A Yarrowia lipolytica yeast with high gastrodin production and its mutagenesis screening method and application

Abstract

The present invention relates to a kind of Yarrowia lipolytica of high-yield gastrodin and its mutagenesis screening method and application, belong to the field of genetic engineering technology. The present invention uses Yarrowia lipolytica YliGT7 producing gastrodin as the starting strain, combines normal pressure room temperature plasma ARTP mutagenesis technology and solid phase extraction mass spectrometry technology to obtain a high-yield gastrodin mutant, and finds that the expression of YALI0C05170g, YALI0F06468g and YALI0F04114g genes in the mutant genome is significantly increased compared with the starting strain by transcriptome sequencing, and is increased by 2.425, 2.155 and 2.148 times respectively. Afterwards, a recombinant strain is constructed, and it is verified by free expression that overexpressing the above genes in the starting strain can improve the yield of gastrodin, which is increased by 89%, 72.6% and 70.4% respectively compared with the starting strain, and the gastrodin yield reaches 1406.6mg / L at the highest. YALI0C05170g and YALI0F04114g were integrated into the YALI0A08734g locus of the Yarrowia lipolytica genome for expression, and the yields in YPD medium reached 10.8g / L and 11.02g / L, respectively, which were 2.5% and 4.6% higher than those of the original strain, providing a new idea and inspiration for the efficient industrial production of gastrodin.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a Yarrowia lipolytica high-yielding gastrodin and a mutagenesis screening method and application thereof. Background Art

[0002] Gastrodin is an organic compound extracted from the dried root of Gastrodia elata, an orchid plant. It has multiple effects such as sedation, hypnosis, anticonvulsant, anti-epileptic, and anti-inflammatory. It has a good effect on relieving symptoms such as neurasthenia, insomnia, and headache. It is also used clinically to treat cardiovascular and cerebrovascular diseases, depression, vertigo and other diseases. Due to its unique pharmacological effects, gastrodin is widely used in medical treatment, health care products, and food. As a natural analgesic, gastrodin is particularly widely used in the pharmaceutical field. At present, the approved gastrodin dosage forms in my country include acetyl gastrodin tablets, gastrodin tablets, gastrodin capsules, gastrodin injection, etc.

[0003] The traditional method of producing gastrodin is plant extraction, which involves crushing the tubers of gastrodia elata and extracting gastrodin using alcohol extraction or water extraction. This method is relatively mature, but it has the problems of low extraction efficiency and high cost. In recent years, with the development of biotechnology, biosynthesis has gradually become a new trend in the production of gastrodin. Microorganisms that can efficiently express enzymes related to gastrodin synthesis are constructed through genetic engineering methods, and gastrodin is produced by microbial fermentation. This method has the advantages of high production efficiency, low cost, and environmental friendliness, and is the main direction of future gastrodin production.

[0004] Yarrowia lipolytica is one of the most studied and widely used unconventional yeasts. It is usually distributed in lipid- and protein-rich substrates, such as dairy products or sausages. Compared with the conventional yeast Saccharomyces cerevisiae, this yeast has a variety of unique biochemical and metabolic characteristics, and therefore shows good industrial application value. Specifically, as follows: First, Yarrowia lipolytica is a typical dimorphic yeast; second, it is a strict aerobic bacterium that basically does not produce alcohol; third, it has an efficient acetyl-CoA metabolic pathway and a high tricarboxylic acid cycle flux in its cells, and the accumulation of lipids can reach 77%, so it is very suitable for the industrial production of organic acids, lipids and their derivatives; fourth, it can decompose oil compounds and plays an important role in the environmental remediation of waste oil pollution. At present, many complex synthetic biology tools and metabolic models have been excavated, which can be used for the metabolic engineering transformation of Yarrowia lipolytica, but there are problems such as multiple transformation directions, long research cycles and complex methods. Therefore, it is urgent to develop methods to achieve strain transformation quickly and efficiently.

