Application of ackermann kwangsiensis exopolysaccharide in preparation of anti-aging product

Abstract

The invention provides application of ackermann kwangsiensis exopolysaccharide in preparation of an anti-aging product, and belongs to the technical field of medical application of microbial polysaccharide. The extracellular polysaccharide is extracted from ackermann kwangsiensis by adopting a TCA precipitation method. Animal experiments show that the ackermann kwangsiensis exopolysaccharide can effectively reduce the MDA content in an aging model mouse and improve the SOD activity at the same time; the phenomena that the skin corium layer of the model mouse is thinned, collagenous fibers are reduced, the arrangement is loose and the like tend to age are improved, and the content of hydroxyproline in the skin is increased; in addition, expression of mouse hippocampus BDNF genes and TrKB genes can be activated, and the problems of slow action, cognitive impairment and memory decline of model mice are relieved. Therefore, the ackermann kwangsiensis exopolysaccharide provided by the invention has good anti-aging and antioxidant activity, and can be used for preparing various anti-aging products.

Description

Technical Field

[0001] The invention belongs to the technical field of medical application of microbial polysaccharides, and specifically relates to application of Guangxi Akkermansia exopolysaccharide in the preparation of anti-aging products. Background Art

[0002] Aging is a complex process that occurs naturally in organisms over time, involving the gradual decline in the functions of cells, tissues, and organs. Among them, oxidative stress is one of the important factors leading to aging. As the body ages, the capacity of the intracellular antioxidant system weakens, leading to the accumulation of free radicals such as reactive oxygen species (ROS), which in turn triggers lipid peroxidation, protein oxidation, and DNA damage, accelerating cell aging and dysfunction. Therefore, antioxidant strategies have become an important means to delay aging.

[0003] Extracellular polysaccharides (EPS) are a class of high molecular weight compounds secreted by microorganisms outside the cell during their growth and metabolism, and have multiple biological activities. These polysaccharides not only have good water solubility, stability and biocompatibility, but also exhibit significant biological functions such as antioxidant, anti-inflammatory, immunomodulatory and anti-tumor. In probiotics, extracellular polysaccharides, as important secondary metabolites, not only help probiotics colonize and compete in the intestine, but also promote body health by regulating host immune response and improving intestinal microecological balance.

[0004] Akkermansia muciniphila (Akk bacteria for short) is a probiotic that inhabits the intestinal mucus layer of mammals. Its unique mucin degradation ability makes it one of the key microorganisms for maintaining intestinal health. However, there are currently no reports on the antioxidant and anti-aging effects of Akkermansia exopolysaccharides. Summary of the invention

[0005] In view of this, the object of the present invention is to provide an application of Guangxi Akkermansia exopolysaccharide (EPS) in the preparation of anti-aging products.

[0006] The invention provides an application of Guangxi Akkermansia exopolysaccharide in the preparation of anti-aging products.

[0007] Preferably, the aging includes at least one of the following: cognitive dysfunction, decreased learning ability and memory, slowed movements and reduced exploratory behavior, increased oxidative capacity and skin aging.

[0008] Preferably, the product includes at least one of the following: medicines, health products, foods and cosmetics.

[0009] Preferably, the effective concentration of Akkermansia guangxiensis exopolysaccharide in the product is not less than 10 mg / ml.

[0010] Preferably, the Akkermansia guangxiensis exopolysaccharide includes Akkermansia guangxiensis sp. strain N21116;

[0011] The deposit number of the Guangxi Akkermansia strain N21116 is GDMCC No: 62888.

[0012] Preferably, the method for preparing the extracellular polysaccharide of Akkermansia guangxi comprises separating a liquid phase from a culture broth or fermentation broth of Akkermansia guangxi, removing proteins in the liquid phase, obtaining a pretreated liquid phase, and then precipitating polysaccharides with alcohol to obtain the extracellular polysaccharide of Akkermansia guangxi.

