Pullulanase mutant and its application

Abstract

The present invention belongs to the field of genetic engineering and enzyme engineering, and specifically relates to a pullulanase mutant and its application. The pullulanase mutant comprises the following amino acid mutations relative to the amino acid position of SEQ ID NO: 1: S388, and at least one selected from D239, N266, I324, N364, N389, D409, N422, and T482, and the pullulanase mutant exhibits higher enzyme activity and / or catalytic performance compared with the parent pullulanase. The pullulanase mutant provided by the present invention can significantly improve the enzyme activity, and some mutants also have better catalytic performance at the same time, so it is significantly better than the parent pullulanase in comprehensive enzymatic performance, which is not only conducive to reducing the enzyme production cost, but also conducive to improving the production efficiency of starch sugar preparation and alcohol fermentation industries.

Description

[0001] Cross-reference information

[0002] This application claims priority to Chinese patent application No. 2023117266552 filed on December 14, 2023, the entire contents of which are incorporated herein by reference. Technical Field

[0003] The invention belongs to the field of genetic engineering and enzyme engineering, and specifically relates to a pullulanase mutant and application thereof. Background Art

[0004] The liquefaction and saccharification of starch raw materials are necessary processes for the preparation of syrup and alcohol fermentation. The glycosidic bonds in starch mainly include α-1,4-glycosidic bonds and α-1,6-glycosidic bonds. Although the latter only accounts for about 6% of the total glycosidic bonds, it makes the starch form a branched structure. Since α-amylase (α-amylase, EC 3.2.1.1), β-amylase (β-amylase, EC 3.2.1.2), and glucoamylase (glucoamylase, EC 3.2.1.3) cannot or can only slowly cut α-1,6-glycosidic bonds, the starch enzymatic hydrolysis cycle is long and the utilization rate is low, which seriously affects the economic benefits. Pullulanase has the ability to efficiently hydrolyze α-1,6-glycosidic bonds. Its application in starch processing can effectively shorten the reaction time, improve the utilization rate of raw materials, and reduce the generation of by-products. It has very important application value.

[0005] Pullulanase, also known as pullulan-6-glucanohydrolase, restrictive dextrinase, α-dextrin-6-glucanohydrolase. Pullulanase can be divided into five categories according to the type of decomposed glycosidic bond and the product. The type I pullulanase is usually referred to in the industry. It can specifically cut the α-1,6-glycosidic bond in pullulan, amylopectin and some branched dextrins, and the final hydrolysis product is maltotriose. Most type I pullulanases are derived from Bacillus, especially Bacillus acidophilus, Bacillus naganoensis and Bacillus deramificans. The enzymatic properties of Bacillus-derived pullulanases, such as the optimal pH and optimal temperature, are very close to those of saccharifying enzymes. They can be well applied to the saccharification process. They are the most important type of commercial pullulanases and occupy the vast majority of the pullulanase market. However, the enzyme production of wild-type strains is not high, and it needs to be overexpressed in a suitable host to have industrial production prospects. Compared with the Escherichia coli expression host commonly used in experimental research, Bacillus subtilis and Bacillus licheniformis have significant advantages in safety and are recognized as hosts for enzyme expression in the food industry. In addition, the catalytic properties and biochemical properties of enzymes can be further improved through in vitro evolution technology of enzyme molecules.

[0006] At present, the pullulanase from Bacillus debranching is studied more. U.S. Patent US 7968691B2 reports that the enzyme degrades with the extension of fermentation time until the activity is completely lost. After the 104 amino acids at its N-terminus are removed, it is found that the truncated enzyme activity is stable and the secretion capacity is improved. Domestic researchers have also studied the stability of Bacillus debranching pullulanase. Chinese patents CN102876650B and CN103571812B have obtained mutants with improved enzyme activity and thermal stability by point mutation of the enzyme, and the thermal stability can be further improved by combining the N-terminal truncation strategy. Chinese patent CN107532155B has obtained a truncated pullulanase with higher efficiency than the parent pullulanase in saccharification application by carrying out an N-terminal truncation experiment on the pullulanase from Bacillus debranching. Compared with the parent enzyme, the main advantage of truncated pullulanase is to improve pH tolerance and thermal stability.

