Acyltransferase mutant and application thereof in synthesis of N-acetyl-trans-4-hydroxyproline

Abstract

The invention discloses an acyltransferase mutant and application of the acyltransferase mutant in synthesis of N-acetyl-trans-4-hydroxyproline, and belongs to the technical field of enzyme engineering. The acyltransferase mutant provided by the invention contains 10th and 95th mutations on the basis of a corresponding amino acid sequence, such as a sequence as shown in SEQ ID NO.1, or contains 62nd or 64th mutations while containing the 10th and 95th mutations. Compared with an original enzyme before mutation, the acyltransferase mutant obtained by the invention has higher acyltransferase activity, and the conversion rate of trans-4-hydroxy-L-proline is greatly improved, so that the yield of N-acetyl-trans-4-hydroxy proline is further improved, and the yield of N-acetyl-trans-4-hydroxy proline is improved. After the surfactant and the metal ions are added, the yield of the N-acetyl-trans-4-hydroxyproline synthesized by the mutant D62K / D10V / D95I under the catalysis is up to 18.7 g / L.

Description

Technical Field

[0001] The invention relates to an acyltransferase mutant and application thereof in the synthesis of N-acetyl-trans-4-hydroxyproline, belonging to the technical field of enzyme engineering. Background Art

[0002] N-acetyl-trans-4-hydroxyproline, as an important amino acid derivative, has a wide range of application value in the fields of beauty, skin care and biomedicine. This compound is mainly used as an effective ingredient for anti-aging, anti-wrinkle and moisturizing in cosmetics, while in the field of medicine, it is used to treat osteoarthritis and rheumatoid arthritis, relieve pain and limb stiffness, and shows good gastrointestinal safety. However, the traditional synthesis method of N-acetyl-trans-4-hydroxyproline mainly relies on the chemical reaction between trans-4-hydroxy-L-proline and acetylation reagent. This method is not only complex in process and requires cumbersome separation steps, but also inefficient, resulting in high production costs. In addition, the waste generated during the chemical synthesis process has an adverse impact on the environment, limiting its application in large-scale industrial production.

[0003] In order to solve the above problems, bioenzyme catalytic synthesis methods have gradually attracted attention in recent years. Acyltransferase, as an important biocatalyst, plays a key role in the process of transferring the acetyl group on the acyl donor to trans-4-hydroxy-L-proline to synthesize N-acetyl-trans-4-hydroxyproline. However, the enzyme activity of wild-type acyltransferase is often low, which is difficult to meet the needs of large-scale production. Therefore, finding acyltransferase mutants with high catalytic activity and suitable catalytic methods has become the key to improving the efficiency of N-acetyl-trans-4-hydroxyproline synthesis.

[0004] Although the prior art has attempted to modify acyltransferases by genetic engineering, the resulting mutant enzyme activity is limited, and there are problems such as poor stability and low substrate selectivity. The patent with publication number CN117586979A discloses an acyltransferase mutant, which uses trans-4-hydroxy-L-proline as a substrate and uses a genetically engineered strain expressing the acyltransferase mutant in the technology for catalysis, but the yield of N-acetyl-trans-4-hydroxyproline is still low.

[0005] Therefore, finding a method for efficiently synthesizing N-acetyl-trans-4-hydroxyproline can reduce production costs and reduce environmental impact, providing a new solution for the industrial production of N-acetyl-trans-4-hydroxyproline. Summary of the invention

[0006] In order to further explore the potential of acyltransferase (MsAcT) and improve the enzymatic activity of acyltransferase, the present invention provides an acyltransferase mutant. Compared with before mutation, the mutant has a greatly improved conversion rate for trans-4-hydroxy-L-proline, and further improves the yield of N-acetyl-trans-4-hydroxyproline.

[0007] The first object of the present invention is to provide an acyltransferase mutant with high acetylation activity, wherein the acyltransferase mutant contains mutations at positions 10 and 95 based on the acyltransferase mutant corresponding to the amino acid sequence as shown in SEQ ID NO.1.

[0008] SEQ ID NO.1:

[0009] MAKRILCFGDCLTWGWVPVEDGAPTERFAPDVRWTGVLAQQLGADFEVIEEGLSARTTNIDDPTDPRLNGASYLPSCLATHLPLDLVIIMLGTNDTKAYFRRTPLDIALGMSVLVTQVLTSAGGVGTTYPAPKVLVVSPPPLAPMPHPWFQLIFEGGEQKTTELARVYSALASFMKVPFFDAGSVISTDGVDGIHFTEANNRDLGVALAEQVRSLL

[0010] In one embodiment of the present invention, the nucleotide sequence encoding the acyltransferase mutant having the amino acid sequence shown in SEQ ID NO.1 is shown in SEQ ID NO.2.

[0011] SEQ ID NO.2:

[0012] ATGGCCAAACGCATCTTATGTTTCGGAGACtgcCTGACTTGGGGATGGGTTCCCGTGGAAGACGGTGCTCCTACTGAACGCTTTGCGCCAGATGTACGCTGGACCGGCGTATTAGCTCAGCAGTTAGGCGCTGACTTTGAAGTCATTGAGGAAGGTTTGTCT GCCCGTACGACAAACATCGATGATCCCACCGACCCGCGTTTGAATGGAGCGAGCTATCTTCCCTCGTGCCTGGCAACTCACTTACCGCTGGATCTTGTTATTATCATGTTGGGCACAAACGACACCAAGGCGTATTTCCGCCGCACACCCCTTGATATTGCA CTTGGGATGTCGGTGCTTGTCACACAGGTCTTGACATCCGCGGGGGGAGTAGGCACGACATATCCCGCACCGAAAGTATTAGTCGTCTCGCCTCCTCCCTTGGCACCCATGCCTCACCCCTGGTTTCAACTGATTTTTGAGGGCGGAGAACAAAAGACAACG GAACTTGCCCGTGTGTATTCAGCGCTGGCTTCGTTTATGAAAGTCCCGTTCTTTGATGCCGGTAGCGTGATCAGTACAGACGGCGTAGATGGTATCCACTTTACGGAGGCCAATAACCGTGATCTGGGGGTGGCACTGGCGGAGCAAGTTCGCTCACTTTTA

[0013] Wherein, in the amino acid sequence SEQ ID NO.1, the 10th and 95th amino acid sites are hydrophilic amino acid residues.

[0014] In one embodiment of the present invention, the acyltransferase mutant contains mutations at positions 10 and 95, and also contains mutations at positions 62 or 64, based on the acyltransferase mutant corresponding to the amino acid sequence as shown in SEQ ID NO.1.

[0015] In one embodiment of the present invention, the acyltransferase mutant is obtained by mutating the aspartic acid at position 10 of the acyltransferase mutant with an amino acid sequence as shown in SEQ ID NO.1 to valine, and at the same time mutating the aspartic acid at position 95 of the acyltransferase mutant with an amino acid sequence as shown in SEQ ID NO.1 to isoleucine, and is named: D10V / D95I.

[0016] In one embodiment of the present invention, the aspartic acid at position 62 of the acyltransferase mutant with an amino acid sequence as shown in SEQ ID NO.1 is mutated to lysine, the aspartic acid at position 10 of the acyltransferase mutant with an amino acid sequence as shown in SEQ ID NO.1 is mutated to valine, and the aspartic acid at position 95 of the acyltransferase mutant with an amino acid sequence as shown in SEQ ID NO.1 is mutated to isoleucine, and the resulting protein is named: D62K / D10V / D95I.