[0005] Although the existing method of using Yarrowia lipolytica to synthesize gastrodin has the advantages of high production efficiency, low cost, and environmental friendliness, it also has some disadvantages. The first is the difficulty in optimizing the metabolic pathway. Although microorganisms that can express enzymes related to gastrodin synthesis can be constructed through genetic engineering, the mining and identification of key enzyme genes is still a challenge. In addition, the synthesis of gastrodin involves the participation of multiple metabolic pathways and enzymes, and the regulatory mechanisms of these pathways and enzymes are relatively complex, which increases the difficulty of optimizing the metabolic pathway. Summary of the invention

[0006] To solve the above technical problems, the present invention provides a Yarrowia lipolytica with high gastrodin production and a mutagenesis screening method and application thereof, wherein the Yarrowia lipolytica starting strain YliGT7 is subjected to normal pressure room temperature plasma mutagenesis technology, combined with solid phase extraction-mass spectrometry technology, to screen a gastrodin high-yield mutant, and transcriptome sequencing is used to find that the expression of YALI0C05170g, YALI0F06468g and YALI0F04114g genes in the mutant genome is significantly increased compared with the starting strain, and is increased by 2.425, 2.155 and 2.148 times, respectively. Afterwards, a recombinant strain is constructed, and it is verified that the overexpression of genes YALI0C05170g, YALI0F06468g and YALI0F04114g in the starting strain can increase the yield of gastrodin. YALI0C05170g and YALI0F04114g were integrated into the YALI0A08734g site of the Yarrowia lipolytica genome and expressed, with yields reaching 10.8 g / L and 11.02 g / L, respectively, in YPD medium.

[0007] The first object of the present invention is to provide a recombinant Yarrowia lipolytica with high gastrodin production, wherein the construction method of the recombinant Yarrowia lipolytica comprises the following steps:

[0008] Step S1, integrating the gastrodin biosynthesis pathway genes UGT, CAR, Ubic and PAR2 into the YALI0E18568g site of the starting strain;

[0009] Step S2: Overexpression of the key regulatory gene EcaroG of DAHP enzyme S180F and ScARO4 K229L To the YALI0D15246g site of the starting strain;

[0010] Step S3, integrating the gastrodin biosynthesis pathway genes UGT, CAR, Ubic and PAR2 into the YALI0A16379g site of the starting strain;

[0011] Step S4, integrating the gastrodin biosynthesis pathway genes UGT, CAR, Ubic and PAR2 into the YALI0C08701g site of the starting strain;

[0012] Step S5, integrating UDP-glucose supply-related genes ylPGM2, ylUGP1 and ylAK9 into the YALI0B10153g site of the starting strain;

[0013] Step S6, knocking out or silencing the glucosidase encoding genes YALI0A19074p and YALI0B14289p of the starting strain;

[0014] Step S7, inserting a T2A sequence and an antisense promoter after the TAA sequence of the pyruvate kinase gene PYK;

[0015] Step S8, overexpressing one or more of the genes YALI0C05170g, YALI0F06468g and YALI0F04114g;

[0016] Wherein, the antisense promoter is the copper ion activated promoter pMT2, and the nucleotide sequence of the pMT2 is shown in SEQ ID NO.9.

[0017] Furthermore, the nucleotide sequence of YALI0C05170g is shown in SEQ ID NO.1, the nucleotide sequence of YALI0F06468g is shown in SEQ ID NO.2, and the nucleotide sequence of YALI0F04114g is shown in SEQ ID NO.3.

[0018] Furthermore, the starting strain of the recombinant Yarrowia lipolytica is Yarrowia lipolytica po1f.

[0019] Furthermore, the overexpression is TEF is the promoter, T XPR2 For the terminator.

[0020] Furthermore, the promoter P TEF The nucleotide sequence is shown in SEQ ID NO.4, and the terminator T XPR2 The nucleotide sequence is shown in SEQ ID NO.5.

[0021] Furthermore, the recombinant Yarrowia lipolytica knocks out the Ku70 gene.

[0022] Furthermore, the nucleotide sequence of the Ku70 gene is shown in SEQ ID NO.6.

[0023] In one embodiment of the present invention, the nucleotide sequence of glycosyltransferase SylUGT is shown as SEQ ID NO.7.

[0024] Further, in step S8, the YALI0A08734g site in the Yarrowia lipolytica genome expresses one or more of the genes YALI0C05170g or YALI0F04114g.

[0025] The second object of the present invention is to provide the use of the recombinant Yarrowia lipolytica in producing gastrodin.

[0026] The third object of the present invention is to provide a method for producing gastrodin, by adding the above-mentioned recombinant Yarrowia lipolytica into a fermentation system.