[0013] Preferably, the method for removing the protein in the liquid phase is to remove the protein using trichloroacetic acid;

[0014] The working volume concentration of the trichloroacetic acid is 3.5% to 4.5%.

[0015] Preferably, the alcohol in the alcohol-precipitated polysaccharide comprises an ethanol aqueous solution with a volume concentration of 93% to 97%;

[0016] The volume ratio of the pretreated liquid phase to the alcohol in the alcohol-precipitated polysaccharide is 1:(2-4).

[0017] Preferably, the temperature of the alcohol precipitation of polysaccharide is 3-5°C; and the time of the alcohol precipitation of polysaccharide is not less than 10 hours.

[0018] Preferably, after the alcohol precipitation of the polysaccharide, the precipitated polysaccharide is washed with anhydrous ethanol for 2 to 3 times.

[0019] The present invention provides an application of Guangxi Akkermansia exopolysaccharide in the preparation of anti-aging products. The present invention uses the exopolysaccharide extracted from the culture fluid of Guangxi Akkermansia to carry out inflammation with anti-aging and antioxidant effects. The Guangxi Akkermansia exopolysaccharide can effectively reduce the MDA content in the aging mouse model induced by D-galactose (D-gal), and at the same time improve the SOD activity, and at the same time improve the aging phenomenon such as the thinning of the dermis layer of the mouse skin induced by D-galactose, the reduction and loose arrangement of collagen fibers, and increase the hydroxyproline content of the skin. In addition, it can activate the expression of BDNF and TrKB in the mouse hippocampus, and alleviate the slow movement, cognitive dysfunction and memory decline of the mouse induced by D-galactose. It can be seen that the Guangxi Akkermansia exopolysaccharide provided by the present invention has good anti-aging activity and can be used to prepare a variety of anti-aging products. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The results of the water maze experiment on Akkermansia exopolysaccharide (EPS) in Guangxi intervening in D-gal-induced aging mice;

[0021] Figure 2 The results of the mining experiment on EPS intervention in D-galactose-induced aging mice;

[0022] Figure 3 The results of the detection of biochemical indicators such as SOD and MDA in the serum of D-galactose-induced aging mice after EPS intervention;

[0023] Figure 4 The results of the detection of biochemical indicators such as SOD and MDA in the liver of D-galactose-induced aging mice with EPS intervention;

[0024] Figure 5 The results of the Masson staining experiment on EPS intervention in D-galactose-induced aging mouse skin tissue;

[0025] Figure 6 The experimental results of EPS intervention on the hydroxyproline content in the skin tissue of D-galactose-induced aging mice;

[0026] Figure 7 These are the results of the detection of BDNF signaling pathway expression in the hippocampus of D-galactose-induced aging mice induced by EPS. DETAILED DESCRIPTION

[0027] The invention provides an application of Guangxi Akkermansia exopolysaccharide in the preparation of anti-aging products.

[0028] In the present invention, the Akkermansia guangxiensis exopolysaccharide preferably includes Akkermansia guangxiensis sp. strain N21116. The deposit number of the Akkermansia guangxiensis strain N21116 is preferably GDMCC No: 62888. The Akkermansia guangxiensis strain N21116 is a well-known strain, which is deposited and disclosed in the patent publication number CN116200312A.

[0029] In the present invention, the method for preparing the extracellular polysaccharide of Akkermansia guangxi is preferably to separate the liquid phase from the culture solution or fermentation solution of Akkermansia guangxi, remove the protein in the liquid phase, obtain the pretreated liquid phase, and then precipitate the polysaccharide with alcohol to obtain the extracellular polysaccharide of Akkermansia guangxi. The method for preparing the culture solution or fermentation solution of Akkermansia guangxi is to inoculate the activated Akkermansia guangxi in a BHI culture solution containing a volume concentration of 0.05% hydrochloric acid-L-cysteine ​​for anaerobic culture to obtain a seed solution, and to inoculate the seed solution again in a BHI culture solution containing a volume concentration of 0.05% hydrochloric acid-L-cysteine ​​for expanded culture to obtain a culture solution. The inoculation amount of the seed solution is preferably 5% to 10%, and can be 6% to 8%, or 7%. The anaerobic culture or expanded culture is preferably cultured under anaerobic conditions. The temperature of the anaerobic culture or expanded culture is preferably 36 to 38°C, and can be 37°C. The time of the anaerobic culture is preferably 20 to 24h, and can be 23h. The time for the expanded culture is preferably 40 to 50 hours, and can be 45 to 48 hours.