[0017] In one embodiment of the present invention, the aspartic acid at position 62 of the acyltransferase mutant with an amino acid sequence as shown in SEQ ID NO.1 is mutated to arginine, the aspartic acid at position 10 of the acyltransferase mutant with an amino acid sequence as shown in SEQ ID NO.1 is mutated to valine, and the aspartic acid at position 95 of the acyltransferase mutant with an amino acid sequence as shown in SEQ ID NO.1 is mutated to isoleucine, and the resulting protein is named: D62R / D10V / D95I.

[0018] In one embodiment of the present invention, the threonine at position 64 of the acyltransferase mutant with an amino acid sequence as shown in SEQ ID NO.1 is mutated to asparagine, the aspartic acid at position 10 of the acyltransferase mutant with an amino acid sequence as shown in SEQ ID NO.1 is mutated to valine, and the aspartic acid at position 95 of the acyltransferase mutant with an amino acid sequence as shown in SEQ ID NO.1 is mutated to isoleucine, and the resulting product is named: T64N / D10V / D95I.

[0019] In one embodiment of the present invention, the amino acid sequence of the D62K / D10V / D95I mutant is shown in SEQ ID NO.3, and the nucleotide sequence is shown in SEQ ID NO.4.

[0020] The present invention also provides a gene encoding the mutant or a recombinant vector carrying the gene.

[0021] The present invention also provides a recombinant cell expressing the mutant or carrying the gene or the recombinant vector.

[0022] In one embodiment of the present invention, the recombinant cell uses bacteria or fungi as expression hosts.

[0023] In one embodiment of the present invention, the host of the recombinant cell is Escherichia coli C43 (DE3).

[0024] The present invention also provides a recombinant enzyme catalyst containing the above-mentioned acyltransferase mutant sequence, wherein the catalyst is in any one of the following forms:

[0025] (1) culturing a recombinant expression transformant, isolating a transformant cell expressing a recombinant enzyme containing the acyltransferase mutant sequence, and obtaining the recombinant enzyme catalyst;

[0026] (2) culturing the recombinant expression transformant, isolating the transformant cells expressing the recombinant enzyme containing the acyltransferase mutant sequence, disrupting the transformant cells expressing the recombinant enzyme to obtain a cell disrupted liquid, and obtaining the recombinant enzyme catalyst;

[0027] (3) Cultivating the recombinant expression transformant, isolating the transformant cells expressing the recombinant enzyme containing the acyltransferase mutant sequence, disrupting the transformant cells expressing the recombinant enzyme to obtain a cell disruption solution, freeze-drying the cell disruption solution to obtain a freeze-dried enzyme powder, and obtaining the recombinant enzyme catalyst.

[0028] The present invention also provides a method for improving acyltransferase activity (AT:H); the AT:H is the ratio of acyltransferase activity to hydrolysis activity;

[0029] The method comprises mutating the aspartic acid at position 10 of the acyltransferase mutant of the amino acid sequence as shown in SEQ ID NO.1 to valine, and simultaneously mutating the aspartic acid at position 95 of the acyltransferase mutant of the amino acid sequence as shown in SEQ ID NO.1 to isoleucine;

[0030] Or the aspartic acid at position 62 of the acyltransferase mutant with an amino acid sequence as shown in SEQ ID NO.1 is mutated to lysine, and the aspartic acid at position 10 of the acyltransferase mutant with an amino acid sequence as shown in SEQ ID NO.1 is mutated to valine, and the aspartic acid at position 95 of the acyltransferase mutant with an amino acid sequence as shown in SEQ ID NO.1 is mutated to isoleucine.

[0031] or the aspartic acid at position 62 of the acyltransferase mutant with an amino acid sequence as shown in SEQ ID NO.1 is mutated to arginine, the aspartic acid at position 10 of the acyltransferase mutant with an amino acid sequence as shown in SEQ ID NO.1 is mutated to valine, and the aspartic acid at position 95 of the acyltransferase mutant with an amino acid sequence as shown in SEQ ID NO.1 is mutated to isoleucine;

[0032] Or the threonine at position 64 of the acyltransferase mutant whose amino acid sequence is as shown in SEQ ID NO.1 is mutated to asparagine, and the aspartic acid at position 10 of the acyltransferase mutant whose amino acid sequence is as shown in SEQ ID NO.1 is mutated to valine, and the aspartic acid at position 95 of the acyltransferase mutant whose amino acid sequence is as shown in SEQ ID NO.1 is mutated to isoleucine.

[0033] The present invention also provides the use of the acyltransferase mutant or the recombinant cell or the recombinant enzyme catalyst in catalyzing the substrate trans-4-hydroxy-L-proline to prepare N-acetyl-trans-4-hydroxyproline.

[0034] In one embodiment of the present invention, the application is to add the acyltransferase mutant or the recombinant cell or the recombinant enzyme catalyst to a reaction system containing trans-4-hydroxy-L-proline and an acyl donor to carry out a reaction to prepare N-acetyl-trans-4-hydroxyproline.

[0035] In one embodiment of the present invention, the acyl donor is vinyl acetate.

[0036] In one embodiment of the present invention, the reaction system further contains a phosphate buffer.

[0037] In one embodiment of the present invention, the reaction system further contains a surfactant and / or metal ions.

[0038] In one embodiment of the present invention, the surfactant is PEG 4000, Triton-X 100, Tween80, AEO-9 or DMSO;

[0039] Preferably, the surfactant is AEO-9.

[0040] In one embodiment of the present invention, the metal ion is Na + , Mn 2+ , K + NH + 、Al 3+ , Ca 2+ , Cu 2+ , Fe 2 + or Mg 2+ ;

[0041] Preferably, the metal ion is Mn 2+ .

[0042] In one embodiment of the present invention, the application is to add the acyltransferase mutant or the recombinant cell or the recombinant enzyme catalyst to a reaction system containing trans-4-hydroxy-L-proline, an acyl donor, a surfactant, and a metal ion to react and prepare N-acetyl-trans-4-hydroxyproline.

[0043] In one embodiment of the present invention, the final concentration of trans-4-hydroxy-L-proline in the system is 100-350 mM, the final concentration of the acyl donor in the system is 1-20% v / v, the final concentration of the surfactant in the system is 0.4-0.8 g / L, and the final concentration of the metal ion in the system is 0.4-1.0 mM.

[0044] In one embodiment of the present invention, the application is to add 250 mM trans-4-hydroxy-L-proline, 10% (v / v) vinyl acetate, 0.4 g / L AEO-9 and 0.8 mM Mn 2+ The MsAcT mutant was added to a 100 mM phosphate buffer (pH 7.0) system at a final concentration of 0.4 mg / mL and reacted at 45°C for 12 h.

[0045] The present invention also provides a method for preparing N-acetyl-trans-4-hydroxyproline by catalyzing the substrate trans-4-hydroxy-L-proline, the method comprising adding the acyltransferase mutant or the recombinant cell or the recombinant enzyme catalyst to a reaction system containing trans-4-hydroxy-L-proline and an acyl donor to carry out a reaction, thereby preparing N-acetyl-trans-4-hydroxyproline.