[0007] An important method to improve the stability of pullulanase is N-terminal truncation, while improving enzymatic performance requires more protein engineering. Therefore, there is still a need to further explore potential mutants, which is of great significance for reducing enzyme production costs and improving the production efficiency of starch sugar preparation and alcohol fermentation industries. Summary of the invention

[0008] The present invention first provides a pullulanase mutant. Relative to the amino acid position of SEQ ID NO: 1, the pullulanase mutant comprises the following amino acid mutations: S388, and at least one selected from D239, N266, I324, N364, N389, D409, N422, and T482, and the pullulanase mutant exhibits higher enzyme activity and / or catalytic performance than the parent pullulanase.

[0009] As a preferred embodiment, the pullulanase mutant comprises the following mutations: S388F, and at least one selected from D239N, N266D, I324P, N364G, N389A, D409N, N422T, and T482C.

[0010] As a preferred embodiment, the pullulanase mutant comprises any of the following mutation combinations: D239N / S388F, N266D / S388F, I324P / S388F, N364G / S388F, S388F / N389A, S388F / D409N, S388F / N422T, S388F / T482C, N266D / S388F / N389A, N266D / S388F / N422T, S 388F / N389A / N422T, N266D / S388F / N389A / N422T, N266D / I324P / S388F / N389A / N422T, N266D / N36 4G / S388F / N389A / N422T, N266D / S388F / N389A / D409N / N422T, N266D / S388F / N389A / N422T / T482C.

[0011] As a preferred embodiment, the pullulanase mutant comprises any of the following mutation combinations: N266D / S388F, N266D / S388F / N389A, S388F / N389A / N422T, N266D / S388F / N389A / N422T. The above mutations can bring about simultaneous improvement of enzyme activity and catalytic performance.

[0012] As a preferred embodiment, the pullulanase mutant is an N-terminally truncated pullulanase.

[0013] More preferably, the sequence of the parent pullulanase is shown as SEQ ID NO:1.

[0014] The present invention further provides an isolated nucleic acid encoding the pullulanase mutant described in any of the aforementioned embodiments.

[0015] The present invention further provides a nucleic acid construct, which comprises the isolated nucleic acid described in any of the aforementioned schemes.

[0016] The present invention further provides a recombinant vector comprising the isolated nucleic acid described in any of the aforementioned schemes.

[0017] The present invention further provides a host cell comprising the isolated nucleic acid described in any of the aforementioned schemes.

[0018] The present invention further provides a composition comprising the pullulanase mutant described in any one of the above embodiments and another enzyme.

[0019] As a preferred embodiment, the additional enzyme is one or more selected from amylase, cellulase, hemicellulase, isomerase, lipase, phytase and protease.

[0020] As a preferred embodiment, the amylase is at least one enzyme selected from α-amylase, glucoamylase, and isoamylase.

[0021] As a preferred embodiment, the cellulase is at least one enzyme selected from β-glucosidase, cellobiohydrolase, and endoglucanase.

[0022] The present invention further provides the use of the pullulanase mutant or the composition described in any of the above schemes in any of the following aspects: (1) food processing; (2) feed processing; (3) textile industry; (4) leather processing; (5) paper preparation; (6) auxiliary cleaning.

[0023] The present invention further provides a method for hydrolyzing α-1,6-glycosidic bonds, comprising: using the pullulanase mutant or the composition described in any of the aforementioned schemes.

[0024] The present invention further provides a method for producing glucose, comprising: mixing a starch liquefaction product with the pullulanase mutant or the composition described in any of the aforementioned schemes to produce glucose.

[0025] The pullulanase mutants provided by the present invention can significantly improve the enzyme activity, and some mutants also have better catalytic performance, and thus are significantly better than the parent pullulanase in terms of comprehensive enzymatic performance, which is not only conducive to reducing the enzyme production cost, but also conducive to improving the production efficiency of starch sugar preparation and alcohol fermentation industries. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0027] Figure 1 This is the plasmid map of pUC57-pul104-Cm-amyE in the examples of the present invention. DETAILED DESCRIPTION