[0030] In the present invention, the method for separating the liquid phase is preferably centrifugation. The centrifugal force of the centrifugation is preferably 8000-12000g, which can be 10000g. The time of the centrifugation is preferably 8-12min, which can be 10min. The method for removing protein from the liquid phase is preferably to remove protein with trichloroacetic acid. The working volume concentration of trichloroacetic acid is preferably 3.5%-4.5%, which can be 4%. The alcohol in the alcohol-precipitated polysaccharide preferably includes an ethanol aqueous solution with a volume concentration of 93%-97%, which can be an ethanol aqueous solution with a volume concentration of 95%. The volume ratio of the pretreated liquid phase and the alcohol in the alcohol-precipitated polysaccharide is preferably 1: (2-4), which can be 1: 3. The temperature of the alcohol-precipitated polysaccharide is preferably 3-5°C, which can be 4°C; the time of the alcohol-precipitated polysaccharide is preferably not less than 10h, which can be 12-20h, and can also be 15h-18h. After the alcohol-precipitated polysaccharide, it is preferred that the precipitated polysaccharide be washed 2-3 times with anhydrous ethanol.

[0031] In the present invention, the aging preferably includes at least one of the following: cognitive dysfunction, learning ability and memory loss, slow movement and reduced exploratory behavior, increased oxidative capacity and skin aging. In the embodiment of the present invention, the functional verification of the exopolysaccharide of Akkermansia guangxiensis was carried out using a mouse aging model induced by D-galactose as the experimental subject. The daily dosage of the D-galactose was 100 mg / kg, and the administration was continued for 56 days.

[0032] In one embodiment of the present invention, a D-galactose-induced mouse aging model was used as the object, and the Morris water maze experiment was used to detect the learning and memory ability of the mice. The results showed that the escape latency of the model group was significantly prolonged compared with the normal group, while the escape latency of the EPS-administered group was significantly shortened compared with the model group, indicating that its spatial learning and memory ability was significantly enhanced; the exploration experiment after the platform moved showed that the number of times the mice in the extracellular polysaccharide-administered group crossed the third quadrant increased, further proving the improvement of their spatial memory ability.

[0033] In one embodiment of the present invention, a D-galactose-induced mouse aging model was used as the object, and the action ability and exploration ability of mice were detected through a mine field experiment. After the model group mice received galactose-induced aging treatment, they showed aging performance such as slow action and reduced exploratory behavior. After the experimental group mice were given extracellular polysaccharide intervention while receiving galactose-induced aging treatment, they showed more active action and exploratory behavior. The moving distance, moving speed and residence time in the central area of ​​the experimental group mice were significantly higher than those of the model group, indicating that EPS has a significant improvement effect on the behavior of galactose-induced aging mice, and may have potential anti-aging value.

[0034] In one embodiment of the present invention, in order to further explore the molecular mechanism of EPS affecting aging model mice, the expression of BDNF gene and its receptor TrkB gene in the hippocampus of mice was also detected. The results showed that the BDNF gene expression of mice was significantly increased compared with that of the model group, indicating that extracellular polysaccharides have the effect of upregulating BDNF expression; at the same time, compared with the normal control group, the TrkB gene expression of mice in the model group was reduced, and the TrkB gene expression of mice after EPS intervention was increased compared with that of the model group, further supporting the activation effect of extracellular polysaccharides on the BDNF signaling pathway.