[0046] In one embodiment of the present invention, the acyl donor is vinyl acetate.

[0047] In one embodiment of the present invention, the reaction system further contains a phosphate buffer.

[0048] In one embodiment of the present invention, the reaction system further contains a surfactant and / or metal ions.

[0049] In one embodiment of the present invention, the surfactant is PEG 4000, Triton-X 100, Tween80, AEO-9 or DMSO;

[0050] Preferably, the surfactant is AEO-9.

[0051] In one embodiment of the present invention, the metal ion is Na + , Mn 2+ , K + NH +、Al 3+ , Ca 2+ , Cu 2+ , Fe 2 + or Mg 2+ ;

[0052] Preferably, the metal ion is Mn 2+ .

[0053] In one embodiment of the present invention, the method is to add the acyltransferase mutant or the recombinant cell or the recombinant enzyme catalyst to a reaction system containing trans-4-hydroxy-L-proline, an acyl donor, a surfactant, and a metal ion to react to prepare N-acetyl-trans-4-hydroxyproline.

[0054] In one embodiment of the present invention, the final concentration of trans-4-hydroxy-L-proline in the system is 100-350 mM, the final concentration of the acyl donor in the system is 1-20% v / v, the final concentration of the surfactant in the system is 0.4-0.8 g / L, and the final concentration of the metal ion in the system is 0.4-1.0 mM.

[0055] In one embodiment of the present invention, the method comprises: adding 250 mM trans-4-hydroxy-L-proline, 10% (v / v) vinyl acetate, 0.4 g / L AEO-9 and 0.8 mM Mn 2+ The MsAcT mutant was added to a 100 mM phosphate buffer (pH 7.0) system at a final concentration of 0.4 mg / mL and reacted at 45°C for 12 h.

[0056] The present invention also provides a method for improving the yield or conversion rate of N-acetyl-trans-4-hydroxyproline, wherein the acyltransferase mutant or the recombinant cell or the recombinant enzyme catalyst is added to a reaction system containing trans-4-hydroxy-L-proline and an acyl donor to carry out a reaction, thereby preparing N-acetyl-trans-4-hydroxyproline.

[0057] In one embodiment of the present invention, the acyl donor is vinyl acetate.

[0058] In one embodiment of the present invention, the reaction system further contains a phosphate buffer.

[0059] In one embodiment of the present invention, the reaction system further contains a surfactant and / or metal ions.

[0060] In one embodiment of the present invention, the surfactant is PEG 4000, Triton-X 100, Tween80, AEO-9 or DMSO;

[0061] Preferably, the surfactant is AEO-9.

[0062] In one embodiment of the present invention, the metal ion is Na + , Mn 2+ , K + NH + 、Al 3+ , Ca 2+ , Cu 2+ , Fe 2 + or Mg 2+ ;

[0063] Preferably, the metal ion is Mn 2+ .

[0064] In one embodiment of the present invention, the method is to add the acyltransferase mutant or the recombinant cell or the recombinant enzyme catalyst to a reaction system containing trans-4-hydroxy-L-proline, an acyl donor, a surfactant, and a metal ion to react to prepare N-acetyl-trans-4-hydroxyproline.

[0065] In one embodiment of the present invention, the final concentration of trans-4-hydroxy-L-proline in the system is 100-350 mM, the final concentration of the acyl donor in the system is 1-20% v / v, the final concentration of the surfactant in the system is 0.4-0.8 g / L, and the final concentration of the metal ion in the system is 0.4-1.0 mM.

[0066] In one embodiment of the present invention, the method comprises: adding 250 mM trans-4-hydroxy-L-proline, 10% (v / v) vinyl acetate, 0.4 g / L AEO-9 and 0.8 mM Mn 2+ The MsAcT mutant was added to a 100 mM phosphate buffer (pH 7.0) system at a final concentration of 0.4 mg / mL and reacted at 45°C for 12 h.

[0067] The present invention also provides the use of the mutant, the gene, the recombinant vector, the recombinant cell, the recombinant enzyme catalyst or the method in the field of biomaterials, medicine or cosmetics.

[0068] Beneficial effects:

[0069] The present invention is based on structural information combined with simulation calculation, and uses PCR method to perform site-directed saturation mutagenesis, and finally obtains MsAcT mutants with high acyltransferase activity. The acyltransferase mutants obtained by the present invention have higher acyltransferase activity and catalytic efficiency than the original enzyme before mutation, and can improve production efficiency. Among them, the mutant D62K / D10V / D95I has the best effect, with an enzyme activity (AT:H) as high as 4.5; when it catalyzes the substrate alone, the yield of N-acetyl-trans-4-hydroxyproline reaches 8.76g / L, which is 93.4% higher than before mutation; after adding surfactants and metal ions, its catalytic synthesis of N-acetyl-trans-4-hydroxyproline has a yield of up to 12.71g / L.

[0070] Therefore, the acyltransferase mutant of the present invention is of great significance in the efficient biosynthesis of N-acetyl-trans-4-hydroxyproline and has broad application prospects in the fields of biomaterials, medicine or cosmetics. BRIEF DESCRIPTION OF THE DRAWINGS

[0071] Figure 1 Agarose gel electrophoresis diagram;

[0072] Figure 2 This is the SDS-PAGE picture. DETAILED DESCRIPTION

[0073] The technical solutions described in the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in the field without creative work are within the scope of protection of the present invention. The materials and reagents used in the embodiments can be obtained from commercial channels unless otherwise specified.

[0074] The culture medium and buffer solution involved in the embodiment:

[0075] LB solid medium (1 L): tryptone 10 g, yeast powder 5 g, NaCl 10 g, agar powder 17 g.

[0076] LB liquid culture medium: 10 g tryptone, 5 g yeast powder, 10 g NaCl, dissolved in deionized water and fixed to 1000 mL.

[0077] Binding Buffer: Dissolve 17.54 g NaCl and 6.00 g NaH2PO4 in deionized water and make up to 1000 mL. Adjust the pH to 8 with NaOH solution.

[0078] Elution buffer with different concentrations of imidazole: NaCl 29.22 g, Tris 2.42 g, imidazole 0.68 / 27.23 g (2 / 400 mM) were dissolved in deionized water and then made up to 1000 mL, and the pH was adjusted to 8 with hydrochloric acid.

[0079] Trans-4-hydroxy-L-proline, p-nitrophenyl acetate, AEO-9, reagents, consumables and competent cells used were purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0080] Example 1: Construction of hydrophobic acyltransferase mutants

[0081] 1. Site-directed mutagenesis strategy

[0082] The hydrophilic amino acid residues in the active pocket (non-catalytic triad) of the acyltransferase MsAcT (S11C) (amino acid sequence is SEQ ID NO.1) were selected, and the 10th and 95th Asp were simulated for saturation mutation, and one or both sites were mutated to obtain hydrophobic mutants. The binding energy after virtual mutation was calculated, and the mutants with the highest ranking were selected according to the size of the binding energy. Finally, three mutation modes were determined: D10V / D95I, D10V / D95W, and D10L / D95I (Table 1).

