Application of an antifreeze protein in weight loss and blood sugar reduction

By constructing an NPAFP transgenic mouse model, using NPAFP protein to regulate brown fat metabolism and liver lipid droplet content, the existing weight loss and glucose-lowering methods have been solved, and significant weight loss and glucose-lowering effects have been achieved.

CN119770624BActive Publication Date: 2025-07-08HIGENE (HANGZHOU) BIOTECHNOLOGY CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510296991.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-13
Publication Date
2025-07-08
Estimated Expiration
2045-03-13

AI Technical Summary

Technical Problem

The existing weight loss and glucose-lowering methods have limited efficacy, side effects or limited scope of application, and multi-target strategies have not been fully developed.

Method used

Genetic engineering technology was used to construct an NPAFP transgenic mouse model, and by regulating brown fat metabolism and liver lipid drop content, NPAFP protein was used as an active ingredient to develop a drug composition for weight loss and lowering sugar.

Benefits of technology

NPAFP protein significantly reduces fat accumulation and improves blood sugar levels, provides new drug strategies for treating obesity and diabetes, and has significant weight loss and lowering glycemic effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119770624B_ABST
    Figure CN119770624B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of biomedical technology, and specifically relates to the application of an antifreeze protein in weight loss and blood glucose reduction. The present invention successfully constructs an NPAFP transgenic mouse model by using genetic engineering technology, and verifies the potential application value of the NPAFP protein in weight loss and blood glucose reduction. Further, based on this model, it is found that the NPAFP protein has a significant effect on reducing fat accumulation and improving blood glucose levels by regulating brown fat metabolism and liver lipid droplet content. The development of compounds or protein engineering modification based on the NPAFP protein of the present invention can provide new drugs and strategies for the treatment of obesity and diabetes. At the same time, further exploring the molecular mechanism of the NPAFP protein by combining multi-omics technologies helps to promote its clinical translation and application.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to the application of an antifreeze protein in weight loss and blood glucose reduction. Background Art

[0002] With the improvement of people's living standards, the dietary structure has also begun to change. Irregular eating habits have led to an increasing incidence of metabolic syndrome (MS) year by year, and there is a trend of getting younger. After the development of metabolic syndrome, it can cause various harms to the human body, such as obesity, insulin resistance, hyperinsulinemia, diabetes, coronary heart disease, hypertension, stroke, and even lead to certain cancers, including pancreatic cancer, hepatobiliary cancer, colon cancer, etc. Among them, weight loss and blood glucose reduction are important topics in the current research on metabolic diseases. Obesity is a controllable risk factor for many diseases. In particular, visceral adipose tissue can regulate pro-inflammatory cytokines (such as interleukin-6), leading to inflammation, oxidative stress and insulin resistance, thus increasing the risk of chronic diseases (Thomas DM, Brdau C, Bosy-Wesiphal A, et al. Relationships between body roundness with body fat and viseeral adipose tissue e-menging from a new geometrical model [J]. Obesity( Silver Spring), 2013, 21(11):2264 -2271.). The main characteristics of T2DM are hyperglycemia caused by insulin resistance and pancreatic β-cell dysfunction, as well as persistent low-grade inflammation in peripheral tissues. Obesity, unhealthy eating habits, lack of exercise, and various pathophysiological disorders caused by environmental and genetic factors will result in impaired glucose homeostasis in T2DM (DeFronzo RA, Ferrannini E, Groop L, et al. Type 2 diabetes mellitus. Nat Rev Dis Primers. 2015 Jul 23;1:15019.). Studies have shown that the prevalence of T2DM increases proportionally with the increase in body weight. The BMI increases from normal 25 kg / m 2 to 30 kg / m 2, the risk of death related to T2DM more than doubles (Magkos F, Hjorth MF, Astrup A. Diet and exercise in the prevention and treatment of type 2 diabetes mellitus. Nat Rev Endocrinol. 2020 Oct;16(10):545-555.). In addition, excessive intake of carbohydrates can lead to insulin resistance and may advance the onset time of people genetically predisposed to T2DM. In patients with T2DM and obesity, a weight loss of about 15 kg can relieve the condition of 80% of T2DM patients (Jao CL, Hung CC, Tung YS, et al. The development of bioactive peptides from dietary proteins as a dipeptidyl peptidase IV inhibitor for the management of type 2 diabetes. Biomedicine. 2015 Sep;5(3):14.).

