Acyltransferase mutant with high acetylation activity and application thereof

Abstract

The invention discloses an acyltransferase mutant with high acetylation activity and application of the acyltransferase mutant, and belongs to the technical field of enzyme engineering. The acyltransferase mutant provided by the invention contains one or more mutation sites in the 62nd site and the 64th site on the basis of the acyltransferase mutant of which the corresponding amino acid sequence is shown as SEQ ID NO.1. Compared with an original enzyme before mutation, the acyltransferase mutant obtained by the invention has higher acyltransferase activity and catalytic efficiency, and the yield of N-acetyl-trans-4-hydroxyproline can be increased. Therefore, the acyltransferase mutant disclosed by the invention has important significance in efficient biosynthesis of N-acetyl-trans-4-hydroxyproline, and has a wide application prospect in the fields of biological materials, medicines or cosmetics.

Description

Technical Field

[0001] The invention relates to an acyltransferase mutant with high acetylation activity and application thereof, belonging to the technical field of enzyme engineering. Background Art

[0002] N-acetyl-trans-4-hydroxyproline is widely used in the fields of beauty, skin care and biomedicine, and has high market demand and economic value. Currently, N-acetyl-trans-4-hydroxyproline on the market is mainly synthesized by chemical reaction of hydroxyproline and acetylation reagent. The process is complicated, the separation steps are cumbersome and the efficiency is low, resulting in high production costs. In addition, chemical synthesis has a negative impact on the environment, limiting its promotion and application in industry.

[0003] In recent years, the enzyme-catalyzed synthesis of N-acetyl-trans-4-hydroxyproline has shown a good development momentum. The acyltransferase MsAcT from Mycobacterium smegmatis has become one of the most popular acyltransferases due to its high activity, high stability and wide range of esterification reaction substrates. The patent with publication number CN117586979A discloses an acyltransferase mutant, which uses hydroxyproline as a substrate and is catalyzed by a genetically engineered strain expressing the acyltransferase mutant in the technology, and the yield of N-acetyl-trans-4-hydroxyproline reaches more than 312.5 mg / L. Among them, the yield of N-acetyl-trans-4-hydroxyproline synthesized by the whole cell of the genetically engineered strain expressing the mutant K97A / F154A can reach 488 mg / L.

[0004] Despite this, the yield of N-acetyl-trans-4-hydroxyproline is still low. The research on the synthesis of N-acetyl-trans-4-hydroxyproline using MsAcT is still in its early stages, and the catalytic efficiency of the enzyme needs to be further improved. In addition, MsAcT has mixed hydrolase and acyltransferase activities, and its high hydrolase activity hinders the accumulation of products. Therefore, further exploring and developing MsAcT to improve its catalytic efficiency and acyltransferase activity (AT:H) is the key to increasing the yield of N-acetyl-trans-4-hydroxyproline, which has extremely high economic and practical value. Summary of the invention

[0005] In order to further explore the potential of acyltransferase (MsAcT) and improve the enzymatic activity of acyltransferase, the present invention provides an acyltransferase mutant. Compared with before mutation, the mutant has a greatly improved conversion rate of hydroxyproline, further improving the yield of N-acetyl-trans-4-hydroxyproline.

[0006] The first object of the present invention is to provide an acyltransferase mutant with high acetylation activity, wherein the acyltransferase mutant contains one or more mutation sites at positions 62 and 64 based on the corresponding amino acid sequence of the acyltransferase mutant as shown in SEQ ID NO.1.

[0007] SEQ ID NO.1:

[0008] MAKRILCFGDCLTWGWVPVEDGAPTERFAPDVRWTGVLAQQLGADFEVIEEGLSARTTNIDDPTDPRLNGASYLPSCLATHLPLDLVIIMLGTNDTKAYFRRTPLDIALGMSVLVTQVLTSAGGVGTTYPAPKVLVVSPPPLAPMPHPWFQLIFEGGEQKTTELARVYSALASFMKVPFFDAGSVISTDGVDGIHFTEANNRDLGVALAEQVRSLL

[0009] In one embodiment of the present invention, the nucleotide sequence encoding the acyltransferase mutant having the amino acid sequence shown in SEQ ID NO.1 is shown in SEQ ID NO.2.