[0028] The specific embodiments of the present invention are described in detail below. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention. Those skilled in the art may make various modifications and changes to the present invention without departing from the scope or spirit of the present invention. For example, a feature described or illustrated as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0029] Unless otherwise indicated, the meaning of all terms (including technical and scientific terms) used to disclose the present invention is the same as that commonly understood by those of ordinary skill in the art to which the present invention belongs. By way of further guidance, the following definitions are used to better understand the teachings of the present invention. The terms used herein in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0030] The terms "and / or", "or / and", and "and / or" used in this article include any one of two or more related listed items, and also include any and all combinations of related listed items, and the arbitrary and all combinations include any two related listed items, any more related listed items, or a combination of all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or", "or / and", and "and / or", it should be understood that in this application, the technical solution undoubtedly includes technical solutions that are all connected by "logical and", and undoubtedly includes technical solutions that are all connected by "logical or". For example, "A and / or B" includes three parallel solutions of A, B and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, the technical solution that is all connected by "logical OR"), and also includes any and all combinations of A, B, C, and D, that is, the combination of any two or any three of A, B, C, and D, and also includes the combination of four of A, B, C, and D (that is, the technical solution that is all connected by "logical AND").

[0031] As used herein, the terms "comprising", "including" and "comprising" are synonymous and are inclusive or open-ended and do not exclude additional, unrecited members, elements or method steps.

[0032] Numerical ranges expressed as endpoints herein include all numbers and fractions subsumed within the range, as well as the recited endpoints.

[0033] The present invention relates to concentration values, and its meaning includes fluctuations within a certain range. For example, it can fluctuate within the corresponding accuracy range. For example, 2% can allow fluctuations within the range of ±0.1%. For values ​​that are large or do not require too fine control, its meaning is also allowed to include greater fluctuations. For example, 100mM can allow fluctuations within the range of ±1%, ±2%, ±5%, etc. Involving molecular weight, its meaning is allowed to include fluctuations of ±10%.

[0034] In the present invention, descriptions such as "plurality" and "multiple" refer to quantities greater than or equal to 2 unless otherwise specified.

[0035] In the present invention, the technical features described in an open manner include closed technical solutions composed of the listed features, and also include open technical solutions containing the listed features.

[0036] In the present invention, “preferred”, “better”, “more preferred” and “suitable” are only used to describe implementation methods or examples with better effects. It should be understood that they do not constitute limitations on the scope of protection of the present invention.

[0037] In the present invention, "optionally", "optional", "optionally", "optionally", "optional", "optional", "optional" means optional, that is, it means to be selected from any one of the two parallel schemes of "yes" or "no". If multiple "optional" or "optional" appear in a technical solution, unless otherwise specified and there is no contradiction or mutual restriction, each "optional" or "optional" is independent.

[0038] The "mutation" mentioned in the present invention refers to changing the amino acid at the site to an amino acid different from the natural amino acid. For example, the 388th position is changed to any amino acid except S, and the 266th position is changed to any amino acid except N.

[0039] In the present invention, "the amino acid position relative to..." means that the amino acid position makes an equal contribution to the function of the compared proteins (enzymes). For example, for a reference amino acid sequence (i.e., the amino acid sequence of SEQ ID NO: 1), when the amino acid sequence of the comparison object is arranged in a manner that allows for optimal comparison while taking into account the partial homology of the primary structure (amino acid sequence) (in this case, gaps can be introduced as needed to optimize the alignment), the amino acid at the position corresponding to the specific amino acid in the reference amino acid sequence can be determined as the "corresponding amino acid". Instead of comparing between primary structures, the comparison between stereostructures can be used, or not only the comparison between primary structures but also the comparison between stereostructures can be used to determine the "corresponding amino acid". By using stereostructure information, a highly reliable comparison result can be obtained. In this case, a method can be used to compare while comparing the atomic coordinates of the stereostructures of multiple enzymes. The stereostructure information of the mutant target enzyme can be obtained from a protein database commonly used in the art.

[0040] The following nomenclature is used for amino acid substitutions in the present invention: original amino acid, position, substituted amino acid. As an example, the serine (S) at position S388 is substituted with phenylalanine (F) and represented as S388F. Multiple amino acid substitutions are separated by a comma (""), such as N266D, N389A, and N422T.

[0041] In the present invention, when " / " is used to connect at least two amino acid substitutions, it means that the amino acids before and after the " / " connection occur simultaneously. As an example, when the mutations of N266D and S388F occur simultaneously, it is expressed as N266D / S388F; when the mutations of N266D, S388F and N389A occur simultaneously, it is expressed as N266D / S388F / N389A. Multiple different mutation schemes are separated by ",", such as N266D / S388F, N266D / S388F / N389A, N266D / S388F / N422T.