[0035] In another embodiment of the present invention, the D-galactose-induced mouse aging model was used as the object, and the effect of EPS on the antioxidant capacity of galactose-induced aging mice was also verified. Compared with the normal control group, the SOD activity of the oxidation index in the serum and liver of the model mice was significantly decreased, and the MDA content was significantly increased; and EPS was able to increase the SOD activity in the serum and liver of mice, while reducing the MDA content. This shows that Akkermansia exopolysaccharide has the ability to increase the antioxidant activity of mouse serum and liver.

[0036] In another embodiment of the present invention, EPS was used to improve skin aging caused by galactose-induced aging mice. Compared with the normal control group, the collagen fiber content in the skin of galactose-induced aging mice was reduced and the arrangement became loose. After EPS intervention, the content and arrangement of collagen fibers in the skin of aging mice were improved, as shown by an increase in the content of collagen fibers and a tighter arrangement. This shows that extracellular polysaccharides have a protective effect on the skin of D-galactose-induced aging mice. At the same time, the EPS can also increase the content of hydroxyproline in skin tissue. Hydroxyproline is one of the imino acids and one of the main components of collagen tissue. Therefore, the content of hydroxyproline in the skin is often detected to assess the content of collagen in the skin, thereby characterizing the degree of skin aging.

[0037] In the present invention, the product preferably includes at least one of the following: medicine, health care product, food and cosmetics. The effective concentration of the exopolysaccharide of Akkermansia guangxiensis in the product is preferably not less than 10 mg / ml, and can be 10-15 mg / ml, or 112-13 mg / ml. The present invention has no special restrictions on the preparation method of the product, and the product preparation method known in the art can be used.

[0038] The application of an extracellular polysaccharide of Akkermansia guianensis provided by the present invention in the preparation of anti-aging products is described in detail below in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0039] Example 1

[0040] A method for extracting extracellular polysaccharide (EPS) from Akkermansia chinensis in Guangxi

[0041] The activated Akkermansia guangxiensis N21116 was inoculated into a BHI culture solution containing hydrochloric acid-L-cysteine ​​(0.05% v / v) for anaerobically culture, and after obtaining the seed solution, the seed solution was inoculated into a BHI culture solution containing hydrochloric acid-L-cysteine ​​(0.05% v / v) at an inoculum amount of 10% (v / v), and cultured at 37°C for 48 hours under an anaerobic environment to obtain a fermentation solution. The fermentation solution was centrifuged at 10000×g for 10 minutes, and the fermentation supernatant was collected for the extraction of exopolysaccharides.

[0042] The fermentation supernatant was added with trichloroacetic acid (TCA) at a final concentration of 4% and mixed evenly to precipitate the protein overnight. After centrifugation at 10,000×g for 10 minutes, the supernatant was collected, and three times the volume of 95% ethanol solution was added to the supernatant while stirring, and then the mixture was stirred evenly and placed in a refrigerator at 4°C overnight. The precipitate was then collected after centrifugation at 10,000×g for 10 minutes, and then dialyzed with a dialysis bag with a filter membrane of 8 to 14 kda, and vacuum freeze-dried to obtain Guangxi Akkermansia exopolysaccharide (EPS).

[0043] The crude polysaccharide prepared above was measured by sulfuric acid-phenol method, and the polysaccharide yield in Guangxi Akkermansia exopolysaccharide (EPS) was 80% to 85%.

[0044] Example 2

[0045] Efficacy verification of Akkermansia exopolysaccharide (EPS) from Guangxi

[0046] 1. Construction of D-galactose (D-gal)-induced aging mouse model

[0047] Thirty C57BL / 6J mice aged 6-8 weeks were selected and randomly divided into a control group, a model group and an experimental group, with 10 mice in each group. After one week of adaptive feeding, the mice in the control group were subcutaneously injected with 200 μl of saline every day, while the mice in the model group and the experimental group were subcutaneously injected with the same volume of D-galactose solution (100 mg / kg) as the saline in the control group every day. At the same time, the mice in the experimental group were gavaged with 200 μl EPS (150 mg / kg) every day for 56 days.