[0010] SEQ ID NO.2:

[0011] ATGGCCAAACGCATCTTATGTTTCGGAGACtgcCTGACTTGGGGATGGGTTCCCGTGGAAGACGGTGCTCCTACTGAACGCTTTGCGCCAGATGTACGCTGGACCGGCGTATTAGCTCAGCAGTTAGGCGCTGACTTTGAAGTCATTGAGGAAGGTTTGTCT GCCCGTACGACAAACATCGATGATCCCACCGACCCGCGTTTGAATGGAGCGAGCTATCTTCCCTCGTGCCTGGCAACTCACTTACCGCTGGATCTTGTTATTATCATGTTGGGCACAAACGACACCAAGGCGTATTTCCGCCGCACACCCCTTGATATTGCA CTTGGGATGTCGGTGCTTGTCACACAGGTCTTGACATCCGCGGGGGGAGTAGGCACGACATATCCCGCACCGAAAGTATTAGTCGTCTCGCCTCCTCCCTTGGCACCCATGCCTCACCCCTGGTTTCAACTGATTTTTGAGGGCGGAGAACAAAAGACAACG GAACTTGCCCGTGTGTATTCAGCGCTGGCTTCGTTTATGAAAGTCCCGTTCTTTGATGCCGGTAGCGTGATCAGTACAGACGGCGTAGATGGTATCCACTTTACGGAGGCCAATAACCGTGATCTGGGGGTGGCACTGGCGGAGCAAGTTCGCTCACTTTTA

[0012] Among them, in the amino acid sequence SEQ ID NO.1, the 62nd and 64th amino acid sites are near the active pocket of the acyltransferase MsAcT The amino acid residues within.

[0013] In one embodiment of the present invention, the acyltransferase mutant is obtained by mutating the aspartic acid at position 62 of the acyltransferase mutant having an amino acid sequence as shown in SEQ ID NO.1 to lysine, and is named: D62K;

[0014] In one embodiment of the present invention, the acyltransferase mutant having an amino acid sequence as shown in SEQ ID NO.1 is obtained by mutating the aspartic acid at position 62 to arginine, and is named: D62R;

[0015] In one embodiment of the present invention, the 64th threonine of the acyltransferase mutant with the amino acid sequence as shown in SEQ ID NO.1 is mutated to asparagine, and is named: T64N.

[0016] The present invention also provides a gene encoding the mutant or a recombinant vector carrying the gene.

[0017] The present invention also provides a recombinant cell expressing the mutant or carrying the gene or the recombinant vector.

[0018] In one embodiment of the present invention, the recombinant cell uses bacteria or fungi as expression hosts.

[0019] In one embodiment of the present invention, the host of the recombinant cell is Escherichia coli C43 (DE3).

[0020] The present invention also provides a recombinant enzyme catalyst containing the above-mentioned acyltransferase mutant sequence, wherein the catalyst is in any one of the following forms:

[0021] (1) culturing a recombinant expression transformant, isolating a transformant cell expressing a recombinant enzyme containing the acyltransferase mutant sequence, and obtaining the recombinant enzyme catalyst;

[0022] (2) culturing the recombinant expression transformant, isolating the transformant cells expressing the recombinant enzyme containing the acyltransferase mutant sequence, disrupting the transformant cells expressing the recombinant enzyme to obtain a cell disrupted liquid, and obtaining the recombinant enzyme catalyst;

[0023] (3) Cultivating the recombinant expression transformant, isolating the transformant cells expressing the recombinant enzyme containing the acyltransferase mutant sequence, disrupting the transformant cells expressing the recombinant enzyme to obtain a cell disruption solution, freeze-drying the cell disruption solution to obtain a freeze-dried enzyme powder, and obtaining the recombinant enzyme catalyst.

[0024] The present invention also provides a method for increasing the acyltransferase activity (AT:H); the AT:H is the ratio of the acyltransferase activity to the hydrolysis activity;

[0025] The method comprises mutating the aspartic acid at position 62 of the acyltransferase mutant of the amino acid sequence as shown in SEQ ID NO.1 to lysine or arginine;

[0026] Or the threonine at position 64 of the acyltransferase mutant having an amino acid sequence as shown in SEQ ID NO.1 is mutated to asparagine.