[0003] Current treatment methods include lifestyle intervention, drug treatment, and metabolic surgery, etc. The 2017 AACE / ACE Consensus Statement newly proposed that weight loss should be a long-term goal. For prediabetic and type 2 diabetes patients who are already overweight or obese, behavioral intervention and weight loss drugs should be used when necessary, emphasizing the importance of weight loss in disease management. Weight loss can reduce insulin resistance, increase the hypoglycemic effect, and also improve lipid metabolism and blood pressure. The 2017 AACE / ACE Consensus Statement first recommends lifestyle intervention and weight loss drugs can be added when necessary. Weight loss drugs can be used for all patients with a BMI≥27 kg / m 2 and with complications or a BMI≥30 kg / m 2patients (Garber AJ, Handelsman Y, Grunberger G, et al. CONSENSUS STATEMENT BY THE AMERICAN ASSOCIATION OF CLINICAL ENDOCRINOLOGISTS AND AMERICAN COLLEGE OF ENDOCRINOLOGY ON THE COMPREHENSIVE TYPE 2 DIABETES MANAGEMENT ALGORITHM - 2020 EXECUTIVE SUMMARY. Endocr Pract. 2020 Jan;26(1):107 - 139.). Studies have shown that the mechanism of action of weight - loss and blood - sugar - lowering compounds involves multiple biological pathways, which mainly focus on aspects such as the regulation of fat metabolism, blood - sugar metabolism, and the balance of gut microbiota. Compounds of natural origin, such as polyphenols and flavonoid compounds, have been widely studied due to their low toxicity and multi - target effects. For example, resveratrol and green tea polyphenols can promote fat breakdown and enhance insulin sensitivity by activating the AMPK signaling pathway; quercetin and astragaloside IV can significantly improve insulin resistance and lipid metabolism by regulating the expression of metabolism - related genes. In addition, synthetic compounds, such as the GLP - 1 receptor agonist semaglutide, and metabolites derived from gut microbiota (such as short - chain fatty acids), also show unique effects in fat breakdown, glucose metabolism, and gut microbiota regulation. These studies reveal the complexity of metabolic regulation and suggest that a multi - target strategy may be the key to future drug development. However, existing treatment methods have problems such as limited efficacy, obvious side effects, or restricted scope of application. Therefore, developing more efficient and safe weight - loss and blood - sugar - lowering compounds and exploring their mechanism of action have become a hot research direction.

[0004] Antifreeze proteins (AFPs) are a general term for different structurally ice-binding proteins that can enhance the freeze resistance of organisms. They were initially discovered in Antarctic fish and were defined as antifreeze agents. To date, AFPs have been found in different organisms, and the main categories include: teleost fish, insects, plants, fungi, nematodes, amphibians, bacteria, and diatoms. There are significant differences in the structures of antifreeze proteins from different species sources, and no obvious homology has been found from the perspective of genetic genes, only maintaining consistency in the antifreeze function. The adsorption process between antifreeze proteins and the ice crystal surface is specific, and different types of antifreeze proteins may bind to crystal planes with different crystal orientations on the ice crystal surface; after binding to the ice crystal surface, antifreeze proteins can lower the ice crystal growth point temperature, and in this way, antifreeze proteins can limit the growth of ice crystals and inhibit the recrystallization phenomenon of ice crystals (Graham L A, Hobbs R S, Flet alher G L, et al. HelicalAntifreeze Proteins Have Independently Evolved in Fishes on Four Occasions[J]. Plos One, 2013, 8(12):81285.). The protective function of AFP benefits from its properties, including ice surface affinity, thermal hysteresis, ice recrystallization inhibition, and temporarily binding the organism to ice. Different properties produce different antifreeze effects. Although multiple antifreeze properties of AFP can usually be detected, its antifreeze effect is mainly based on one property. Generally speaking, all these properties or effects stem from the protein's ability to bind to ice (Xiang H, Yang X, Ke L,et al. Theproperties, biotechnologies, and applications of antifreeze proteins. Int JBiol Macromol. 2020 Jun 15;153:661-675.). In recent years, with the gradual clarification of the properties and action mechanisms of AFP, its applications have become increasingly widespread, including in the fields of cryomedicine, agriculture, food industry, environmental monitoring, and ice prevention materials, etc.