[0048] 2. Water Maze Experiment

[0049] One week before the end of the experiment, the learning and memory ability of mice was tested by Morris water maze test. The diameter of the test pool was 1.2m and the height was 40-50cm. Water was poured into the pool to make the water depth reach 30cm. The pool was divided into 4 quadrants, and a circular platform with a diameter of 9cm and a height of 28cm was fixed in the third quadrant. Food-grade white pigment was added to the water to hide the platform in the water. The photography equipment was set vertically above the center of the water maze pool so that the shooting angle could cover the entire test area. The water temperature was maintained at 22±1℃. During the test, the experimental venue was kept bright and without obvious noise. Day 1: Adaptive training, the mouse was placed facing the pool wall, and the mouse was placed in the water from the east, south, west, and north to familiarize it with the environment. Days 2-5: Formal test, the time it took for the mouse to find the underwater platform (i.e., the escape latency) was recorded. If the mouse did not find the platform within 60s, it was recorded as 60s. Day 6: An exploration experiment was conducted. The platform was removed and the mice were placed in the water from the first quadrant facing the pool wall. The number of times the mice crossed the third quadrant was recorded.

[0050] Results Figure 1 Compared with the aging model group, the mice in the D-galactose + EPS group had significantly shorter escape latency in consecutive days of testing, indicating that their spatial learning and memory abilities were significantly enhanced ( Figure 1 The results of the exploration experiment showed that in the exploration experiment after the platform was removed, the number of times the mice in the exopolysaccharide administration group crossed the third quadrant increased, further proving the improvement of their spatial memory ability ( Figure 1 (middle B).

[0051] 3. Mine experiment

[0052] One week before the end of the experiment, the mice's mobility and exploration ability were tested through a mine field experiment. The experiment was conducted in a quiet environment to reduce the interference of external factors on the mice's behavior. The test box was 50 cm long, 50 cm wide, and 40 cm high, with a white interior to ensure a clear shooting angle and that the mice's behavior was not affected by color.

[0053] Place the camera above the center of the test box, adjust the shooting angle and focal length, and ensure that the shooting angle can cover the entire test area. Perform adaptive feeding and testing on the mice to adapt to the test box environment and reduce stress response. After the adaptive test, place the mice into the test box from the designated corner. Use the camera to record the movement trajectory of the mice 10 minutes after entering the box, including the moving distance, moving speed, exploration area, etc. Before each mouse is tested, clean the test box to avoid interference with the experimental results by the excrement and odor of the previous mouse. Perform data analysis on the recorded mouse movement trajectories and compare the behavioral differences between the experimental and control group mice in the mine experiment.

[0054] Results Figure 2 The mice in the model group showed signs of aging such as slow movement and reduced exploratory behavior after receiving D-galactose-induced aging treatment. The mice in the experimental group showed more active movement and exploratory behavior after receiving D-galactose-induced aging treatment and exopolysaccharide intervention. The moving distance of the mice in the experimental group ( Figure 2 Middle A), Movement Speed ​​( Figure 2 B) and the time spent in the central area ( Figure 2 C) was significantly higher than that in the model group, indicating that extracellular polysaccharides have a significant improvement effect on the behavior of D-galactose-induced aging mice and may have potential anti-aging value.

[0055] 4. Effect of EPS on the antioxidant capacity of D-gal-induced aging mice

[0056] ① Detection of oxidation indexes in serum: At the end of the experiment, blood was collected from the mouse heart to collect serum samples. The activity of SOD and the content of MDA in serum were detected using the corresponding kits.

[0057] Results Figure 3 Compared with the normal control group, the SOD activity in the serum of the mice in the aging model group was significantly reduced, and the MDA content was significantly increased. The SOD activity in the serum of the mice in the extracellular polysaccharide intervention group was significantly higher than that in the aging model group ( Figure 3 A), the MDA content was significantly lower than that of the aging model group ( Figure 3 (B), indicating that Akkermansia exopolysaccharide has the ability to enhance the antioxidant activity of mice.