[0083] Table 1 Screening based on mutation binding energy

[0084]

[0085] 2. Construction of mutant recombinant plasmid

[0086] (1) chemically synthesizing a gene encoding an acyltransferase mutant MsAcT(S11C) having an amino acid sequence as shown in SEQ ID NO.1 (the nucleotide sequence of the gene is shown in SEQ ID NO.2), wherein MsAcT(S11C) is obtained by mutating the serine at position 11 of the amino acid sequence of the wild-type acyltransferase MsAcT to cysteine;

[0087] (2) Construction of recombinant vector: Using the primers in Table 2 and the commercial plasmid pET22b as the backbone, the acyltransferase MsAcT (S11C) sequence was connected to the pET-22b (+) vector as the target gene template, and linear amplification was performed using PCR technology. After linear amplification, the target gene MsAcT (S11C) was connected to the pET22b vector using the One Step Seamless Cloning Mix homologous recombinase and incubated at 50°C for 30 min to obtain the recombinant vector pET-22b (+)-MsAcT (S11C);

[0088] Table 2 Primer sequences

[0089]

[0090] (3) Using the nucleotide sequence of the recombinant plasmid pET-22b(+)-MsAcT(S11C) as a template, primers containing mutation sites were designed to mutate the aspartic acid at position 10 of the acyltransferase mutant MsAcT(S11C) as shown in SEQ ID NO.1 to valine, and at the same time, the aspartic acid at position 95 of the acyltransferase mutant MsAcT(S11C) as shown in SEQ ID NO.1 to isoleucine to obtain the MsAcT(S11C / D10V / D95I) mutant (or D10V / D95I mutant); the aspartic acid at position 10 of the acyltransferase mutant MsAcT(S11C) as shown in SEQ ID NO.1 to valine, and at the same time, the aspartic acid at position 95 of the acyltransferase mutant MsAcT(S11C) as shown in SEQ ID NO.1 to isoleucine to obtain the MsAcT(S11C / D10V / D95I) mutant (or D10V / D95I mutant). The aspartic acid at position 95 of the acyltransferase mutant MsAcT (S11C) shown in NO.1 was mutated to tryptophan to obtain the MsAcT (S11C / D10V / D95W) mutant (or called the D10V / D95W mutant); the aspartic acid at position 10 of the acyltransferase mutant MsAcT (S11C) with an amino acid sequence as shown in SEQ ID NO.1 was mutated to leucine, and the aspartic acid at position 95 of the acyltransferase mutant MsAcT (S11C) with an amino acid sequence as shown in SEQ ID NO.1 was mutated to tryptophan to obtain the MsAcT (S11C / D10L / D95W) mutant (or called the D10L / D95W mutant), and the primer sequences are shown in Table 3.

[0091] Site-directed mutagenesis was performed using PCR technology to obtain recombinant plasmids pET-22b(+)-MsAcT(S11C / D10V / D95I), pET-22b(+)-MsAcT(S11C / D10V / D95W), and pET-22b(+)-MsAcT(S11C / D10L / D95W).

[0092] The PCR reaction system is shown in Table 4. The PCR reaction conditions are 98°C for 30 s; 98°C for 10 s, 58°C for 5 s, 72°C for 3 min, for a total of 30 cycles; 72°C for 2 min; and stored at 4°C.

[0093] The PCR products were detected by 1% agarose gel electrophoresis. Figure 1The PCR products were transformed into competent E. coli JM109 cells, positive transformants were picked, plasmids were extracted, and sequencing was performed for verification. Finally, three mutants were successfully constructed, namely E. coli-JM09-MsAcT (S11C / D10V / D95I), E. coli-JM09-MsAcT (S11C / D10V / D95W), and E. coli-JM09-MsAcT (S11C / D10L / D95W).

[0094] Table 3 Primers

[0095]

[0096] Table 4 PCR reaction system

[0097]

[0098] Example 2: Expression analysis and purification of acyltransferase mutant proteins

[0099] 1. Inducible expression of acyltransferase mutant protein

[0100] The recombinant plasmids pET-22b(+)-MsAcT(S11C), pET-22b(+)-MsAcT(S11C / D10V / D95I), pET-22b(+)-MsAcT(S11C / D10V / D95W), and pET-22b(+)-MsAcT(S11C / D10L / D95W) obtained in Example 1 were transformed into Escherichia coli C43(DE3) strains that efficiently express hydrophobic proteins by heat shock method. The recombinant Escherichia coli containing the MsAcT (S11C) recombinant plasmid or mutant plasmid are obtained, namely E. coli-DE3-MsAcT (S11C), E. coli-DE3-MsAcT (S11C / D10V / D95I), E. coli-DE3-MsAcT (S11C / D10V / D95W), and E. coli-DE3-MsAcT (S11C / D10L / D95W).

[0101] The three recombinant E. coli successfully constructed were inoculated into 4 mL of LB liquid medium containing ampicillin (100 μg / mL) for activation and cultured at 37°C, 200 rpm for 12 h; then inoculated into 50 mL of LB liquid medium at a 1% (v / v) inoculum and cultured at 37°C, 220 rpm for 3-4 h until OD 600=0.6-0.8; add 250μMIPTG (isopropyl-β-D-thiogalactoside), 16℃, 220rpm, low temperature induction for 16h. Centrifuge the fermentation broth at 4℃, 5000rpm for 5min to collect the bacteria; resuspend the bacteria with 20mL Binding Buffer (50mM NaH2PO4, 300mM NaCl, pH 8.0); in an ice-water bath, use an ultrasonic cell disruptor to disrupt the cells for 20min (ultrasound at 45% power for 2s, with an interval of 2s); centrifuge at 4℃, 10000rpm for 40min, and use the supernatant as the crude enzyme. Take 15μL of the crude enzyme in a 1.5mL centrifuge tube, mix with 5μL of 5×SDS PAGE loading buffer, place in a 100℃ metal bath for 10min, and immediately perform SDS-PAGE analysis. The results are shown in Figure 2 shown.

[0102] 2. Protein purification

[0103] The crude enzyme obtained in step 1 above was filtered through a 0.22 μm filter membrane and then loaded onto a pre-equilibrated nickel column; non-specific binding proteins were first eluted with 10 column volumes of elution buffer (2 mM imidazole); then the target protein was eluted with 3 column volumes of elution buffer (400 mM imidazole); the obtained protein purification solution was placed at 4°C, dialyzed overnight in 100 mM phosphate buffer (pH 7.0) to remove imidazole to obtain a purified enzyme solution, which was stored in a 4°C refrigerator. Finally, the protein concentration was determined by the Bradford method, and the protein purity was detected by 10% SDS-PAGE gel electrophoresis.

[0104] Finally, four purified enzyme solutions were obtained, namely, a purified enzyme solution containing MsAcT (S11C), a purified enzyme solution containing MsAcT (S11C / D10V / D95I), a purified enzyme solution containing MsAcT (S11C / D10V / D95W), and a purified enzyme solution containing MsAcT (S11C / D10L / D95W).

[0105] Example 3: Acyltransferase activity (AT:H) determination of acyltransferase mutants

[0106] The p-nitrophenyl acyltransferase (pNP-AcT) method was used to determine the hydrolase and acyltransferase activities of MsAcT mutants. The hydrolase activity was assessed by monitoring the release of p-nitrophenol from p-nitrophenyl ester at 405 nm. The acyltransferase activity was determined by the increased release of p-nitrophenol (pNP) after the addition of methanol. The acetylation activity of the mutants was reflected by the ratio of acyltransferase activity (AT) to hydrolytic activity (H) (AT:H).