[0005] Antifreeze proteins can be roughly divided into four categories according to their species sources: fish antifreeze proteins, insect antifreeze proteins, plant antifreeze proteins, and microbial antifreeze proteins. Among them, the antifreeze proteins isolated from fish are further divided into six types, namely type I, II, III, and IV antifreeze proteins (AFP I, AFP II, AFP III, AFP IV), antifreeze glycoproteins (AFGPs), and hyperactive antifreeze proteins (Hyperactive-AFP) according to the differences in the primary structure and configuration of the proteins (Guo Tinghe. Irreversible Random Adsorption Inhibition Model of the Thermal Hysteresis Activity of Antifreeze Proteins [D]. 2022). Among them, antifreeze protein III (AFP III) is one of the most widely used and non-toxic cryoprotectants discovered so far. There have been reports on adding AFP III to freeze ovaries, sperm, and oocytes, etc., but most of them tend to focus on developmental research. There are huge differences in the structures of antifreeze proteins from different species sources, and no obvious homology has been found from the perspective of genetic genes, only maintaining consistency in the antifreeze function.

[0006] In previous research (“Evolution of an antifreeze protein by neofunctionalization under escape from adaptive conflict”, Deng et al. PNAS, 2010.), it was first discovered and proven that the Antarctic fish Lycodichthys dearborni evolved an antifreeze protein AFPIII through neofunctionalization during the process of escaping adaptive conflict, and it was named LdAFPII. This protein evolved from SAS-B and has multiple repeats of functional domains (such as LdAFPIII-1 with one repeat functional domain, LdAFPIII-4 with four repeat functional domains, LdAFPIII-12 with twelve repeat functional domains, etc.). Each AFPIII domain contains 62 amino acids. The sequence of the LdAFPII protein was disclosed in a previous study (“Cloning and Evolutionary Analysis of the Polymorphic Type III Antifreeze Protein Gene of Antarctic Eel Pout (Lycodichthys dearborni)”, Yu Jing et al., Acta Genetica Sinica, 2005, 32 (8): 789-794). Summary of the Invention

[0007] The present invention successfully constructed an NPAFP transgenic mouse model using genetic engineering technology and found that the NPAFP protein has a significant effect on reducing fat accumulation and improving blood glucose levels by regulating brown fat metabolism and liver lipid droplet content. Based on this, the present invention was completed.

[0008] In a first aspect, the present invention provides a pharmaceutical composition for weight loss and blood sugar reduction, and the active ingredient of the pharmaceutical composition is NPAFP protein.

[0009] Furthermore, the NPAFP protein is selected from one or more of NPAFP1, NPAFP2, NPAFP3, NPAFP4, NPAFP5, NPAFP6, NPAFP7, NPAFP8, NPAFP9, NPAFP10, NPAFP11 and / or NPAFP12.

[0010] Preferably, the NPAFP protein is selected from one or more of NPAFP1, NPAFP2, NPAFP3, NPAFP4 and / or NPAFP12.

[0011] Furthermore, the nucleotide sequence of the NPAFP1 protein is as shown in SEQ ID NO.1; the nucleotide sequence of the NPAFP2 protein is as shown in SEQ ID NO.2; the nucleotide sequence of the NPAFP3 protein is as shown in SEQ ID NO.3; the nucleotide sequence of the NPAFP4 protein is as shown in SEQ ID NO.4; the nucleotide sequence of the NPAFP12 protein is as shown in SEQ ID NO.5.

[0012] Furthermore, the obesity is divided into primary obesity and secondary obesity.

[0013] Furthermore, the diabetes can be divided into insulin-dependent type 1 diabetes (T1DM) and non-insulin-dependent type 2 diabetes (T2DM).

[0014] In a second aspect, the present invention provides the use of NPAFP protein in the preparation of a drug for treating obesity and / or diabetes.

[0015] Furthermore, the NPAFP protein is selected from one or more of NPAFP1, NPAFP2, NPAFP3, NPAFP4, NPAFP5, NPAFP6, NPAFP7, NPAFP8, NPAFP9, NPAFP10, NPAFP11 and / or NPAFP12.

[0016] Preferably, the NPAFP protein is selected from one or more of NPAFP1, NPAFP2, NPAFP3, NPAFP4 and / or NPAFP12.