[0027] The present invention also provides a method for improving the yield or conversion rate of N-acetyl-trans-4-hydroxyproline, wherein the method comprises adding the acyltransferase mutant or the recombinant cell or the recombinant enzyme catalyst to a reaction system containing hydroxyproline and an acyl donor to carry out a reaction, thereby preparing N-acetyl-trans-4-hydroxyproline.

[0028] In one embodiment of the present invention, the acyl donor is vinyl acetate.

[0029] In one embodiment of the present invention, the reaction system further contains a phosphate buffer.

[0030] In one embodiment of the present invention, the final concentration of hydroxyproline in the system is 100-350 mM, and the final concentration of the acyl donor in the system is 1-20% v / v.

[0031] In one embodiment of the present invention, the method is to add the MsAcT mutant at a final concentration of 0.4 mg / mL to 100 mM phosphate buffer (pH 7.0) containing 250 mM hydroxyproline and 10% (v / v) vinyl acetate, and react at 45°C for 12 hours.

[0032] The present invention also provides the use of the acyltransferase mutant or the recombinant cell or the recombinant enzyme catalyst in catalyzing the substrate hydroxyproline to prepare N-acetyl-trans-4-hydroxyproline.

[0033] In one embodiment of the present invention, the application is to add the acyltransferase mutant or the recombinant cell or the recombinant enzyme catalyst to a reaction system containing hydroxyproline and an acyl donor to carry out a reaction to prepare N-acetyl-trans-4-hydroxyproline.

[0034] In one embodiment of the present invention, the acyl donor is vinyl acetate.

[0035] In one embodiment of the present invention, the reaction system further contains a phosphate buffer.

[0036] In one embodiment of the present invention, the final concentration of hydroxyproline in the system is 100-350 mM, and the final concentration of the acyl donor in the system is 1-20% v / v.

[0037] In one embodiment of the present invention, the application is to add the MsAcT mutant at a final concentration of 0.4 mg / mL to 100 mM phosphate buffer (pH 7.0) containing 250 mM hydroxyproline and 10% (v / v) vinyl acetate, and react at 45°C for 12 hours.

[0038] The present invention also provides the use of the mutant, the gene, the recombinant vector, the recombinant cell, the recombinant enzyme catalyst or the method in the field of biomaterials, medicine or cosmetics.

[0039] Beneficial effects:

[0040] The present invention uses the PCR method to perform site-directed saturation mutagenesis based on structural information combined with simulation calculations, and finally obtains a MsAcT mutant with high acyltransferase activity. The acyltransferase mutant obtained by the present invention has higher acyltransferase activity and catalytic efficiency than the original enzyme before mutation, and can improve production efficiency. Among them, the mutant D62K has the best effect, with an enzyme activity of up to 5.9; when it catalyzes the substrate, the yield of N-acetyl-trans-4-hydroxyproline reaches 7.27g / L, which is 160% higher than before mutation.

[0041] Therefore, the acyltransferase mutant of the present invention is of great significance in the efficient biosynthesis of N-acetyl-trans-4-hydroxyproline and has broad application prospects in the fields of biomaterials, medicine or cosmetics. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 This is a graph showing the results of screening based on alanine scanning binding energy;

[0043] Figure 2 This is a result diagram of site screening based on simulated mutation binding energy;

[0044] Figure 3 Agarose gel electrophoresis. DETAILED DESCRIPTION

[0045] The technical solutions described in the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in the field without creative work are within the scope of protection of the present invention. The materials and reagents used in the embodiments can be obtained from commercial channels unless otherwise specified.

[0046] The culture medium and buffer solution involved in the embodiment:

[0047] LB solid medium (1 L): tryptone 10 g, yeast powder 5 g, NaCl 10 g, agar powder 17 g.

[0048] LB liquid culture medium: 10 g tryptone, 5 g yeast powder, 10 g NaCl, dissolved in deionized water and fixed to 1000 mL.

[0049] Binding Buffer: Dissolve 17.54 g NaCl and 6.00 g NaH2PO4 in deionized water and make up to 1000 mL. Adjust the pH to 8 with NaOH solution.