[0107] The experiments were performed at 25 °C and the reaction scale was 1 mL.

[0108] Hydrolase activity experimental group: p-nitrophenyl acetate (final concentration of 1 mM), benzyl alcohol (final concentration of 10 mM), the purified enzyme solution containing MsAcT (S11C) or MsAcT (S11C / D10V / D95I) or MsAcT (S11C / D10V / D95W) or MsAcT (S11C / D10L / D95W) obtained in Example 2 (final concentration of 0.1 mg / L), 200 mM potassium phosphate buffer (pH 7.5) and DMSO with a final concentration of 0.1% (v / v) were added to each well in sequence;

[0109] Acyltransferase activity test group: based on the hydrolase activity test group, benzyl alcohol was added to a final concentration of 10 mM;

[0110] Control group: p-nitrophenyl acetate (final concentration of 1 mM), benzyl alcohol (final concentration of 10 mM), 200 mM potassium phosphate buffer (pH 7.5) and DMSO with a final concentration of 0.1% (v / v) were added to each well in sequence.

[0111] After the three groups reacted for 15 min, 200 μL was added to a 96-well plate, and the absorbance value of each well of the three groups was detected at a wavelength of 405 nm using an ELISA reader. 405 , calculate the amount of p-nitrophenol pNP produced. The calculation formula of acyltransferase activity (AT:H) is as follows:

[0112] AT:H=(n2-n0) / (n1-n0)

[0113] Among them, n0, n1, and n2 represent the amount of pNP generated in the control group, the hydrolase activity experimental group, and the acyltransferase activity experimental group (i.e., the absorbance value A 405 ).

[0114] The results of the acyltransferase activity assay of the acyltransferase mutants are shown in Table 5. Compared with MsAcT (S11C), the AT:H of the mutant D10V / D95I was significantly increased, and it was further applied (Table 5).

[0115] Table 5 Acyltransferase activity (AT:H) determination of acyltransferase mutants

[0116] Mutants Control MsAcT(S11C) D10V / D95W D10V / D95I D10L / D95I AT:H 1.03 2.71 2.91 3.54 2.68

[0117] Example 4: Synthesis of N-acetyl-trans-4-hydroxyproline catalyzed by acyltransferase mutants

[0118] The reaction scale was 1 mL.

[0119] Experimental group: trans-4-hydroxy-L-proline at a final concentration of 250 mM and 10% (v / v) vinyl acetate were added to 100 mM phosphate buffer (pH 7.0), and then the purified enzyme solution containing MsAcT (S11C) or MsAcT (S11C / D10V / D95I) or MsAcT (S11C / D10V / D95W) obtained in Example 2 was added at a final concentration of 0.4 mg / mL.

[0120] Control group: trans-4-hydroxy-L-proline at a final concentration of 250 mM and 10% (v / v) vinyl acetate were added to 100 mM phosphate buffer (pH 7.0).

[0121] After the above solution was reacted at 45°C for 12 hours, a sample was taken, and 4 times the volume of methanol was added to the sample and mixed. After the mixture was allowed to stand at -20°C for 4 hours, it was centrifuged at 4°C and 12000 rpm for 5 minutes, and the supernatant was aspirated for high performance liquid chromatography detection.

[0122] The HPLC detection conditions of N-acetyl-trans-4-hydroxyproline are as follows: Agilent HPLC was used to separate the liquid phase using a Diamond C-18, 4.6×250 mm column: flow rate 0.8 mL / min, mobile phase A was 2% methanol in water, mobile phase B was 2% methanol and 0.1% phosphoric acid in water. Column temperature 25°C, detection wavelength 205 nm. A single sample was run for 20 min.

[0123] The results of the determination of N-acetyl-trans-4-hydroxyproline production of the acyltransferase mutants are shown in Table 6. Compared with the original enzyme MsAcT (S11C), the N-acetyl-trans-4-hydroxyproline production of the mutant D10V / D95I was significantly increased to 6.27 g / L.

[0124] Table 6 N-acetyl-trans-4-hydroxyproline production assay of acyltransferase mutants

[0125]

[0126]

[0127] Example 5: Construction, expression and purification of combined mutants and AT:H determination

[0128] 1. Construction strategy of combined mutants

[0129] Based on the results of Examples 1 to 4 above, the mutant D10V / D95I can significantly increase AT:H, and the combination of multiple beneficial single-point mutations can produce a cumulative or synergistic effect on catalytic activity. Previous studies have found that mutations at positions 62 and 64 can significantly increase the enzymatic activity of the acyltransferase MsAcT (S11C). Therefore, the following three combined mutants were further constructed, namely mutants T64N / D10V / D95I, D62R / D10V / D95I, and D62K / D10V / D95I, specifically:

[0130] The aspartic acid at position 62 of the acyltransferase mutant MsAcT (S11C) whose amino acid sequence is shown in SEQ ID NO.1 is mutated to lysine, the aspartic acid at position 10 of the acyltransferase mutant MsAcT (S11C) whose amino acid sequence is shown in SEQ ID NO.1 is mutated to valine, and the aspartic acid at position 95 of the acyltransferase mutant MsAcT (S11C) whose amino acid sequence is shown in SEQ ID NO.1 is mutated to isoleucine to obtain a MsAcT (S11C / D62K / D10V / D95I) mutant (or referred to as a D62K / D10V / D95I mutant);

[0131] The aspartic acid at position 62 of the acyltransferase mutant MsAcT (S11C) whose amino acid sequence is shown in SEQ ID NO.1 is mutated to arginine, the aspartic acid at position 10 of the acyltransferase mutant MsAcT (S11C) whose amino acid sequence is shown in SEQ ID NO.1 is mutated to valine, and the aspartic acid at position 95 of the acyltransferase mutant MsAcT (S11C) whose amino acid sequence is shown in SEQ ID NO.1 is mutated to isoleucine to obtain a MsAcT (S11C / D62R / D10V / D95I) mutant (or referred to as a D62R / D10V / D95I mutant);

[0132] The threonine at position 64 of the acyltransferase mutant MsAcT (S11C) as shown in the amino acid sequence of SEQ ID NO.1 is mutated to asparagine, the aspartic acid at position 10 of the acyltransferase mutant MsAcT (S11C) as shown in the amino acid sequence of SEQ ID NO.1 is mutated to valine, and the aspartic acid at position 95 of the acyltransferase mutant MsAcT (S11C) as shown in the amino acid sequence of SEQ ID NO.1 is mutated to isoleucine to obtain a MsAcT (S11C / T64N / D10V / D95I) mutant (or called a T64N / D10V / D95I mutant).

[0133] 2. Construction and expression purification of combined mutants

[0134] The recombinant plasmid pET-22b(+)-MsAcT(S11C / D10V / D95I) obtained in Example 1 was used as a template and the primer sequences shown in Table 7 were used to amplify and construct the above mutants.

[0135] The PCR products were detected by 1% agarose gel electrophoresis. The recombinant plasmids pET-22b(+)-T64N / D10V / D95I, pET-22b(+)-D62R / D10V / D95I, and pET-22b(+)-D62K / D10V / D95I verified by sequencing were transformed into Escherichia coli C43(DE3) chemically competent cells, and the specific implementation methods of induced expression and protein purification were the same as those in Example 2.