[0027] Furthermore, the fermentation system contains 60-80 g / L glucose, 10-30 g / L peptone and 5-20 g / L yeast powder, and the fermentation time is 80-160 hours.

[0028] In one embodiment of the present invention, the fermentation system contains 80 g / L glucose, 20 g / L peptone and 10 g / L yeast powder.

[0029] In one embodiment of the present invention, the fermentation time is 120 hours.

[0030] The fourth object of the present invention is to provide a method for improving the production of gastrodin in recombinant Yarrowia lipolytica, by overexpressing one or more of the genes YALI0C05170g, YALI0F06468g and YALI0F04114g in the recombinant Yarrowia lipolytica producing gastrodin, wherein the expression is free expression or integrated expression, and the integrated expression integrates the gene YALI0C05170g or YALI0F04114g into the YALI0A08734g site of the Yarrowia lipolytica genome.

[0031] A fifth object of the present invention is to provide a method for mutagenesis screening of Yarrowia lipolytica with high gastrodin production, comprising the following steps:

[0032] Step S1, knocking out the Ku70 gene in the gastrodin-producing Yarrowia lipolytica to use as a starting strain;

[0033] Step S2, performing ARTP mutagenesis on the starting strain, wherein the ARTP mutagenesis conditions are as follows: power 120 W, irradiation distance 2 mm, gas flow rate 10 SLM, and irradiation time 50-120 s;

[0034] Step S3: using solid phase extraction-mass spectrometry to quantitatively analyze the product to obtain Yarrowia lipolytica with high gastrodin production.

[0035] As a new mutagenesis technology, ARTP mutagenesis can quickly and efficiently construct microbial mutation libraries, and has the advantages of wide application range, obvious positive mutation effect and good cell genetic stability. Compared with other conventional mutagenesis methods, ARTP technology can cause maximum DNA damage to single cells while maintaining cell viability, and the mutation rate is also higher, making it a more effective breeding tool.

[0036] In one embodiment of the present invention, the conditions for solid phase extraction-mass spectrometry are electrospray ionization source (ESI), negative ion multiple reaction monitoring mode (MRM), ionization temperature of 550°C, ionization voltage (IS) of -4500V, and spray gas (GS1) of 45psi.

[0037] Beneficial effects of the present invention:

[0038] The present invention adopts ARTP mutagenesis technology to mutate gastrodin-producing Yarrowia lipolytica, and quantitatively analyzes the product by solid phase extraction-mass spectrometry technology, successfully screens out high-yielding gastrodin-producing Yarrowia lipolytica, and performs transcriptome sequencing on the high-yielding gastrodin-producing Yarrowia lipolytica mutant strain, and determines that the expression levels of genes YALI0C05170g, YALI0F06468g and YALI0F04114g are upregulated compared with the starting strain, which provides a new idea and method for further optimizing and improving the gastrodin yield. TEF For promoter and T XPR2 The terminator expression system ensures the efficient and stable expression of the target gene, verifies the role of the target gene in increasing the yield of gastrodin, improves the yield and production efficiency of gastrodin, and provides strong support for the efficient industrial production of gastrodin. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] In order to make the content of the present invention more clearly understood, the present invention is further described in detail below according to specific embodiments of the present invention in conjunction with the accompanying drawings, wherein

[0040] Figure 1 is the map of the episomal plasmid pYLXP'-YALI0C05170g in Example 2 of the present invention;

[0041] Figure 2 is the map of the episomal plasmid pYLXP'-YALI0F06468g in Example 2 of the present invention;

[0042] Figure 3 is the map of the episomal plasmid pYLXP'-YALI0F04114g in Example 2 of the present invention;

[0043] Figure 4is the map of the integrative plasmid loci3-Purloxp-YALI0C05170g in Example 2 of the present invention;

[0044] Figure 5 is the map of the integrative plasmid loci3-Purloxp-YALI0F04114g in Example 2 of the present invention;

[0045] Figure 6 The results of fermentation synthesis of gastrodin by the free expression type recombinant strain in Example 4 of the present invention;

[0046] Figure 7 This is the result of fermentation synthesis of gastrodin by the integrated expression recombinant strain in Example 4 of the present invention. DETAILED DESCRIPTION

[0047] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0048] In the following examples, the starting strain Yarrowia lipolytica YliGT7 was constructed by the inventors in the early stage and disclosed in patent CN117965600A, the development of a copper ion-induced antisense transcription gene regulation tool and its application in the synthesis of gastrodin; the pYLXP' plasmid was preserved in the laboratory, and the nucleotide sequence is shown in SEQ ID NO.8; the gastrodin standard was purchased from Shanghai MacLean Biochemical Technology Co., Ltd., with the product number G828303-5g; unless otherwise specified, the reagents and culture media used were commercially available, and the methods used were conventional methods.