[0042] The "at least one" mentioned in the present invention includes 1 or more than 2 solutions. In some embodiments, those skilled in the art can select one amino acid site to mutate in "at least one selected from...", or can select multiple (such as 2, 3 or 4, etc.) amino acids to mutate in combination, both of which can enable pullulanase to obtain better performance.

[0043] The term "pullulanase" as used herein refers to an enzyme that can hydrolyze α-1,6 glycosidic bonds in polysaccharides. Pullulanases are also known as debranching enzymes because they can hydrolyze α-1,6 glycosidic bonds in branched polysaccharides such as starch to produce linear polysaccharide, disaccharide or monosaccharide components. For example, pullulanases can degrade starch to produce linear starch polymers, mainly polymers of α-1,4 linked glucose.

[0044] The term "parent pullulanase" used in the present invention refers to natural pullulanase. Natural pullulanase is preferably bacterial pullulanase, including but not limited to pullulans derived from Bacillus subtilis, Klebsiella pneumoniae, thermophilic anaerobic bacteria, thermophilic thermoactinomycetes, acidophilic pullulanase, debranching Bacillus and Bacillus cereus.

[0045] According to a preferred embodiment of the present invention, the natural pullulanase is a pullulanase derived from a Bacillus strain, preferably from a debranching Bacillus, and the N-terminus of the amino acid sequence thereof is truncated by 104 amino acids. The truncated amino acid sequence is shown in SEQ ID NO:1.

[0046] Pullulanase mutant

[0047] The present invention relates to a pullulanase mutant. Relative to the amino acid position of SEQ ID NO: 1, the pullulanase mutant comprises the following amino acid mutations: S388, and at least one selected from D239, N266, I324, N364, N389, D409, N422, and T482, and the pullulanase mutant exhibits higher enzyme activity and / or catalytic performance than a parent pullulanase.

[0048] According to the reported literature, there are many modification targets and combinations of pullulanase molecules. However, the present invention unexpectedly discovered that by mutating the above-mentioned sites, the enzymatic activity of pullulanase can be significantly improved, and some mutations can also improve the catalytic performance of pullulanase, which will further facilitate its application in the hydrolysis of α-1,6-glycosidic bonds.

[0049] In some embodiments, the pullulanase mutant comprises the following mutations: S388F, and at least one selected from D239N, N266D, I324P, N364G, N389A, D409N, N422T, and T482C.

[0050] Those skilled in the art can combine the above-mentioned mutation sites to obtain specific embodiments of the pullulanase mutant of the present invention.

[0051] In some embodiments, the pullulanase mutant comprises any of the following mutation combinations: D239N / S388F, N266D / S388F, I324P / S388F, N364G / S388F, S388F / N389A, S388F / D409N, S388F / N422T, S388F / T482C, N266D / S388F / N389A, N266D / S388F / N422T, S388F / N389A / N422T, N266D / S388F / N389A / N422T, N266D / I324P / S388F / N389A / N422T, N266D / N36 4G / S388F / N389A / N422T, N266D / S388F / N389A / D409N / N422T, N266D / S388F / N389A / N422T / T482C.

[0052] In some preferred embodiments, the pullulanase mutant comprises the following mutations: S388F, and at least one selected from N266D, N389A, and N422T.

[0053] In some more preferred embodiments, the pullulanase mutant comprises any of the following mutation combinations:

[0054] N266D / S388F, N266D / S388F / N389A, S388F / N389A / N422T, N266D / S388F / N389A / N422T.

[0055] The above mutation can simultaneously improve the enzymatic activity and catalytic performance of pullulanase, which further enables the mutant of the present invention to have an application advantage that is significantly superior to other mutants in the prior art (most of which are only improved in a single performance).