[0136] The protein expression was detected by SDS-PAGE electrophoresis. All combined mutants were able to achieve soluble expression and were successfully purified by nickel column affinity chromatography.

[0137] Finally, three purified enzyme solutions were obtained, namely, a purified enzyme solution containing MsAcT (S11C / D62K / D10V / D95I), a purified enzyme solution containing MsAcT (S11C / D62R / D10V / D95I), and a purified enzyme solution containing MsAcT (S11C / T64N / D10V / D95I).

[0138] Table 7 Primers

[0139]

[0140] 3. Combination mutant AT:H assay

[0141] Using pNP-AcT as a substrate, the acyltransferase activity of different combination mutants of the enzyme solution obtained in step 2 above was determined. The specific implementation method is the same as that in Example 3.

[0142] The results are shown in Table 8. Compared with MsAcT(S11C), the enzyme activities of all mutants were improved. Among them, the triple-point combination mutant D62K / D10V / D95I had the highest acyltransferase activity, which was increased by about 2.4 times compared with MsAcT(S11C).

[0143] Table 8 Acyltransferase activity (AT:H) determination of acyltransferase mutants

[0144] Mutants Control MsAcT(S11C) T64N / D10V / D95I D62R / D10V / D95I D62K / D10V / D95I AT:H 1.03 2.71 3.49 4.21 6.49

[0145] Example 6: Synthesis of N-acetyl-trans-4-hydroxyproline catalyzed by combined mutants

[0146] The yield of N-acetyl-trans-4-hydroxyproline synthesized by the combined mutant was determined using the purified enzyme solution containing MsAcT (S11C / D62K / D10V / D95I), the purified enzyme solution containing MsAcT (S11C / D62R / D10V / D95I), and the purified enzyme solution containing MsAcT (S11C / T64N / D10V / D95I) obtained in step 2 of Example 5. The determination method was the same as that in Example 4.

[0147] The conversion rate of N-acetyl-trans-4-hydroxyproline was calculated as follows:

[0148] N-acetyl-trans-4-hydroxyproline conversion rate = actual molar amount of N-acetyl-trans-4-hydroxyproline in the system / trans-4-hydroxy-L-proline consumption in the system * 100%

[0149] The results of synthesizing N-acetyl-trans-4-hydroxyproline using trans-4-hydroxy-L-proline and vinyl acetate as substrates are shown in Table 9. Among them, D62K / D10V / D95I has the highest yield of 13.62 g / L, which is 148% higher than that of D62K / D10V.

[0150] Table 9 N-acetyl-trans-4-hydroxyproline production assay of acyltransferase mutants

[0151]

[0152] Example 7: Synthesis of N-acetyl-trans-4-hydroxyproline by adding different surfactants

[0153] The effects of surfactant types and concentrations on the synthesis of N-acetyl-trans-4-hydroxyproline were detected respectively.

[0154] 1. The reaction scale is 1 mL. Add trans-4-hydroxy-L-proline at a final concentration of 250 mM and 10% (v / v) vinyl acetate to 100 mM phosphate buffer (pH 7.0), then add the purified enzyme solution containing MsAcT (S11C / D62K / D10V / D95I) obtained in step 2 of Example 5 at a final concentration of 0.4 mg / mL, and then add PEG 4000, Tween 80, Triton-X 100, AEO-9 or DMSO at a final concentration of 1 g / L.

[0155] After the above solution was reacted at 45°C for 12 hours, a sample was taken, and 4 times the volume of methanol was added to the sample and mixed. After the mixed solution was allowed to stand at -20°C for 4 hours, it was centrifuged at 4°C and 12000 rpm for 5 minutes, and the supernatant was taken for high performance liquid chromatography to detect the yield of synthesized N-acetyl-trans-4-hydroxyproline.

[0156] The HPLC detection conditions of N-acetyl-trans-4-hydroxyproline are as follows: Agilent HPLC was used to separate the liquid phase using a Diamond C-18, 4.6×250 mm column: flow rate 0.8 mL / min, mobile phase A was 2% methanol in water, mobile phase B was 2% methanol and 0.1% phosphoric acid in water. Column temperature 25°C, detection wavelength 205 nm. A single sample was run for 20 min.

[0157] The conversion rate of N-acetyl-trans-4-hydroxyproline was calculated as follows:

[0158] N-acetyl-trans-4-hydroxyproline conversion rate = actual molar amount of N-acetyl-trans-4-hydroxyproline in the system / trans-4-hydroxy-L-proline consumption in the system * 100%

[0159] The results showed that the addition of AEO-9 had the most significant effect on the synthesis of N-acetyl-trans-4-hydroxyproline (Table 10).

[0160] Table 10 Determination of the yield of N-acetyl-trans-4-hydroxyproline synthesized by adding different surfactants

[0161]

[0162] 2. The reaction scale is 1 mL. Add trans-4-hydroxy-L-proline at a final concentration of 250 mM and 10% (v / v) vinyl acetate to 100 mM phosphate buffer (pH 7.0), then add the purified enzyme solution containing MsAcT (S11C / D62K / D10V / D95I) obtained in step 2 of Example 5 at a final concentration of 0.4 mg / mL, and then add AEO-9 at a final concentration of 0 g / L, 0.1 g / L, 0.2 g / L, 0.4 g / L, 0.6 g / L, 0.8 g / L or 1 g / L.

[0163] The method for detecting the yield and conversion rate of synthesized N-acetyl-trans-4-hydroxyproline is the same as that in step 1 above.

[0164] The results in Table 11 show that the addition of 0.8 g / L AEO-9 has the most significant effect on the synthesis of N-acetyl-trans-4-hydroxyproline, with an N-acetyl-trans-4-hydroxyproline yield of 17.2 g / L and a conversion rate of 86.2%.

[0165] Table 11 Determination of the yield of N-acetyl-trans-4-hydroxyproline synthesized with different AEO-9 addition amounts

[0166]

[0167] Example 8: Synthesis of N-acetyl-trans-4-hydroxyproline by adding different metal ions

[0168] The effects of metal ions and their concentrations on the synthesis of N-acetyl-trans-4-hydroxyproline were detected respectively.

[0169] 1. The reaction scale was 1 mL. To 100 mM phosphate buffer (pH 7.0), add trans-4-hydroxy-L-proline at a final concentration of 250 mM, 10% (v / v) vinyl acetate, and then add the purified enzyme solution containing MsAcT (S11C / D62K / D10V / D95I) obtained in step 2 of Example 5 at a final concentration of 0.4 mg / mL, and then add Na + , Mn 2+ , K + NH + 、Al 3+ , Ca 2+ , Cu 2+ , Fe 2+ Mg 2+ of chloride salt to make the final concentration of metal ions in the system reach 1 mM.

[0170] The method for detecting the yield and conversion rate of synthesized N-acetyl-trans-4-hydroxyproline is the same as step 1 in the above embodiment 7.

[0171] The results in Table 12 show that: Mn 2+ The addition had the most significant effect on the synthesis of N-acetyl-trans-4-hydroxyproline.