[0050] Elution buffer with different concentrations of imidazole: NaCl 29.22 g, Tris 2.42 g, imidazole 0.68 g / 27.23 g / 68.32 g (final concentration 2 / 400 / 1000 mM) were dissolved in deionized water and made up to 1000 mL, and the pH was adjusted to 8 with hydrochloric acid.

[0051] The p-nitrophenyl acetate involved in the examples was purchased from Sangon Biotech (Shanghai) Co., Ltd. with the item number 830-03-5; hydroxyproline was purchased from Sangon Biotech (Shanghai) Co., Ltd. with the item number 51-35-4; all competent cells used were purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0052] Example 1: Construction of highly active acyltransferase mutants

[0053] 1. Site-directed mutagenesis strategy

[0054] Discovery studio software was used to analyze the active pocket of acyltransferase MsAcT (S11C) (amino acid sequence SEQ ID NO.1). Alanine scanning was performed on all amino acid residues in the 500-kDa region, and two mutation points were predicted and screened to be stable after simulated mutation, Asp at position 62 and Thr at position 64 ( Figure 1 ), and further simulate saturation mutation prediction to screen the optimal mutation method ( Figure 2 ), and finally 9 mutation modes were determined, including D62E, D62H, D62K, D62R, D62W, T64H, T64F, T64Y and T64N.

[0055] 2. Construction of mutant recombinant plasmid

[0056] (1) chemically synthesizing a gene encoding an acyltransferase mutant MsAcT(S11C) having an amino acid sequence as shown in SEQ ID NO.1 (the nucleotide sequence of the gene is shown in SEQ ID NO.2), wherein MsAcT(S11C) is obtained by mutating the serine at position 11 of the wild-type acyltransferase MsAcT to cysteine;

[0057] (2) Construction of recombinant vector: Using the primers in Table 1 and the commercial plasmid pET22b as the backbone, the acyltransferase Misact (S11C) sequence was connected to the pET-22b (+) vector as the target gene template, and linear amplification was performed using PCR technology. After linear amplification, the target gene MsAcT (S11C) was connected to the pET22b vector using the One Step Seamless Cloning Mix homologous recombinase and incubated at 50°C for 30 minutes to obtain the recombinant vector pET-22b (+)-MsAcT (S11C);

[0058] Table 1 Primer sequences

[0059]

[0060] (3) Using the nucleotide sequence of the recombinant plasmid pET-22b(+)-MsAcT(S11C) as a template, primers containing the mutation site were designed (Table 2):

[0061] The aspartic acid at position 62 of the acyltransferase mutant MsAcT (S11C) as shown in the amino acid sequence of SEQ ID NO.1 is mutated to glutamic acid to obtain the MsAcT (S11C / D62E) mutant (or D62E mutant); the aspartic acid at position 62 of the acyltransferase mutant MsAcT (S11C) as shown in the amino acid sequence of SEQ ID NO.1 is mutated to histidine to obtain the MsAcT (S11C / D62H) mutant (or D62H mutant); the aspartic acid at position 62 of the acyltransferase mutant MsAcT (S11C) as shown in the amino acid sequence of SEQ ID NO.1 is mutated to lysine to obtain the MsAcT (S11C / D62K) mutant (or D62K ...glutamic acid to obtain the MsAcT (S11C / D62E) mutant (or D62E mutant); the aspartic acid at position 62 of the acyltransferase mutant MsAcT (S11C) as shown in the amino acid sequence of SEQ ID NO.1 is mutated to histidine to obtain the MsAcT (S11C / D62H) mutant (or D62H mutant); The aspartic acid at position 62 of the acyltransferase mutant MsAcT(S11C) shown in SEQ ID NO.1 was mutated to tryptophan to obtain the MsAcT(S11C / D62W) mutant (or D62W mutant); the aspartic acid at position 62 of the acyltransferase mutant MsAcT(S11C) shown in SEQ ID NO.1 was mutated to arginine to obtain the MsAcT(S11C / D62R) mutant (or D62R mutant); the threonine at position 64 of the acyltransferase mutant MsAcT(S11C) shown in SEQ ID NO.1 was mutated to histidine to obtain the MsAcT(S11C / T64H) mutant (or T64H mutant); the amino acid sequence of ... The threonine at position 64 of the acyltransferase mutant MsAcT (S11C) shown in NO.1 is mutated to phenylalanine to obtain the MsAcT (S11C / T64F) mutant (or T64F mutant); the threonine at position 64 of the acyltransferase mutant MsAcT (S11C) with an amino acid sequence as shown in SEQ ID NO.1 is mutated to tyrosine to obtain the MsAcT (S11C / T64Y) mutant (or T64Y mutant); the threonine at position 64 of the acyltransferase mutant MsAcT (S11C) with an amino acid sequence as shown in SEQ ID NO.1 is mutated to asparagine to obtain the MsAcT (S11C / T64N) mutant (or T64N mutant).