[0017] Further, the nucleotide sequence of the NPAFP1 protein is as shown in SEQ ID NO.1; the nucleotide sequence of the NPAFP2 protein is as shown in SEQ ID NO.2; the nucleotide sequence of the NPAFP3 protein is as shown in SEQ ID NO.3; the nucleotide sequence of the NPAFP4 protein is as shown in SEQ ID NO.4; the nucleotide sequence of the NPAFP12 protein is as shown in SEQ ID NO.5.

[0018] Further, one or more pharmaceutically acceptable carriers may also be added to the drug.

[0019] Further, the drug can be formulated into various dosage forms, including but not limited to one or more of tablets, capsules, aerosols, pills, powders, solutions, suspensions, emulsions, granules, liposomes, transdermal agents, and / or suppositories.

[0020] Further, the preparation can be one or more of an ordinary preparation, a sustained-release preparation, and / or a controlled-release preparation.

[0021] Further, for various preparations, colorants, preservatives, fragrances, flavoring agents, sweeteners, or other materials can also be added to the pharmaceutical preparation as needed.

[0022] Further, the drug can be administered by injection, via a body cavity, or by inhalation.

[0023] Furthermore, the injection administration includes subcutaneous injection, intravenous injection, intramuscular injection, and intracavitary injection, etc.; the administration via a body cavity includes rectal or vaginal administration; the administration by inhalation includes nasal administration.

[0024] Further, obesity is divided into primary obesity and secondary obesity.

[0025] Further, diabetes can be divided into insulin-dependent type 1 diabetes (T1DM) and non-insulin-dependent type 2 diabetes (T2DM).

[0026] Fourthly, the present invention provides the use of the NPAFP protein in constructing an animal model of obesity and / or diabetes.

[0027] Further, the NPAFP protein is selected from one or more of NPAFP1, NPAFP2, NPAFP3, NPAFP4, NPAFP5, NPAFP6, NPAFP7, NPAFP8, NPAFP9, NPAFP10, NPAFP11, and / or NPAFP12.

[0028] Preferably, the NPAFP protein is selected from one or more of NPAFP1, NPAFP2, NPAFP3, NPAFP4, and / or NPAFP12.

[0029] Furthermore, the nucleotide sequence of the NPAFP1 protein is as shown in SEQ ID NO.1; the nucleotide sequence of the NPAFP2 protein is as shown in SEQ ID NO.2; the nucleotide sequence of the NPAFP3 protein is as shown in SEQ ID NO.3; the nucleotide sequence of the NPAFP4 protein is as shown in SEQ ID NO.4; the nucleotide sequence of the NPAFP12 protein is as shown in SEQ ID NO.5.

[0030] Furthermore, the animals in the animal model include rodents, large mammals, and non-human primates.

[0031] Still further, the rodents include, but are not limited to, mice, rats, and rabbits.

[0032] Furthermore, the large mammals include, but are not limited to, pigs and dogs.

[0033] Furthermore, the non-human primates include, but are not limited to, rhesus monkeys and cynomolgus monkeys.

[0034] Furthermore, the obesity is divided into primary obesity and secondary obesity.

[0035] Furthermore, the diabetes can be divided into insulin-dependent type 1 diabetes (T1DM) and non-insulin-dependent type 2 diabetes (T2DM).

[0036] In a fifth aspect, the present invention provides a method for constructing an animal model of obesity and / or diabetes, wherein the animal model is an NPAFP transgenic mouse constructed by using gene editing technology to insert the NPAFP gene into the mouse H11 gene locus and expressing different numbers of AFP III functional domains.

[0037] Furthermore, the NPAFP protein is selected from one or more of NPAFP1, NPAFP2, NPAFP3, NPAFP4, NPAFP5, NPAFP6, NPAFP7, NPAFP8, NPAFP9, NPAFP10, NPAFP11, and / or NPAFP12.

[0038] Preferably, the NPAFP protein is selected from one or more of NPAFP1, NPAFP2, NPAFP3, NPAFP4, and / or NPAFP12.

[0039] Furthermore, the nucleotide sequence of the NPAFP1 protein is as shown in SEQ ID NO.1; the nucleotide sequence of the NPAFP2 protein is as shown in SEQ ID NO.2; the nucleotide sequence of the NPAFP3 protein is as shown in SEQ ID NO.3; the nucleotide sequence of the NPAFP4 protein is as shown in SEQ ID NO.4; the nucleotide sequence of the NPAFP12 protein is as shown in SEQ ID NO.5.