[0049] The culture medium used in the following examples is as follows:

[0050] Leucine-deficient plate: glucose 20 g / L, ammonium sulfate 5 g / L, amino-free yeast nitrogen source YNB 1.7 g / L, adenine hemisulfate 10 mg / L, L-arginine 0.05 g / L, L-aspartic acid 0.08 g / L, L-histidine 0.02 g / L, L-isoleucine 0.05 g / L, L-lysine 0.05 g / L, L-methionine 0.02 g / L, L-phenylalanine 0.05 g / L, L-threonine 0.1 g / L, L-tryptophan 0.05 g / L, L-tyrosine 0.05 g / L, L-valine 0.14 g / L, uracil 0.1 g / L, agar 20 g / L;

[0051] Uracil-deficient plate: glucose 20 g / L, ammonium sulfate 5 g / L, amino-free yeast nitrogen source YNB 1.7 g / L, adenine hemisulfate 10 mg / L, L-arginine 0.05 g / L, L-aspartic acid 0.08 g / L, L-histidine 0.02 g / L, L-isoleucine 0.05 g / L, L-lysine 0.05 g / L, L-methionine 0.02 g / L, L-phenylalanine 0.05 g / L, L-threonine 0.1 g / L, L-tryptophan 0.05 g / L, L-tyrosine 0.05 g / L, L-valine 0.14 g / L, leucine 0.1 g / L, agar 20 g / L;

[0052] YPD medium: yeast extract 10 g / L, peptone 20 g / L, glucose 20 g / L;

[0053] YPD fermentation medium: yeast extract 10 g / L, peptone 20 g / L, glucose 40 g / L;

[0054] Seed culture medium: glucose 20g / L, peptone 20g / L, yeast powder 10g / L;

[0055] Fermentation medium: glucose 80g / L, peptone 20g / L, yeast powder 10g / L.

[0056] The detection method used in the following examples is as follows:

[0057] Product Gastrodin: All samples needed to be processed accordingly before testing. First, they were centrifuged at 12,000 rpm for 10 min, 1 mL of the supernatant was taken, and then it was passed through a water filter membrane (pore size of 0.22 μm) to remove impurities and perform liquid phase detection.

[0058] High performance liquid chromatography (HPLC) detection parameters, chromatographic columns, and detection conditions are as follows: Shimadzu LC-40, UV-VIS detector, ZORBAX Eclipse Plus C18 chromatographic column (4.6×100mm, 3.5μm, Agilent); mobile phase is pure water (90%) and pure methanol (10%); flow rate is 0.7mL / min; UV detector, detection wavelength is 225nm; injection volume is set to 10μL; column temperature is set to 35°C. The standard substance of gastrodin was prepared with 5 gradient concentrations, and the corresponding response values ​​were detected to obtain the standard curve of concentration and absorbance value, and the correlation coefficient R 2 The value should be greater than 0.99, and then the gastrodin content in the sample was determined based on the respective standard curves.

[0059] The primer sequences involved in the following examples are shown in the following table:

[0060] Table 1 Primer sequences

[0061] Primer name Sequence (5'-3') YALI0C05170g_F ctttttgcagtactaaccgcagatacaccactacgtgacgcaaac YALI0C05170g_R catggaactagtcggtaccttaaacacgacagttggaaatgctaaac YALI0F06468g_F ctttttgcagtactaaccgcagatgacccgacctcacccc YALI0F06468g_R ggccatggaactagtcggtaccctactcgttctgcttggcaaac YALI0F04114g_F ctttttgcagtactaaccgcagcaaaaccacacaaaatggctgcc YALI0F04114g_R catggaactagtcggtaccgtcatatattatgcagtctactggttgttc