[0062] Site-directed mutagenesis was performed using PCR technology to obtain recombinant plasmids pET-22b(+)-MsAcT(S11C / D62E), pET-22b(+)-MsAcT(S11C / D62H), pET-22b(+)-MsAcT(S11C / D62K), pET-22b(+)-MsAcT(S11C / D62W), pET-22b(+)-MsAcT(S11C / D62R), pET-22b(+)-MsAcT(S11C / T64H), pET-22b(+)-MsAcT(S11C / T64F), pET-22b(+)-MsAcT(S11C / T64Y), and pET-22b(+)-MsAcT(S11C / T64N).

[0063] The PCR reaction system is shown in Table 3. The PCR reaction conditions are 98°C for 30 s; 98°C for 10 s, 58°C for 5 s, 72°C for 3 min, for a total of 30 cycles; 72°C for 2 min; and stored at 4°C.

[0064] The PCR products were detected by 1% agarose gel electrophoresis. Figure 3 The PCR products were transformed into Escherichia coli JM109 competent cells to select positive transformants, extract plasmids, and sequence verification. Finally, 7 mutants were successfully constructed, namely E. coli-JM09-MsAcT(S11C / D62E), E. coli-JM09-MsAcT(S11C / D62K), E. coli-JM09-MsAcT(S11C / D62R), E. coli-JM09-MsAcT(S11C / T64H), E. coli-JM09-MsAcT(S11C / T64F), E. coli-JM09-MsAcT(S11C / T64Y), and E. coli-JM09-MsAcT(S11C / T64N).

[0065] Table 2 Primers

[0066]

[0067] Table 3 PCR reaction system

[0068]

[0069] Example 2: Expression analysis and purification of acyltransferase mutant proteins

[0070] 1. Inducible expression of acyltransferase mutant protein

[0071] The recombinant plasmids pET-22b(+)-MsAcT(S11C), pET-22b(+)-MsAcT(S11C / D62E), pET-22b(+)-MsAcT(S11C / D62K), pET-22b(+)-MsAcT(S11C / D62R), pET-22b(+)-MsAcT(S11C / T64H), pET-22b(+)-MsAcT(S11C / T64F), pET-22b(+)-MsAcT(S11C / T64Y), and pET-22b(+)-MsAcT(S11C / T64N) that were successfully verified by sequencing were transformed into Escherichia coli C43(DE3) competent cells that efficiently express hydrophobic proteins, thereby obtaining recombinant Escherichia coli containing the above-mentioned mutant plasmids.

[0072] The recombinant E. coli successfully constructed above was inoculated into 4 mL of LB liquid medium containing ampicillin (100 μg / mL) for activation, and cultured at 37°C, 200 rpm for 12 h; then inoculated into 50 mL of LB liquid medium at a 1% (v / v) inoculum, and cultured at 37°C, 220 rpm for 3-4 h until the OD 600 =0.6-0.8; add 250μM IPTG (isopropyl-β-D-thiogalactoside), 16℃, 220rpm, low temperature induction for 16h. Centrifuge the fermentation broth at 4℃, 5000rpm for 5min, collect the bacteria; resuspend the bacteria with 20mL Binding Buffer; use an ultrasonic cell disruptor to disrupt the cells for 20min under ice water bath conditions (ultrasound at 45% power for 2s, intermittent for 2s); centrifuge at 4℃, 10000rpm for 40min, and use the supernatant as crude enzyme. Take 15μL crude enzyme in a 1.5mL centrifuge tube, mix with 5μL 5SDS PAGE loading buffer, place in a 100℃ metal bath for 10min, and immediately perform SDS-PAGE analysis.