[0040] Beneficial effects

[0041] 1. The present invention successfully constructed an NPAFP transgenic mouse model using genetic engineering technology, and verified the potential application value of the NPAFP protein in weight loss and blood glucose reduction.

[0042] 2. The present invention found that the NPAFP protein has a significant effect on reducing fat accumulation and improving blood glucose levels by regulating brown fat metabolism and liver lipid droplet content.

[0043] 3. Based on the compound development or protein engineering modification of the NPAFP protein of the present invention, it can provide new drugs and strategies for the treatment of obesity and diabetes. At the same time, further exploring the molecular mechanism of the NPAFP protein by combining multi-omics technologies will help promote its clinical transformation and application. Brief description of the drawings

[0044] Figure 1 Is the construction method of NPAFP mice.

[0045] Figure 2 Is the regulation of brown fat metabolism by the NPAFP protein.

[0046] Figure 3 Is the NPAFP reducing the density of lipid droplets in brown fat.

[0047] Figure 4 Is the NPAFP protein reducing liver lipid droplet accumulation.

[0048] Figure 5 Is the NPAFP protein reducing the blood glucose level of mice. Detailed implementation manners

[0049] The following further describes the detailed implementation manners of the present invention. It should be noted here that the description of these implementation manners is for helping to understand the present invention, but does not constitute a limitation to the present invention. In addition, the technical features involved in the following described implementation manners can be combined with each other as long as they do not conflict with each other.

[0050] The experimental methods in the following examples are all conventional methods unless otherwise specified, and the test materials used in the following examples can all be obtained through conventional commercial channels unless otherwise specified.

[0051] The NPAFP (NeuroProtect AFP) in the present invention is antifreeze protein III. The NPAFP protein is selected from one or more of NPAFP1, NPAFP2, NPAFP3, NPAFP4, NPAFP5, NPAFP6, NPAFP7, NPAFP8, NPAFP9, NPAFP10, NPAFP11, and / or NPAFP12.

[0052] Each AFPIII domain contains 62 amino acids. In the present invention, alphafold3 is used for protein structure prediction and optimization, changing the amino acids at positions 36 and 37 from KL to RI, and the amino acid at position 50 from D to E to increase the flexibility of the protein structure. To explore its application in neurological diseases, it is named NeuroProtection AFPIII (such as NPAFP1, NPAFP4, NPAFP12, etc.).

[0053] The nucleotide sequence of the NPAFP1 protein in the present invention is shown in SEQ ID NO.1:

[0054] ATGAAGTCAGTTGTTTTAACTGGTTTGCTGTTCGTCCTCCTTTGTGTCGACCACATGAGTTCAGCCAACAAGGCGTCCGTGGTGGCCAACCAGCTGATCCCCATAAATACTGCCCTGACTCTAGTGATGATGAAGGCGGAGGAAGTCAGCCCAAAGGGCATCCCTGCCGAGGAGATCCCCAGAATAGTGGGAATGCAAGTGAACAGGGCAGTGTATCTGGAGCAAACCCTCATGCCAGATATGGTGAAAAACTATGAATAA

[0055] The nucleotide sequence of the NPAFP2 protein in the present invention is shown in SEQ ID NO.2:

[0056] ATGAAGTCAGTTGTTTTAACTGGTTTGCTGTTCGTCCTCCTTTGTGTCGACCACATGAGTTCAGCCAACAAGGCGTCCGTGGTGGCCAACCAGCTGATCCCCATAAATACTGCCCTGACTCTAGTGATGATGAAGGCGGAGGAAGTCAGCCCAAAGGGCATCCCTGCCGAGGAGATCCCCAGAATAGTGGGAATGCAAGTGAACAGGGCAGTGTATCTGGAGCAAACCCTCATGCCAGATATGGTGAAAAACTATGAAGATGTGACGACATGTCCAGGCTTTAAGTCCGTGGTGGCCAACCAGCTGATCCCCATAAATACTGCCCTGACTCTAGTGATGATGAAGGCGGAGGAAGTCAGCCCAAAGGGCATCCCTGCCGAGGAGATCCCCAGAATAGTGGGAATGCAAGTGAACAGGGCAGTGTATCTGGAGCAAACCCTCATGCCAGATATGGTGAAAAACTATGAATAA

[0057] The nucleotide sequence of the NPAFP3 protein described in the present invention is shown in SEQ ID NO.3:

[0058] ATGAAGTCAGTTGTTTTAACTGGTTTGCTGTTCGTCCTCCTTTGTGTCGACCACATGAGTTCAGCCAACAAGGCGTCCGTGGTGGCCAACCAGCTGATCCCCATAAATACTGCCCTGACTCTAGTGATGATGAAGGCGGAGGAAGTCAGCCCAAAGGGCATCCCTGCCGAGGAGATCCCCAGAATAGTGGGAATGCAAGTGAACAGGGCAGTGTATCTGGAGCAAACCCTCATGCCAGATATGGTGAAAAACTATGAAGATGTGACGACATGTCCAGGCTTTAAGTCCGTGGTGGCCAACCAGCTGATCCCCATAAATACTGCCCTGACTCTAGTGATGATGAAGGCGGAGGAAGTCAGCCCAAAGGGCATCCCTGCCGAGGAGATCCCCAGAATAGTGGGAATGCAAGTGAACAGGGCAGTGTATCTGGAGCAAACCCTCATGCCAGATATGGTGAAAAACTATGAAGATGTGACGACATGTCCAGGCTTTAAGTCCGTGGTGGCCAACCAGCTGATCCCCATAAATACTGCCCTGACTCTAGTGATGATGAAGGCGGAGGAAGTCAGCCCAAAGGGCATCCCTGCCGAGGAGATCCCCAGAATAGTGGGAATGCAAGTGAACAGGGCAGTGTATCTGGAGCAAACCCTCATGCCAGATATGGTGAAAAACTATGAA

[0059] The nucleotide sequence of the NPAFP4 protein described in the present invention is shown in SEQ ID NO.4:

[0060] ATGAAGTCAGTTGTTTTAACTGGTTTGCTGTTCGTCCTCCTTTGTGTCGACCACATGAGTTCAGCCAACAAGGCGTCCGTGGTGGCCAACCAGCTGATCCCCATAAATACTGCCCTGACTCTAGTGATGATGAAGGCGGAGGAAGTCAGCCCAAAGGGCATCCCTGCCGAGGAGATCCCCAGAATAGTGGGAATGCAAGTGAACAGGGCAGTGTATCTGGAGCAAACCCTCATGCCAGATATGGTGAAAAACTATGAAGATGTGACGACATGTCCAGGCTTTAAGTCCGTGGTGGCCAACCAGCTGATCCCCATAAATACTGCCCTGACTCTAGTGATGATGAAGGCGGAGGAAGTCAGCCCAAAGGGCATCCCTGCCGAGGAGATCCCCAGAATAGTGGGAATGCAAGTGAACAGGGCAGTGTATCTGGAGCAAACCCTCATGCCAGATATGGTGAAAAACTATGAAGATGTGACGACATGTCCAGGCTTTAAGTCCGTGGTGGCCAACCAGCTGATCCCCATAAATACTGCCCTGACTCTAGTGATGATGAAGGCGGAGGAAGTCAGCCCAAAGGGCATCCCTGCCGAGGAGATCCCCAGAATAGTGGGAATGCAAGTGAACAGGGCAGTGTATCTGGAGCAAACCCTCATGCCAGATATGGTGAAAAACTATGAAGATGTGACGACATGTCCAGGCTTTAAGTCCGTGGTGGCCAACCAGCTGATCCCCATAAATACTGCCCTGACTCTAGTGATGATGAAGGCGGAGGAAGTCAGCCCAAAGGGCATCCCTGCCGAGGAGATCCCCAGAATAGTGGGAATGCAAGTGAACAGGGCAGTGTATCTGGAGCAAACCCTCATGCCAGATATGGTGAAAAACTATGAATAA

[0061] The nucleotide sequence of the NPAFP12 protein described in the present invention is shown in SEQ ID NO.5:

[0062]

[0063] Example 1 Construction of Animal Model

[0064] To explore the regulatory effects of NPAFP protein on fat and blood glucose in vivo, NPAFP transgenic mice containing different AFPIII domains were constructed ( Figure 1 ). A plasmid (Donorvector) expressing NPAFP protein was constructed using the CAG promoter. First, the CRISPR / Cas9 system and Donor vector samples were microinjected into fertilized eggs of mice with a C57BL / 6JGpt background. Through homologous recombination technology, the NPAFP expression plasmid was inserted into the H11 locus of C57BL / 6 mice; the surviving fertilized eggs after injection were transplanted into pseudopregnant female mice and allowed to give birth. Genomic DNA was extracted from the F0 generation pups born to the recipient mice at 5 - 7 days for PCR and sequencing identification to confirm the genotype. After the positive F0 generation mice reached sexual maturity, they were mated with wild-type background mice. Genomic DNA was extracted from the F1 generation mice born at 5 - 7 days for PCR and sequencing identification to confirm the genotype. The F1 generation mice were continuously mated with WT for breeding, and the offspring were subjected to genotype identification. Three-month-old sibling heterozygotes and WT mice were perfused and fixed for further section staining and blood glucose measurement.