[0172] Table 12 Determination of the yield of N-acetyl-trans-4-hydroxyproline synthesized by adding different metal ions

[0173]

[0174] 2. The reaction scale was 1 mL. To 100 mM phosphate buffer (pH 7.0), add trans-4-hydroxy-L-proline at a final concentration of 250 mM, 10% (v / v) vinyl acetate, and then add the purified enzyme solution containing MsAcT (S11C / D62K / D10V / D95I) obtained in step 2 of Example 5 at a final concentration of 0.4 mg / mL, and then add Mn at final concentrations of 0 mM, 0.1 mM, 0.2 mM, 0.4 mM, 0.6 mM, 0.8 mM, and 1 mM.2+ .

[0175] The method for detecting the yield and conversion rate of synthesized N-acetyl-trans-4-hydroxyproline is the same as step 1 in the above embodiment 7.

[0176] The results showed that 1mM Mn 2+ The addition had the most significant effect on the synthesis of N-acetyl-trans-4-hydroxyproline, with an N-acetyl-trans-4-hydroxyproline yield of 12.31 g / L and a conversion rate of 86% (Table 13).

[0177] Table 13 Different Mn 2+ Yield determination of N-acetyl-trans-4-hydroxyproline synthesized by adding

[0178]

[0179] Example 9: AEO-9 and Mn 2+ Compounding and adding synthetic N-acetyl-trans-4-hydroxyproline

[0180] The final concentrations of AEO-9 were 0, 0.1, 0.2, 0.4, 0.6, 0.8, and 1.0 g / L, and the final concentrations of Mn were 0, 0.2, 0.4, 0.6, 0.8, 1.0, and 1.2 mM. 2+ Effects of complexing on the synthesis of N-acetyl-trans-4-hydroxyproline.

[0181] The reaction scale was 1 mL. To 100 mM phosphate buffer (pH 7.0), add trans-4-hydroxy-L-proline at a final concentration of 250 mM, 10% (v / v) vinyl acetate, and then add the purified enzyme solution containing MsAcT (S11C / D62K / D10V / D95I) obtained in step 2 of Example 5 at a final concentration of 0.4 mg / mL, and then add different concentrations of AEO-9 and different concentrations of Mn 2+ Chloride salts, AEO-9 and Mn 2+ The adding strategy is shown in Table 13.

[0182] The method for detecting the yield and conversion rate of synthesized N-acetyl-trans-4-hydroxyproline is the same as step 1 in the above embodiment 7.

[0183] The results are shown in Table 14. 0.4 g / L AEO-9 and 0.8 mM Mn 2+ The addition of AE0-9 and Mn had the most significant effect on the synthesis of N-acetyl-trans-4-hydroxyproline, and the yield of N-acetyl-trans-4-hydroxyproline reached 14.27 g / L, which was higher than that of the single addition of AE0-9 and Mn 2+The conversion rate of trans-4-hydroxy-L-proline reached 91%, which was higher than that of adding AE0-9 and Mn 2+ An increase of 102% and 106% respectively.

[0184] Table 14 AEO-9 and Mn 2+ Compounded to form N-acetyl-trans-4-hydroxyproline

[0185]

[0186] Note: The results are presented as "N-acetyl-trans-4-hydroxyproline yield / conversion rate".

[0187] The sequence involved in the present invention is as follows:

[0188] SEQ ID NO.1:

[0189] MAKRILCFGDCLTWGWVPVEDGAPTERFAPDVRWTGVLAQQLGADFEVIEEGLSARTTNIDDPTDPRLNGASYLPSCLATHLPLDLVIIMLGTNDTKAYFRRTPLDIALGMSVLVTQVLTSAGGVGTTYPAPKVLVVSPPPLAPMPHPWFQLIFEGGEQKTTELARVYSALASFMKVPFFDAGSVISTDGVDGIHFTEANNRDLGVALAEQVRSLL

[0190] SEQ ID NO.2:

[0191] ATGGCCAAACGCATCTTATGTTTCGGAGACtgcCTGACTTGGGGATGGGTTCCCGTGGAAGACGGTGCTCCTACTGAACGCTTTGCGCCAGATGTACGCTGGACCGGCGTATTAGCTCAGCAGTTAGGCGCTGACTTTGAAGTCATTGAGGAAGGTTTGTCT GCCCGTACGACAAACATCGATTCCCACCGACCCGCGTTTGAATGGAGCGAGCTATCTTCCCTCGTGCCTGGCAACTCACTTACCGCTGGATCTTGTTTATTATCATGTTGGGCACAAACGACACCAAGGCGTATTTCCGCCGCACACCCCTTGATATTGCA CTTGGGATGTCGGTGCTTGTCACACAGGTCTTGACATCCGCGGGGGGAGTAGGCACGACATATCCCGCACCGAAAGTATTAGTCGTTCCGCCTCCTCCCTTGGACCCATGCCTCACCCCTGGTTTCAACTGATTTTTGAGGGCGGAGAACAAAAGACAACGGAACTTGCCCGTGTGATTCAGCCTGGCTTCGTTTATGAAAGTCCCGTTCTTTGATGCCGGTAGCGTGATCAGTACAGACGGCGTAGATGGTATCACTTTACGGAGGCCAATAACCGTGATCTGGGGGTGGCACTGGGGAGCAAGTTCGCTCACTTT

[0192] SEQ ID NO.3:

[0193] MAKRILCFGVCLTWGWVPVEDGAPTERFAPDVRWTGVLAQQLGADFEVIEEGLSARTTNIDKPTDPRLNGASYLPSCLATHLPLDLVIIMLGTNITKAYFRRTPLDIALGMSVLVTQVLTSAGGVGTTYPAPKVLVVSPPPLAPMHPWFQLIFEGGEQKTTELARVYSALASFMKVPFFDAGSVISTDGVDGIHFTEANNRDLGVALAEQVRSLL

[0194] SEQ ID NO.4:

[0195] ATGGCCAAACGCATCTTATGTTTCGGAGtttgcCTGACTTGGGGATGGGTTCCCGTGGAAGACGGTGCTCCTACTGAACGCTTTGCGCCAGATGTACGCTGGACCGGCGTATTAGCTCAGCAGTTAGGCGCTGACTTTGAAGTCATTGAGGAAGGTTTGTCT GCCCGTACGACAAACATCGATaaaaCCCACCGACCCGCGTTTGAATGGAGCGAGCTATCTTCCCTCGTGCCTGGCAACTCACTTACCGCTGGATCTTGTTATTATCATGTTGGGCACAAACatTACCAAGGCGTATTTCCGCCGCACACCCCTTGATATTGCA CTTGGGATGTCGGTGCTTGTCACACAGGTCTTGACATCCGCGGGGGGAGTAGGCACGACATATCCCGCACCGAAAGTATTAGTCGTCTCGCCTCCTCCCTTGGCACCCATGCCTCACCCCTGGTTTCAACTGATTTTTGAGGGCGGAGAACAAAAGACAACG GAACTTGCCCGTGTGTATTCAGCGCTGGCTTCGTTTATGAAAGTCCCGTTCTTTGATGCCGGTAGCGTGATCAGTACAGACGGCGTAGATGGTATCCACTTTACGGAGGCCAATAACCGTGATCTGGGGGTGGCACTGGCGGAGCAAGTTCGCTCACTTTTA

[0196] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. An acyltransferase mutant, characterized in that The acyltransferase mutant contains mutations at positions 10 and 95 based on the acyltransferase mutant corresponding to the amino acid sequence as shown in SEQ ID NO.

1.