[0073] 2. Protein purification

[0074] The crude enzyme obtained in step 1 above was filtered through a 0.22 μm filter membrane and then loaded onto a pre-equilibrated nickel column; first, non-specific binding proteins were eluted with 10 column volumes of elution buffer (2 mM imidazole); then, the target protein was eluted with 3 column volumes of elution buffer (400 mM imidazole); finally, the remaining impurities were washed with 10 volumes of elution buffer (1000 mM imidazole); the collected protein purification solution was dialyzed at 4°C for 12 h to remove imidazole (the dialysis buffer used a phosphate buffer with a molar concentration of 100 mmol / L pH 7.0), and the purified enzyme solution was obtained and stored in a 4°C refrigerator.

[0075] Finally, 7 purified enzyme solutions were obtained, namely, a purified enzyme solution containing MsAcT (S11C), a purified enzyme solution containing MsAcT (S11C / D62E), a purified enzyme solution containing MsAcT (S11C / D62K), a purified enzyme solution containing MsAcT (S11C / D62R), a purified enzyme solution containing MsAcT (S11C / T64H), a purified enzyme solution containing MsAcT (S11C / T64F), a purified enzyme solution containing MsAcT (S11C / T64Y), and a purified enzyme solution containing MsAcT (S11C / T64N).

[0076] Example 3: Acyltransferase activity (AT:H) determination of acyltransferase mutants

[0077] The p-nitrophenyl acyltransferase (pNP-AcT) method was used to determine the hydrolase and acyltransferase activities of MsAcT mutants. The hydrolase activity was assessed by monitoring the release of p-nitrophenol from p-nitrophenyl esters at 405 nm. The acyltransferase activity was determined by the increased release of p-nitrophenol (pNP) after the addition of methanol. The ratio of acyltransferase activity to hydrolytic activity (AT:H) reflects the acetylation activity of the mutants.

[0078] The experiments were performed at 25 °C and the reaction scale was 1 mL.

[0079] Hydrolase activity experimental group: p-nitrophenyl acetate (final concentration of 1 mM), benzyl alcohol (final concentration of 10 mM), the purified enzyme solution containing MsAcT (S11C) obtained in Example 2, the purified enzyme solution containing MsAcT (S11C / D62E), the purified enzyme solution containing MsAcT (S11C / D62K), the purified enzyme solution containing MsAcT (S11C / D62R), the purified enzyme solution containing MsAcT (S11C / T64H), the purified enzyme solution containing MsAcT (S11C / T64F), the purified enzyme solution containing MsAcT (S11C / T64Y), or the purified enzyme solution containing MsAcT (S11C / T64N) (final concentration of 10 mg / L), 200 mM potassium phosphate buffer (pH 5.0) were added to each well in sequence. 7.5) and DMSO at a final concentration of 0.1% (v / v);

[0080] Acyltransferase activity test group: Based on the hydrolase activity test group, benzyl alcohol was added at a final concentration of 10 mM.

[0081] Control group: p-nitrophenyl acetate (final concentration of 1 mM), benzyl alcohol (final concentration of 10 mM), 200 mM potassium phosphate buffer (pH 7.5) and DMSO with a final concentration of 0.1% (v / v) were added to each well in sequence.

[0082] After the three groups reacted for 15 min, 200 μL was added to a 96-well plate, and the absorbance value of each well of the three groups was detected at a wavelength of 405 nm using an ELISA reader. 405 , calculate the amount of p-nitrophenol pNP produced.

[0083] The calculation formula of acyltransferase activity (AT:H) is as follows:

[0084] AT:H=(n2-n0) / (n1-n0)

[0085] Among them, n0, n1, and n2 represent the amount of pNP generated in the control group, the hydrolase activity experimental group, and the acyltransferase activity experimental group (i.e., the absorbance value A 405 ).

[0086] The results of the acyltransferase activity assay of the acyltransferase mutants showed that compared with the original enzyme, the AT:H of four mutants was significantly increased, and they were further applied (Table 4).

[0087] Table 4 Acyltransferase activity (AT:H) determination of acyltransferase mutants

[0088] Mutants Control MsAcT(S11C) D62E D62K D62R T64N T64Y T64F T64H AT:H 1.03 2.71 2.21 3.94 2.96 3.76 2.19 2.77 2.58

[0089] Example 4: Synthesis of N-acetyl-trans-4-hydroxyproline catalyzed by acyltransferase mutants

[0090] The reaction scale was 1 mL.