[0058] ② Detection of oxidation indexes in the liver: After the mice were slaughtered, the abdominal cavity was quickly opened and the liver was taken out. The blood and impurities on the surface of the liver were washed with physiological saline, and then the water was absorbed with filter paper, and an appropriate amount of tissue was taken for subsequent detection of antioxidant indicators. An appropriate amount of liver tissue was taken, and homogenized, centrifuged, and supernatant were taken according to the instructions of the SOD / MDA kit, and then the reaction solution was added for color reaction, the absorbance was measured, and the SOD activity and MDA content were calculated.

[0059] Results Figure 4 Compared with the normal control group, the SOD activity in the liver of the mice in the aging model group was significantly reduced, and the MDA content was significantly increased, indicating that D-gal-induced aging led to a decrease in the antioxidant capacity of the liver. The SOD activity in the liver of the mice in the extracellular polysaccharide intervention group was significantly higher than that in the aging model group ( Figure 4 A), the MDA content was significantly lower than that of the aging model group ( Figure 4 (B), indicating that extracellular polysaccharides can enhance the antioxidant capacity of the liver.

[0060] 5. EPS improves skin aging caused by D-gal-induced aging mice

[0061] ① Masson staining experiment of skin tissue: After the mice were slaughtered, the backs of the mice were depilated and the back skin was taken. The skin tissue was fixed, dehydrated, waxed and embedded to prepare paraffin sections. The skin was stained with a Masson staining kit, and the sections were sealed with neutral gum. The sections were observed under a microscope, and images were collected and analyzed.

[0062] Results Figure 5 . Collagen fibers were stained blue (counterstained with aniline blue), and muscle fibers and cellulose were stained red. The skin tissue structure was clear, and collagen fibers and muscle fibers were clearly distinguished. Compared with the control group ( Figure 5 Middle A), D-gal induces a decrease in collagen fiber content in the skin of aging mice, and the arrangement becomes loose ( Figure 5 Middle B). After the intervention of extracellular polysaccharide, the content and arrangement of collagen fibers in the skin of aged mice were improved, as shown by an increase in the content of collagen fibers and a tighter arrangement ( Figure 5 (C) shows that exopolysaccharides have a protective effect on the skin of D-gal-induced aging mice. Akkermansia exopolysaccharides have a significant anti-aging effect.

[0063] ② Experiment on determination of hydroxyproline content in skin tissue: After the mice were slaughtered, the backs of the mice were depilated and the back skin tissue was taken as samples. The freshness of the samples was ensured and they were immediately frozen to prevent the degradation of hydroxyproline. According to the instructions of the hydroxyproline content determination kit, hydroxyproline in the skin tissue was extracted and its content was determined.

[0064] Results Figure 6 . Compared with the control group, the hydroxyproline content in the skin of D-gal-induced aged mice was significantly reduced. After the intervention of extracellular polysaccharides, the hydroxyproline content in the skin of aged mice was increased. This shows that extracellular polysaccharides have a significant anti-aging effect and can improve the hydroxyproline content in the skin.

[0065] 6. EPS activates BDNF signaling pathway in the hippocampus

[0066] After the mice were slaughtered, the hippocampal tissues of the mice were collected, immediately frozen in liquid nitrogen, and then transferred to -80°C for storage. Weigh 0.02 g of tissue, and use the Trizol method to extract total RNA from brain and hippocampal tissues according to the instructions of R001 BetterZol Reagent (Beijing Jinbaite Biotechnology Co., Ltd.). RNA was converted into cDNA according to the reverse transcription kit (Tiangen Biochemical Technology Co., Ltd.) and used as a template for qPCR. According to the sequence information of BDNF pathway-related genes (BDNF, receptor TrkB), specific primers were designed and synthesized (Table 1). The qPCR reaction was performed in the QuantStudioTM System, and the fluorescence quantification program was: amplification curve: 94°C 30s, 94°C 15s, 58°C 30s, for 40 cycles; melting curve: 95°C 15s, 60°C 1min, 95°C 15s. The housekeeping gene GAPDH was used as the internal reference, and 2 ﹣△△Ct The target gene was quantitatively analyzed.