[0062] Example 1: ARTP mutagenesis and screening

[0063] (1) The starting strain Yarrowia lipolytica YliGT7 was placed in a 250 mL Erlenmeyer flask and shaken at 220 rpm and 30 °C for 24 h. 1 mL of the cells were collected by centrifugation, resuspended and centrifuged with sterile saline, and the resuspended liquid was diluted to OD 600 =0.8-1.0. After 10 μL of bacterial suspension was dropped on the center of a sterile metal slide, it was placed in an ARTP breeding machine and irradiated for 50-120 seconds using He carrier gas, 120W power, 2mm irradiation distance, and 10 standard liter per minute (SLM) gas flow. After the mutagenesis, the slide was placed in a 1.5mL centrifuge tube containing 1mL of seed culture medium, shaken for 3min to elute the bacteria, and 50μL was spread on YPD solid culture medium after elution, and cultured at 30℃ for 48h.

[0064] (2) Picking step (1) A single colony was inoculated in a 96-well plate containing seed culture medium and cultured at 30°C and 220 rpm for 24 hours, and then transferred to YPD fermentation medium for fermentation at 30°C and 220 rpm for 120 hours. Subsequently, the sample was centrifuged at 4000 rpm for 10 minutes and diluted 100 times with 50% methanol to prepare a sample for high-throughput solid phase extraction-mass spectrometry screening. In the solid phase extraction, a C4 column was first used to separate impurities and target products. The separation conditions were: 90% 0.1% formic acid water and 10% methanol were used for loading, and 10% formic acid water and 90% methanol were used for elution of impurities and eluted products. The product was detected using a triple quadrupole mass spectrometer. The mass spectrometry conditions were: electrospray ionization source (ESI), negative ion multiple reaction monitoring mode (MRM) for quantitative analysis; ionization temperature: 550°C; ionization voltage (IS): -4500V; spray gas (GS1): 45psi. By comparing the abundance of fragment ions of the parent ion with a molecular weight of 123.0 and the daughter ion with a molecular weight of 105.0 in different samples, a mutant strain was screened out, and the gastrodin production was increased by 77% compared with the starting strain.

[0065] Transcriptome sequencing of the mutant strain showed that the expression levels of genes YALI0C05170g, YALI0F06468g and YALI0F04114g were significantly upregulated compared with the starting strain, which were 3.425, 3.155 and 3.148 times that of the starting strain, respectively.

[0066] Example 2: Recombinant plasmid construction

[0067] Episomal plasmid construction: The plasmid pYLXP'-SlyUGT (the nucleotide sequence of the plasmid pYLXP' is shown in SEQ ID NO.8, and the nucleotide sequence of the SlyUGT gene is shown in SEQ ID NO.7) was linearized by enzyme digestion using Avr II and Sal I, and small DNA fragments were recovered after agarose gel electrophoresis. The Yarrowia lipolytica genome was used as a template and YALI0C05170g_F and YALI0C05170g_R were used as primers to amplify the fragments with homology arms; then, the fragments were amplified using The target gene fragment was inserted into the linearized vector by rapid cloning technology to obtain the recombinant plasmid pYLXP'-YALI0C05170g. The recombinant plasmid map is shown in Figure 1 shown.

[0068] The same method as above was used, with the Yarrowia lipolytica genome as template, YALI0F06468g_F / YALI0F06468g_R and YALI0F04114g_F / YALI0F04114g_R as primers, to amplify the fragments with homology arms respectively; The target gene fragment was inserted into the linearized vector by rapid cloning technology to obtain the recombinant plasmid pYLXP'-YALI0F06468g (plasmid map as shown in Figure 2 ) and pYLXP'-YALI0F04114g (plasmid map as shown in Figure 3 shown).

[0069] Construction of integrative plasmid: YALI0C05170g and YALI0C05170g were integrated into the YALI0A08734g site of the Yarrowia lipolytica genome, and the plasmid loci3-purloxp-a087 (SEQ ID NO.10) was linearized by restriction digestion using Not I and Nhe I to obtain a backbone, and the plasmid pYLXP'-YALI0C05170g was linearized by restriction digestion using Not I and Avr II to obtain a fragment containing the target gene, and the small DNA fragment was recovered after agarose gel electrophoresis. The larger fragment of the two recovered DNA fragments was used as a vector and connected using T4 DNA ligase to obtain the integrative recombinant plasmid loci3-Purloxp-YALI0C05170g. The recombinant plasmid map is shown in FIG. Figure 4 Using the same method as above, the recombinant plasmid loc3-Purloxp-YALI0F04114g (plasmid map as shown) was obtained. Figure 5 shown).