[0091] Experimental group: Hydroxyproline at a final concentration of 250 mM and 10% (v / v) vinyl acetate were added to 100 mM phosphate buffer (pH 7.0), and then the purified enzyme solution containing MsAcT (S11C) obtained in Example 2, the purified enzyme solution containing MsAcT (S11C / D62E), the purified enzyme solution containing MsAcT (S11C / D62K), the purified enzyme solution containing MsAcT (S11C / D62R), the purified enzyme solution containing MsAcT (S11C / T64H), the purified enzyme solution containing MsAcT (S11C / T64F), the purified enzyme solution containing MsAcT (S11C / T64Y), or the purified enzyme solution containing MsAcT (S11C / T64N) was added at a final concentration of 0.4 mg / mL.

[0092] Control group: trans-4-hydroxy-L-proline at a final concentration of 250 mM and 10% (v / v) vinyl acetate were added to 100 mM phosphate buffer (pH 7.0).

[0093] The above solution was reacted at 45°C for 12 hours and then sampled. Four volumes of methanol were added to the sample and mixed well. The mixture was allowed to stand at -20°C for 4 hours, and then centrifuged at 4°C and 12,000 rpm for 5 minutes. The supernatant was collected for high performance liquid chromatography detection.

[0094] The HPLC detection conditions of N-acetyl-trans-4-hydroxyproline are as follows: Agilent HPLC was used to separate the liquid phase using a Diamond C-18, 4.6×250 mm column: flow rate 0.8 mL / min, mobile phase A was 2% methanol in water, mobile phase B was 2% methanol and 0.1% phosphoric acid in water. Column temperature 25°C, detection wavelength 205 nm. A single sample was run for 20 min.

[0095] The results of the N-acetyl-trans-4-hydroxyproline production determination of acyltransferase mutants showed that compared with the original enzyme MsAcT (S11C), the N-acetyl-trans-4-hydroxyproline production of three mutants was significantly increased, namely T64N, D62R, and D62K mutants.

[0096] Table 5 N-acetyl-trans-4-hydroxyproline production assay of acyltransferase mutants

[0097]

[0098] The sequence involved in the present invention is as follows:

[0099] SEQ ID NO.1:

[0100] MAKRILCFGDCLTWGWVPVEDGAPTERFAPDVRWTGVLAQQLGADFEVIEEGLSARTTNIDDPTDPRLNGASYLPSCLATHLPLDLVIIMLGTNDTKAYFRRTPLDIALGMSVLVTQVLTSAGGVGTTYPAPKVLVVSPPPLAPMPHPWFQLIFEGGEQKTTELARVYSALASFMKVPFFDAGSVISTDGVDGIHFTEANNRDLGVALAEQVRSLL

[0101] SEQ ID NO.2:

[0102] ATGGCCAAACGCATCTTATGTTTCGGAGACtgcCTGACTTGGGGATGGGTTCCCGTGGAAGACGGTGCTCCTACTGAACGCTTTGCGCCAGATGTACGCTGGACCGGCGTATTAGCTCAGCAGTTAGGCGCTGACTTTGAAGTCATTGAGGAAGGTTTGTCT GCCCGTACGACAAACATCGATGATCCCACCGACCCGCGTTTGAATGGAGCGAGCTATCTTCCCTCGTGCCTGGCAACTCACTTACCGCTGGATCTTGTTATTATCATGTTGGGCACAAACGACACCAAGGCGTATTTCCGCCGCACACCCCTTGATATTGCA CTTGGGATGTCGGTGCTTGTCACACAGGTCTTGACATCCGCGGGGGGAGTAGGCACGACATATCCCGCACCGAAAGTATTAGTCGTCTCGCCTCCTCCCTTGGCACCCATGCCTCACCCCTGGTTTCAACTGATTTTTGAGGGCGGAGAACAAAAGACAACG GAACTTGCCCGTGTGTATTCAGCGCTGGCTTCGTTTATGAAAGTCCCGTTCTTTGATGCCGGTAGCGTGATCAGTACAGACGGCGTAGATGGTATCCACTTTACGGAGGCCAATAACCGTGATCTGGGGGTGGCACTGGCGGAGCAAGTTCGCTCACTTTTA

[0103] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. An acyltransferase mutant having high acetylation activity, characterized in that: The acyltransferase mutant contains one or more mutation sites at positions 62 and 64 based on the acyltransferase mutant corresponding to the amino acid sequence as shown in SEQ ID NO.