[0056] In some embodiments, the pullulanase mutant comprises other conservative mutations in addition to the mutations mentioned in the present invention, so that the pullulanase mutant has up to 5%, 10%, 15% or 20% difference in amino acids from the sequence shown in SEQ ID NO: 1. The "conservative substitution" mentioned herein is also called substitution by "homologous" amino acids, which refers to substitutions in which amino acids are replaced by amino acids with similar side chains, for example, amino acids with basic side chains (such as lysine, arginine and histidine), amino acids with acidic side chains (such as aspartic acid and glutamic acid), non-charged polar side chain amino acids (such as glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), non-polar side chain amino acids (such as alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), β-branched side chain amino acids (such as threonine, valine, isoleucine) and aromatic side chain amino acids (such as tyrosine, phenylalanine, tryptophan, histidine). Conservative amino acid substitutions generally have little effect on the activity of the resulting protein.

[0057] In a preferred embodiment, the pullulanase mutant comprising other conservative mutations still retains the activity of the pullulanase mutant, for example, retains its activity of hydrolyzing α-1,6-glycosidic bonds.

[0058] In some embodiments, the pullulanase mutant is an N-terminally truncated pullulanase. The N-terminus truncation can make the pullulanase have better stability. Those skilled in the art can refer to the schemes disclosed in documents such as US 7968691B2, CN102876650B, CN103571812B, and CN107532155B to confirm the specific scheme of the N-terminus truncation. For example, the N-terminus of the pullulanase mutant is truncated by 104 amino acids.

[0059] When the mutation provided by the present invention is performed on the basis of the N-terminally truncated parent pullulanase (a typical amino acid sequence of which is shown as SEQ ID NO: 1 as an example, and a typical nucleotide sequence is shown as SEQ ID NO: 2), not only higher enzyme activity and catalytic performance can be achieved, but also better stability of the pullulanase mutant can be ensured.

[0060] Preparation of pullulanase mutants

[0061] The present invention also provides a method for preparing the pullulanase mutant described in any of the above schemes, comprising: introducing the mutation into the parent pullulanase; and then recovering the pullulanase mutant.

[0062] Any mutagenesis method known in the art can be used to prepare these variants, such as site-directed mutagenesis, synthetic gene construction, semi-synthetic gene construction, random mutagenesis, shuffling, etc. Those skilled in the art can refer to relevant public documents to confirm the specific operating steps of the above mutagenesis method, which will not be specifically described here.

[0063] The present invention also provides a method for preparing the pullulanase mutant described in any of the above schemes, comprising: culturing a host cell under conditions suitable for the expression of the pullulanase mutant, wherein the host cell contains a nucleic acid encoding the pullulanase mutant; and then recovering the pullulanase mutant.

[0064] These host cells are cultivated in a nutrient medium suitable for producing the variant using methods known in the art. For example, the cell can be cultivated by shaking flasks in a suitable medium and under conditions allowing the variant to express and / or separate, or by carrying out small-scale or large-scale fermentation (including continuous fermentation, batch fermentation, batch-fed fermentation or solid-state fermentation) in a laboratory or industrial fermentor. Cultivation can be carried out in a suitable nutrient medium containing carbon and nitrogen sources and inorganic salts by procedures known in the art. Suitable medium can be obtained from commercial suppliers or can be prepared according to disclosed composition. If the variant is secreted into the nutrient medium, the variant can be directly recovered from the medium. If the variant is not secreted, it can be recovered from cell lysate.

[0065] Isolated nucleic acids

[0066] The present invention further provides an isolated nucleic acid encoding the pullulanase mutant described in any of the aforementioned embodiments.

[0067] The nucleic acid of the present invention can be prepared in an isolated state by using standard genetic engineering methods, molecular biology methods, biochemical methods, etc., with reference to the sequence information disclosed in this specification or the attached sequence listing.

[0068] Nucleic acid construct

[0069] The present invention further provides a nucleic acid construct, which comprises the isolated nucleic acid described in any of the aforementioned schemes.

[0070] In some embodiments, the nucleic acid construct further comprises one or more control sequences for directing the expression of the isolated nucleic acid.

[0071] In some specific embodiments, the control sequence includes one or more of a promoter, an enhancer, a signal peptide, and a terminator. A person skilled in the art can confirm the specific scheme of the control sequence in combination with common sense.

[0072] Recombinant vector

[0073] The present invention further provides a recombinant vector comprising the isolated nucleic acid described in any of the aforementioned schemes.