[0070] Example 3: Construction of recombinant strains

[0071] Free expression strain: Yarrowia lipolytica YliGT7 was used as the starting strain, and the YliGT7 strain was cultured in 2 mL of YPD medium to the exponential growth phase (16-24 h), and the bacteria in 1 mL of the fermentation broth were collected. After centrifugation and discarding the supernatant, 90 μL of 50 volume % PEG4000 solution, 5 μL of lithium acetate (2 M), 5 μL of single-stranded DNA (salmon sperm) and 5 μL of the recombinant plasmids pYLXP'-YALI0C05170g, pYLXP'-YALI0F06468g and pYLX P'-YALI0F04114g obtained in Example 2 were added, mixed and incubated at 37°C for 1 h, and then coated on a leucine-deficient plate to obtain single colonies of the recombinant strains YliGT7-pYLXP'-YALI0C05170g, YliGT7-pYLXP'-YALI0F06468g and pYLX P'-YALI0F04114g. LI0F06468g and YliGT7-pYLXP'-YALI0F04114g.

[0072] Integration expression strain: Yarrowia lipolytica YliGT7 was used as a control strain, and the YliGT7 strain was cultured in 2 mL of YPD medium to the exponential growth phase (16-24 h). The bacteria in 1 mL of the fermentation broth were collected, centrifuged and the supernatant was discarded, and 90 μL of 50 volume % PEG4000 solution, 5 μL of lithium acetate (2M), 5 μL of single-stranded DNA (salmon sperm) and 5 μL of the integration plasmids loc3-Purloxp-YALI0C05170g and loc3-Purloxp-YALI0F04114g obtained in Example 2 were added, mixed, and incubated at 37°C for 1 h, and then coated on a uracil-deficient plate to obtain a single colony of the integrated recombinant strain.

[0073] Example 4: Synthesis of Gastrodin by Fermentation of Recombinant Strain

[0074] 1. Free expression

[0075] (1) The recombinant strain prepared in Example 3 and the starting strain YliGT7 were selected and inoculated into CSM-leu seed medium, and cultured for 48 h at a temperature of 30° C. and a rotation speed of 220 rpm to obtain a recombinant Yarrowia lipolytica seed solution;

[0076] (2) The recombinant Yarrowia lipolytica seed liquid obtained in step (1) was inoculated into CSM-leu fermentation medium at an inoculum amount of 1 volume %, and fermentation culture was carried out at a temperature of 30° C. and a rotation speed of 220 rpm for 120 h to obtain a fermentation liquid; after the fermentation, the content of gastrodin in the fermentation liquid of the recombinant strain was detected by a gastrodin determination method, and the content was 1406.6 mg / L, 1283.3 mg / L and 1266.6 mg / L, and the accumulation of gastrodin was increased by 89%, 72.6% and 70.4% respectively compared with the starting strain, as shown in Tables 2 and 3. Figure 6 .

[0077] 2. Integrated Expression

[0078] (1) The recombinant integrated strain prepared in Example 3 and the starting strain YliGT7 were selected and inoculated into YPD seed medium, and cultured for 48 h at a temperature of 30° C. and a rotation speed of 220 rpm to obtain a seed solution;

[0079] (2) The recombinant Yarrowia lipolytica seed liquid obtained in step (1) was inoculated into YPD fermentation medium at an inoculum amount of 1 volume %, and fermentation culture was carried out at a temperature of 30° C. and a rotation speed of 220 rpm for 120 h to obtain a fermentation liquid; after the fermentation, the content of gastrodin in the fermentation liquid of the recombinant strain was detected by the gastrodin determination method, and the content was 10.8 g / L and 11.02 g / L, as shown in Tables 3 and 4. Figure 7 .