[0067] Table 1 Fluorescence quantitative PCR primers

[0068] Primer pairs Sequence (5'-3') GAPDH-F GTGGAGTCATACTGGAACATGTAG(SEQ ID NO:1) GAPDH-R AATGGTGAAGGTCGGTGTG(SEQ ID NO:2) BDNF-F AGAGCTGTTGGATGAGGACCAG(SEQ ID NO:3) BDNF-R CAAAGGCACTTGACTACTGAGCA(SEQ ID NO:4) TrkB-F CTGGGGCTTATGCCCTGCTG(SEQ ID NO:5) TrkB-R AGGCTCAGTACACCAAATCCTA(SEQ ID NO:6)

[0069] Results Figure 7 Compared with the normal control group, the expression of BDNF gene in the hippocampus of mice in the D-galactose-induced aging model group was significantly reduced. The BDNF gene expression in the EPS-administered group was significantly increased compared with the model group ( Figure 7 A in the middle), indicating that EPS has the effect of upregulating the expression of the BDNF gene. TrkB is the main receptor of BDNF, and changes in its expression level reflect the activity of the BDNF signaling pathway. Compared with the normal control group, the TrkB gene expression of mice in the model group was reduced, and the TrkB gene expression of mice in the exopolysaccharide treatment group was increased compared with the model group ( Figure 7 Middle B), further supporting the activation of BDNF signaling pathway by EPS.

[0070] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Application of Guangxi Akkermansia exopolysaccharide in the preparation of anti-aging products.

2. The application according to claim 1, characterized in that: The aging includes at least one of the following: cognitive dysfunction, decreased learning ability and memory, slowed movements and reduced exploratory behavior, increased oxidative capacity and skin aging.

3. The application according to claim 1, characterized in that: The product includes at least one of the following: medicine, health care product, food and cosmetics.

4. The use according to claim 1, characterized in that: The effective concentration of Guangxi Akkermansia exopolysaccharide in the product is not less than 10 mg / ml.

5. The use according to claim 1, characterized in that: The Akkermansia guangxiensis exopolysaccharide includes Akkermansia guangxiensis sp. strain N21116; The deposit number of the Guangxi Akkermansia strain N21116 is GDMCC No: 62888.

6. The use according to claim 1 or 4, characterized in that: The method for preparing the extracellular polysaccharide of Akkermansia guangxi comprises the steps of separating a liquid phase from a culture solution or a fermentation solution of Akkermansia guangxi, removing proteins in the liquid phase, obtaining a pretreated liquid phase, and then precipitating polysaccharides with alcohol to obtain the extracellular polysaccharide of Akkermansia guangxi.

7. The use according to claim 6, characterized in that: The method for removing the protein in the liquid phase is to remove the protein with trichloroacetic acid; The working volume concentration of the trichloroacetic acid is 3.5% to 4.5%.

8. The use according to claim 6, characterized in that: The alcohol in the alcohol-precipitated polysaccharide comprises an ethanol aqueous solution with a volume concentration of 93% to 97%; The volume ratio of the pretreated liquid phase to the alcohol in the alcohol-precipitated polysaccharide is 1:(2-4).

9. The use according to claim 6, characterized in that: The temperature of the alcohol precipitation of polysaccharide is 3-5°C; the time of the alcohol precipitation of polysaccharide is not less than 10 hours.

10. The use according to claim 6, characterized in that: After the alcohol precipitation of the polysaccharide, the method further comprises washing the precipitated polysaccharide with anhydrous ethanol for 2 to 3 times.

Images