1.

2. The acyltransferase mutant according to claim 1, characterized in that The acyltransferase mutant is obtained by mutating the aspartic acid at position 62 of the acyltransferase mutant having an amino acid sequence as shown in SEQ ID NO.1 to lysine; or obtained by mutating the aspartic acid at position 62 of the acyltransferase mutant having an amino acid sequence as shown in SEQ ID NO.1 to arginine; Or the 64th threonine of the acyltransferase mutant with the amino acid sequence as shown in SEQ ID NO.1 is mutated to asparagine.

3. A gene encoding the mutant according to claim 1 or 2 or a recombinant vector carrying the gene.

4. A recombinant cell expressing the mutant according to claim 1 or 2 or carrying the gene or the recombinant vector according to claim 3; preferably, the recombinant cell uses bacteria or fungi as expression hosts.

5. A recombinant enzyme catalyst comprising the acyltransferase mutant sequence of claim 1 or 2, characterized in that: The catalyst is in any of the following forms: (1) culturing a recombinant expression transformant, isolating a transformant cell expressing a recombinant enzyme containing the acyltransferase mutant sequence of claim 1, and obtaining the recombinant enzyme catalyst; (2) culturing the recombinant expression transformant, isolating the transformant cells expressing the recombinant enzyme containing the acyltransferase mutant sequence of claim 1, disrupting the transformant cells expressing the recombinant enzyme to obtain a cell disrupted liquid, and obtaining the recombinant enzyme catalyst; (3) Cultivating the recombinant expression transformant, isolating the transformant cells expressing the recombinant enzyme containing the acyltransferase mutant sequence of claim 1, disrupting the transformant cells expressing the recombinant enzyme to obtain a cell disruption solution, and freeze-drying the cell disruption solution to obtain a freeze-dried enzyme powder to obtain the recombinant enzyme catalyst.

6. A method for increasing acyltransferase AT:H, characterized in that: The method comprises mutating the aspartic acid at position 62 of the acyltransferase mutant of the amino acid sequence as shown in SEQ ID NO.1 to lysine or arginine; or mutating the threonine at position 64 of the acyltransferase mutant whose amino acid sequence is shown in SEQ ID NO.1 to asparagine; Wherein, the AT:H is the ratio of acyltransferase activity to hydrolysis activity.

7. Use of the acyltransferase mutant according to claim 1 or 2, the gene or recombinant vector according to claim 3, the recombinant cell according to claim 4 or the recombinant enzyme catalyst according to claim 5 in catalyzing the preparation of N-acetyl-trans-4-hydroxyproline from the substrate hydroxyproline.

8. The use according to claim 7, characterized in that: The application is to add the acyltransferase mutant according to claim 1 or 2, the recombinant cell according to claim 4, or the recombinant enzyme catalyst according to claim 5 to a reaction system containing hydroxyproline and an acyl donor to carry out a reaction to prepare N-acetyl-trans-4-hydroxyproline; Preferably, the acyl donor is vinyl acetate; Preferably, the reaction system further contains a phosphate buffer; Preferably, the final concentration of hydroxyproline in the system is 100-350 mM, and the final concentration of the acyl donor in the system is 1-20% v / v.

9. A method for increasing the yield or conversion rate of N-acetyl-trans-4-hydroxyproline, characterized in that: The method comprises adding the acyltransferase mutant according to claim 1 or 2, the recombinant cell according to claim 4, or the recombinant enzyme catalyst according to claim 5 to a reaction system containing hydroxyproline and an acyl donor to carry out a reaction to prepare N-acetyl-trans-4-hydroxyproline.

10. Use of the mutant according to claim 1 or 2, the gene or recombinant vector according to claim 3, the recombinant cell according to claim 4, the recombinase catalyst according to claim 5, the method according to claim 6 or the method according to claim 7 in the field of biomaterials, medicine or cosmetics.

Images