[0074] The "recombinant vector" of the present invention refers to a nucleic acid molecule capable of transporting a nucleic acid inserted therein to a target. Those skilled in the art can select an appropriate vector according to the purpose of use (cloning, protein expression) and the type of host cell. The vector of the present invention is preferably an expression vector. "Expression vector" refers to a vector capable of introducing a nucleic acid inserted therein into a target cell (host cell) and capable of expressing it in the cell. An expression vector generally comprises a promoter sequence necessary for the expression of the inserted nucleic acid, an enhancer sequence that promotes expression, and the like. In addition, an expression vector comprising a selection marker can also be used. When using the expression vector, the selection marker can be used to confirm the presence (and extent) of the introduction of the expression vector.

[0075] In some specific embodiments, the recombinant vector comprises the isolated nucleic acid, the amyE gene promoter of Bacillus subtilis ATCC6051a strain (sequence as shown in SEQ ID NO:3), the signal peptide of Bacillus licheniformis chitinase gene (sequence as shown in SEQ ID NO:4) and the terminator of Bacillus amyloliquefaciens α-amylase gene (amyQ) (sequence as shown in SEQ ID NO:5). In the recombinant vector, the isolated nucleic acid of the present invention can be well expressed, however, the performance improvement of the pullulanase mutant of the present invention does not depend on the recombinant vector, and the other recombinant vectors mentioned above can also exert the superior performance of the pullulanase mutant of the present invention.

[0076] Host cells

[0077] The present invention further provides a host cell comprising the isolated nucleic acid described in any of the aforementioned schemes.

[0078] In the present invention, "host cell" encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations present during replication. The choice of host cell depends largely on the gene encoding the variant and its source.

[0079] The host cell may be any cell useful in the recombinant production of a variant, eg, a prokaryotic or eukaryotic cell.

[0080] Prokaryotic host cells can be any Gram-positive or Gram-negative bacteria. Gram-positive bacteria include, but are not limited to, Bacillus, Clostridium, Enterococcus, Geobacillus, Lactobacillus, Lactococcus, Oceanobacillus, Staphylococcus, Streptococcus, and Streptomyces. Gram-negative bacteria include, but are not limited to, Campylobacter, Escherichia coli, Flavobacterium, Fusobacterium, Helicobacter, Ilyobacter, Neisseria, Pseudomonas, Salmonella, and Ureaplasma.

[0081] The bacterial host cell can be any Bacillus cell, including but not limited to Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus pumilus, Bacillus stearothermophilus, Bacillus subtilis, and Bacillus thuringiensis cells.

[0082] The bacterial host cell may also be any Streptococcus cell, including but not limited to Streptococcus equisimilis, Streptococcus pyogenes, Streptococcus uberis, and Streptococcus equisubsp. Zooepidemicus cells.

[0083] The bacterial host cell can also be any Streptomyces cell, including but not limited to Streptomyces achromogenes, Streptomyces avermitilis, Streptomyces coelicolor, Streptomyces griseus, and Streptomyces lividans cells.

[0084] The host cell may also be a eukaryotic cell, such as a mammalian cell, an insect cell, a plant cell, or a fungal cell. The fungal cell may be a yeast cell or a filamentous fungal cell.

[0085] In some embodiments, the host cell is a high-yield pullulanase genetic engineering strain disclosed in CN104073458B. In the strain, two exocrine proteases, the gene apr of Bacillus subtilis alkaline protease and the gene npr of Bacillus subtilis neutral metalloproteinase, as well as the spore-forming gene spoIIAC are knocked out, so that pullulanase can be highly produced, and a higher yield can be obtained when the pullulanase mutant of the present invention is expressed by the strain. However, the performance improvement of the pullulanase mutant in the present invention does not depend on the strain, and the pullulanase mutant of the present invention still has superior performance in the other host cells mentioned above.

[0086] Composition

[0087] The present invention further provides a composition comprising the pullulanase mutant described in any one of the above embodiments and another enzyme.

[0088] In some embodiments, the additional enzyme is selected from one or more of amylase, cellulase, hemicellulase, isomerase, lipase, phytase, and protease.

[0089] In some embodiments, the amylase is at least one selected from alpha-amylase, glucoamylase, and pullulanase.

[0090] In some embodiments, the cellulase is at least one enzyme selected from β-glucosidase, cellobiohydrolase, and endoglucanase.

[0091] application

[0092] The present invention further provides the use of the pullulanase mutant or the composition described in any of the above schemes in any of the following aspects: (1) food processing; (2) feed processing; (3) textile industry; (4) leather processing; (5) paper preparation; (6) auxiliary cleaning.