[0065] During the construction process, specific primers for the NPAFP gene were designed at the 5' and 3' ends of the insertion site, as well as in the upstream and downstream regions of the insertion site (see Figure 1 B), in order to identify the genotype of mice through PCR electrophoresis technology (see Figure 1 C - D). Currently, transgenic mice that stably inherit and express NPAFP1, NPAFP4, and NPAFP12 proteins have been successfully obtained. These transgenic mice will be used to verify the role of NPAFP in diseases related to weight loss and blood glucose reduction. Three-month-old sibling transgenic heterozygous mice and WT mice were perfused and fixed for further section staining and blood glucose measurement.

[0066] Table 1. Specific Primers for the Construction of Homozygous Mice Models for Weight Loss and Blood Glucose Reduction

[0067] 5’ arm F 1 AGTCTTTCCCTTGCCTCTGCT R 1 AGGCGGGCCATTTACCGTAAGTTA 3’ arm F 2 TCAATCCAGCGGACCTTCCTT R 2 ATATCCCCTTGTTCCCTTTCTGC WT F 3 AGTCTTTCCCTTGCCTCTGCT R 3 GGGTCTTCCACCTTTCTTCAG

[0068] Table 2. Specific Primers for the Construction of Heterozygous Mice Models for Weight Loss and Blood Glucose Reduction

[0069] 5’ arm F 1 AGTCTTTCCCTTGCCTCTGCT R 1 AGGCGGGCCATTTACCGTAAGTTA 3’ arm F 2 TCAATCCAGCGGACCTTCCTT R 2 GGGTCTTCCACCTTTCTTCAG WT F 3 AGTCTTTCCCTTGCCTCTGCT R 3 GGGTCTTCCACCTTTCTTCAG

[0070] Example 2 Histomorphological Detection

[0071] 2.1 HE staining: Detect the tissue morphology of the liver and brown adipose tissue, and observe the distribution of lipid droplets and the density of organelles

[0072] Anesthetize the mice with isoflurane, and then perfuse them with PBS and 4% neutral buffered formaldehyde solution respectively. Take fresh liver and brown adipose tissue, and fix them with 4% neutral buffered formaldehyde solution. Dehydrate the fixed tissue successively according to gradient concentrations (70%, 80%, 95%, 100%). Make the tissue transparent with xylene. Immerse the transparent tissue in liquid paraffin, embed it and prepare paraffin blocks. Cut the tissue into sections, lay the sections flat on glass slides, and dry and fix them. Remove the wax with xylene, then rehydrate step by step through gradient ethanol (100%, 95%, 80%, 70%), and then wash with distilled water. Immerse the sections in hematoxylin staining solution for staining, rinse with tap water, then differentiate with 1% hydrochloric acid alcohol, and then rinse thoroughly with tap water to blue. Immerse the sections in eosin staining solution for staining, and rinse with distilled water. Dehydrate successively with gradient ethanol (70%, 80%, 95%, 100%), then make transparent with xylene, and finally seal the slides with neutral gum. After the sealed slides are dried, observe the histological structure and staining effect under a microscope.

[0073] As Figure 2 shown, larger lipid droplets appeared in the brown adipose tissue cells of the control group WT mice, and the density of organelles was less. However, the number of lipid droplets in the brown adipose tissue cells of NPAFP1 mice decreased, and the density of organelles increased relatively. And the number of lipid droplets in the brown adipose tissue cells of NPAFP4 and NPAFP12 mice was very small, and the density of organelles increased significantly. The above results indicate that NPAFP protein can significantly improve the metabolic characteristics of brown adipose, and its effect is positively correlated with the number of AFPIII domains.