[0080] Table 2 Gastrodin production of free expression recombinant strains

[0081] strain Renovation Gastrodin yield (mg / L) Recombinant strain 1 YliGT7-pYLXP'-YALI0C05170g 1406.6 Recombinant strain 2 YliGT7-pYLXP'-YALI0F06468g 1283.3 Recombinant strain 3 YliGT7-pYLXP'-YALI0F04114g 1266.6 Starting strain YliGT7pYLXP' 743.3

[0082] Table 3 Gastrodin production of integrated expression recombinant strains

[0083] strain Renovation Gastrodin yield (g / L) Recombinant strain 4 loc3-Purloxp-YALI0C05170g 10.8 Recombinant strain 5 loc3-Purloxp-YALI0F04114g 11.02 Control strain YliGT7 10.53

[0084] This example verifies that overexpression of gene YALI0C05170g, YALI0F06468g or YALI0F04114g in the starting strain can indeed increase the yield of gastrodin.

[0085] Obviously, the above embodiments are merely examples for clear explanation and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived from these are still within the protection scope of the invention.

Claims

1. A recombinant Yarrowia lipolytica with high gastrodin production, characterized in that: The build process consists of the following steps: Step S1, integrating the gastrodin biosynthesis pathway genes UGT, CAR, Ubic and PAR2 into the YALI0E18568g site of the starting strain; Step S2: Overexpression of the key regulatory gene EcaroG of DAHP enzyme S180F and ScARO4 K229L To the YALI0D15246g site of the starting strain; Step S3, integrating the gastrodin biosynthesis pathway genes UGT, CAR, Ubic and PAR2 into the YALI0A16379g site of the starting strain; Step S4, integrating the gastrodin biosynthesis pathway genes UGT, CAR, Ubic and PAR2 into the YALI0C08701g site of the starting strain; Step S5, integrating UDP-glucose supply-related genes ylPGM2, ylUGP1 and ylAK9 into the YALI0B10153g site of the starting strain; Step S6, knocking out or silencing the glucosidase encoding genes YALI0A19074p and YALI0B14289p of the starting strain; Step S7, inserting a T2A sequence and an antisense promoter after the TAA sequence of the pyruvate kinase gene PYK; Step S8, overexpressing one or more of the genes YALI0C05170g, YALI0F06468g and YALI0F04114g; Wherein, the antisense promoter is the copper ion activated promoter pMT2, and the nucleotide sequence of the pMT2 is shown in SEQ ID NO.

9.

2. The recombinant Yarrowia lipolytica according to claim 1, characterized in that: The starting strain of the recombinant Yarrowia lipolytica is Yarrowia lipolytica po1f.

3. The recombinant Yarrowia lipolytica according to claim 1, characterized in that: The overexpression TEF is the promoter, T XPR2 For the terminator.

4. The recombinant Yarrowia lipolytica according to claim 1, characterized in that: The recombinant Yarrowia lipolytica knocks out the Ku70 gene.

5. The recombinant Yarrowia lipolytica according to claim 1, characterized in that: In step S8, the gene YALI0C05170g or YALI0F04114g is expressed at the YALI0A08734g site in the Yarrowia lipolytica genome.

6. Use of the recombinant Yarrowia lipolytica according to any one of claims 1 to 5 in producing gastrodin.

7. A method for producing gastrodin, characterized in that: The recombinant Yarrowia lipolytica according to any one of claims 1 to 5 is added to the fermentation system.

8. The method according to claim 7, characterized in that: The fermentation system contains 60-80 g / L glucose, 10-30 g / L peptone and 5-20 g / L yeast powder, and the fermentation time is 80-160 hours.

9. A method for increasing the gastrodin production of recombinant Yarrowia lipolytica, characterized in that: One or more of the genes YALI0C05170g, YALI0F06468g and YALI0F04114g are overexpressed in the recombinant Yarrowia lipolytica producing gastrodin, wherein the expression is free expression or integrated expression, and the integrated expression integrates the gene YALI0C05170g or YALI0F04114g into the YALI0A08734g site of the Yarrowia lipolytica genome.

10. A method for inducing mutation screening of Yarrowia lipolytica with high gastrodin production, characterized in that: The following steps are involved: Step S1, knocking out the Ku70 gene in the gastrodin-producing Yarrowia lipolytica to use as a starting strain; Step S2, performing ARTP mutagenesis on the starting strain, wherein the ARTP mutagenesis conditions are as follows: power 120 W, irradiation distance 2 mm, gas flow rate 10 SLM, and irradiation time 50-120 seconds; Step S3: using solid phase extraction-mass spectrometry to quantitatively analyze the product to obtain Yarrowia lipolytica with high gastrodin production.

Images