2. The acyltransferase mutant according to claim 1, characterized in that The acyltransferase mutant contains mutations at positions 10 and 95, and also contains mutations at positions 62 or 64, based on the acyltransferase mutant corresponding to the amino acid sequence as shown in SEQ ID NO.

1.

3. The acyltransferase mutant according to claim 1 or 2, characterized in that The acyltransferase mutant is obtained by mutating the aspartic acid at position 10 of the acyltransferase mutant with an amino acid sequence as shown in SEQ ID NO.1 to valine, and simultaneously mutating the aspartic acid at position 95 of the acyltransferase mutant with an amino acid sequence as shown in SEQ ID NO.1 to isoleucine; or the amino acid sequence of the acyltransferase mutant as shown in SEQ ID NO.1 is mutated to lysine at the 62nd aspartic acid, the amino acid sequence of the acyltransferase mutant as shown in SEQ ID NO.1 is mutated to valine at the 10th aspartic acid, and the amino acid sequence of the acyltransferase mutant as shown in SEQ ID NO.1 is mutated to isoleucine at the 95th aspartic acid; or the aspartic acid at position 62 of the acyltransferase mutant with the amino acid sequence as shown in SEQ ID NO.1 is mutated to arginine, the aspartic acid at position 10 of the acyltransferase mutant with the amino acid sequence as shown in SEQ ID NO.1 is mutated to valine, and the aspartic acid at position 95 of the acyltransferase mutant with the amino acid sequence as shown in SEQ ID NO.1 is mutated to isoleucine; Or the threonine at position 64 of the acyltransferase mutant whose amino acid sequence is as shown in SEQ ID NO.1 is mutated to asparagine, the aspartic acid at position 10 of the acyltransferase mutant whose amino acid sequence is as shown in SEQ ID NO.1 is mutated to valine, and the aspartic acid at position 95 of the acyltransferase mutant whose amino acid sequence is as shown in SEQ ID NO.1 is mutated to isoleucine.

4. A gene encoding the acyltransferase mutant according to any one of claims 1 to 3 or a recombinant vector carrying the gene.

5. A recombinant cell expressing the acyltransferase mutant according to any one of claims 1 to 3 or carrying the gene or the recombinant vector according to claim 4.

6. A recombinant enzyme catalyst comprising the acyltransferase mutant sequence according to any one of claims 1 to 3, characterized in that: The catalyst is in any of the following forms: (1) culturing a recombinant expression transformant, isolating a transformant cell expressing a recombinant enzyme containing the acyltransferase mutant sequence of claim 1, and obtaining the recombinant enzyme catalyst; (2) culturing the recombinant expression transformant, isolating the transformant cells expressing the recombinant enzyme containing the acyltransferase mutant sequence of claim 1, disrupting the transformant cells expressing the recombinant enzyme to obtain a cell disrupted liquid, and obtaining the recombinant enzyme catalyst; (3) Cultivating the recombinant expression transformant, isolating the transformant cells expressing the recombinant enzyme containing the acyltransferase mutant sequence of claim 1, disrupting the transformant cells expressing the recombinant enzyme to obtain a cell disruption solution, and freeze-drying the cell disruption solution to obtain a freeze-dried enzyme powder to obtain the recombinant enzyme catalyst.

7. A method for increasing acyltransferase AT:H, characterized in that: The method comprises mutating the aspartic acid at position 10 of the acyltransferase mutant of the amino acid sequence as shown in SEQ ID NO.1 to valine, and mutating the aspartic acid at position 95 of the acyltransferase mutant of the amino acid sequence as shown in SEQ ID NO.1 to isoleucine; or the aspartic acid at position 62 of the acyltransferase mutant with the amino acid sequence as shown in SEQ ID NO.1 is mutated to lysine, the aspartic acid at position 10 of the acyltransferase mutant with the amino acid sequence as shown in SEQ ID NO.1 is mutated to valine, and the aspartic acid at position 95 of the acyltransferase mutant with the amino acid sequence as shown in SEQ ID NO.1 is mutated to isoleucine; or the aspartic acid at position 62 of the acyltransferase mutant with an amino acid sequence as shown in SEQ ID NO.1 is mutated to arginine, the aspartic acid at position 10 of the acyltransferase mutant with an amino acid sequence as shown in SEQ ID NO.1 is mutated to valine, and the aspartic acid at position 95 of the acyltransferase mutant with an amino acid sequence as shown in SEQ ID NO.1 is mutated to isoleucine; or mutating the threonine at position 64 of the acyltransferase mutant of the amino acid sequence as shown in SEQ ID NO.1 to asparagine, and mutating the aspartic acid at position 10 of the acyltransferase mutant of the amino acid sequence as shown in SEQ ID NO.1 to valine, and mutating the aspartic acid at position 95 of the acyltransferase mutant of the amino acid sequence as shown in SEQ ID NO.1 to isoleucine; Wherein, the AT:H is the ratio of acyltransferase activity to hydrolysis activity.

8. Use of the acyltransferase mutant according to any one of claims 1 to 3, the recombinant cell according to claim 5, or the recombinant enzyme catalyst according to claim 6 in catalyzing the production of N-acetyl-trans-4-hydroxyproline from trans-4-hydroxy-L-proline; Preferably, the application is to add the acyltransferase mutant or the recombinant cell or the recombinant enzyme catalyst to a reaction system containing trans-4-hydroxy-L-proline and an acyl donor to carry out a reaction to prepare N-acetyl-trans-4-hydroxyproline; Preferably, the acyl donor is vinyl acetate; Preferably, the reaction system further contains a phosphate buffer; Preferably, the reaction system further contains a surfactant and / or a metal ion; Preferably, the surfactant is PEG 4000, Triton-X 100, Tween 80, AEO-9 or DMSO; more preferably, the surfactant is AEO-9; Preferably, the metal ion is Na + , Mn 2+ , K + NH + 、Al 3+ , Ca 2+ , Cu 2+ , Fe 2+ or Mg 2+ More preferably, the metal ion is Mn 2+ ; Preferably, the application is to add the acyltransferase mutant or the recombinant cell or the recombinant enzyme catalyst to a mixture containing trans-4-hydroxy-L-proline, vinyl acetate, AEO-9, Mn 2+ The reaction system is reacted to prepare N-acetyl-trans-4-hydroxyproline; Preferably, the final concentration of trans-4-hydroxy-L-proline in the system is 100-350 mM, the final concentration of vinyl acetate in the system is 1-20% v / v, the final concentration of AEO-9 in the system is 0.4-0.8 g / L, and the final concentration of Mn 2+ The final concentration in the system is 0.4-1.0 mM.

9. A method for increasing the yield or conversion rate of N-acetyl-trans-4-hydroxyproline, characterized in that: The method comprises adding the acyltransferase mutant according to any one of claims 1 to 3, the recombinant cell according to claim 5, or the recombinant enzyme catalyst according to claim 6 to a reaction system containing trans-4-hydroxy-L-proline and an acyl donor to carry out a reaction, thereby preparing N-acetyl-trans-4-hydroxyproline.

10. Use of the acyltransferase mutant according to any one of claims 1 to 3, the gene or recombinant vector according to claim 4, the recombinant cell according to claim 5, the recombinant enzyme catalyst according to claim 6, the method according to claim 7, or the method according to claim 8 or 9 in the field of biomaterials, medicine or cosmetics.

Images