[0074] 2.2 Oil Red O staining: Evaluate the number and size of lipid droplets in the liver and brown adipose tissue

[0075] Anesthetize the mice with isoflurane, and then perfuse them with PBS and 4% neutral buffered formaldehyde solution respectively. Take fresh fixed liver and adipose tissue, and fix them with 4% paraformaldehyde. Dehydrate the fixed tissue with 15% and 30% sucrose solution gradients, embed it in OCT cryoembedding medium, cut the tissue into sections, and place them on glass slides. Dry the sections at room temperature, and then rinse with distilled water. Immerse the sections in 0.5% Oil Red O working solution for staining. Differentiate with 75% ethanol until the background is clear, and then rinse with distilled water. Counterstain the cell nuclei with hematoxylin staining solution, then rinse with tap water and blue. Seal the slides with glycerin gelatin. After the sealed slides are dried, observe the red staining result of lipids and the blue background of cell nuclei under a microscope.

[0076] As Figure 3As shown, the brown adipose tissue of WT mice contains more and larger lipid droplets. However, the lipid droplet content in the brown adipose tissue of mice expressing the NPAFP gene is significantly reduced, and the density of lipid droplets in NPAFP4 and NPAFP12 is lower than that in NPAFP1. This indicates that NPAFP can reduce the lipid droplet content in brown adipocytes, and its effect is positively correlated with the number of AFPIII domains.

[0077] As Figure 4 shown, the number and volume of lipid droplets in the liver tissue of WT mice are relatively large; in contrast, the lipid droplet content in the livers of NPAFP1, NPAFP4, and NPAFP12 mice is significantly reduced, and the effect of the NPAF12 group is more significant. This indicates that the NPAFP protein has an inhibitory effect on liver fat accumulation.

[0078] Example 3 Blood Glucose Level Measurement

[0079] Collect the tail vein blood of mice and detect the blood glucose content using the glucose oxidase method. Prepare tools such as a blood glucose meter, matching test strips, blood collection needles, and alcohol cotton balls. Ensure that the mice are fasted before detection (for fasting blood glucose detection), but they can drink water freely to avoid the influence of food intake on blood glucose levels. Collect the blood from the marginal ear vein, insert the blood glucose test strip into the blood glucose meter, and after the instrument prompts, drop the collected blood onto the sampling end of the test strip to ensure that the blood volume is sufficient. The blood glucose meter will display the blood glucose value within a few seconds. After blood collection, press the blood collection site to stop bleeding and observe whether the mice have any abnormal reactions. Accurately record the blood glucose results, indicating the mouse number and detection time.

[0080] As Figure 5 shown, the blood glucose level of NPAFP1 mice has no significant difference from that of the WT group, while the blood glucose levels of NPAFP4 and NPAFP12 mice are significantly lower than those of the WT group and the NPAFP1 group, and the blood glucose level of NPAFP12 is lower than that of NPAFP4. This indicates that the NPAFP protein has a dose-dependent effect on blood glucose regulation, and its effect is closely related to the number of AFPIII functional domains.

Claims

1. Use of NPAFP protein in the preparation of a medicament for treating obesity, wherein the NPAFP protein is selected from one or more of NPAFP1, NPAFP4 and / or NPAFP12; the nucleotide sequence of NPAFP1 is as shown in SEQ ID NO.1; the nucleotide sequence of NPAFP4 is as shown in SEQ ID NO.4; the nucleotide sequence of NPAFP12 is as shown in SEQ ID NO.

5.

2. The use according to claim 1, wherein the medicament can be formulated into various dosage forms, including but not limited to one or more of tablets, capsules, aerosols, pills, powders, solutions, suspensions, emulsions, granules, liposomes, transdermal agents and / or suppositories.

3. Use of NPAFP protein in the preparation of a medicament for treating diabetes, wherein the NPAFP protein is selected from one or more of NPAFP4 and / or NPAFP12; the nucleotide sequence of NPAFP4 is as shown in SEQ ID NO.4; the nucleotide sequence of NPAFP12 is as shown in SEQ ID NO.

5.

4. The use according to claim 3, wherein the medicament can be formulated into various dosage forms, including but not limited to one or more of tablets, capsules, aerosols, pills, powders, solutions, suspensions, emulsions, granules, liposomes, transdermal agents and / or suppositories.

Citation Information

Patent Citations

  • Exendin for treating diabetes and reducing body weight

    CN105056211A

  • Antifreeze proteins for inhibition of clathrate hydrate formation and reformation

    WO2003087532A1