[0093] Based on the superior enzymatic performance of the pullulanase mutant, the mutant or the composition can be used in the above-mentioned fields to obtain better application effects.

[0094] In some embodiments, the pullulanase mutant or the composition can be used to extract pectin and cellulose from plant cell walls and used for the production of food additives such as pectinase and cellulase.

[0095] In some embodiments, the pullulanase mutant or the composition can be used in the bread-making process to degrade starch in the dough, making it easier to ferment and decompose, thereby improving the texture and taste of the bread.

[0096] In some embodiments, the pullulanase mutant or the composition can be used for starch saccharification in the beer brewing process, so that the starch is converted into soluble sugars that can be fermented by yeast, thereby improving the alcohol content and fermentability of the beer.

[0097] In some embodiments, the pullulanase mutant or the composition can be used to help animals better digest starch and cellulose, thereby improving the energy utilization rate and nutritional value of feed.

[0098] In some embodiments, the pullulanase mutant or the composition can be used to treat textiles to help remove starch, pectin and other impurities on the fiber surface and improve the softness and touch of the textiles.

[0099] In some embodiments, the pullulanase mutant or the composition can be used to help remove residual tissue and non-collagen substances in animal leather, making the leather soft and easy to process.

[0100] In some embodiments, the pullulanase mutant or the composition can be used to improve the cellulose structure of plant fibers, so that pulp is easier to process and paper has more strength and flexibility. In the paper making process, pullulanase is mainly used for pre-treating pulp. During the pre-treatment process, pullulanase can partially degrade the fiber network structure of cellulose fibers, open the links between fibers, and make the fibers easier to disperse and separate. This can improve the processability of the fibers and make the pulp easier to carry out papermaking operations. In addition, pullulanase can also help the strength and flexibility of paper. By catalyzing the conversion of substrates and the release of energy, pullulanase can promote the mutual connection and aggregation between fibers, and enhance the bonding force and strength of paper. At the same time, pullulanase can also reduce the affinity between fibers, improve the fluidity and dryness of pulp, and help the smooth progress of the paper making process.

[0101] In some embodiments, the pullulanase mutant or the composition can be used in various cleaning or washing processes, including being added as a component of laundry and dishwashing detergent compositions.

[0102] method

[0103] The present invention further provides a method for hydrolyzing α-1,6-glycosidic bonds, comprising: using the pullulanase mutant or the composition described in any of the aforementioned schemes.

[0104] The present invention further provides a method for producing glucose, comprising: mixing a starch liquefaction product with the pullulanase mutant or the composition described in any of the aforementioned schemes to produce glucose.

[0105] In the present invention, "α-1,6 glycosidic bond" refers to a bond formed between the C6 carbon of a first glucose and the oxygen linked to the anomeric carbon (C1 carbon) of a second glucose, wherein the second glucose is an α anomeric.

[0106] In the present invention, liquefaction is the process of adding starch raw materials (such as corn, potatoes, etc.) to hot water and then treating them with amylase (usually α-amylase). Amylase can degrade the internal connections of starch molecules and decompose starch molecules into shorter starch chains and starch fragments, i.e., the starch liquefaction product described in the present invention. Liquefaction can make starch more fluid at high temperatures, which is convenient for subsequent processing.

[0107] The aforementioned method of producing glucose may also be referred to as saccharification, which refers to the process of adding saccharifying enzyme to the liquefied starch raw material and further processing. Saccharifying enzyme can further degrade the starch chains and starch fragments after liquefaction and convert them into glucose. The process of saccharification is usually carried out at a lower temperature to maintain the activity and efficiency of saccharifying enzyme. This process often requires a period of time to ensure that starch molecules are converted into glucose as completely as possible.

[0108] In some embodiments, the starch liquefaction product can be obtained through commercial routes.

[0109] In some embodiments, the method for producing glucose includes: using amylase (such as α-amylase) to liquefy a starch-containing substrate (such as corn, potato, etc.), and then mixing the starch liquefaction product with the pullulanase mutant or the composition described in any of the above schemes to produce glucose.

[0110] In some specific embodiments, the starch-containing substrate (such as corn, potato, etc.) can be ground before the aforementioned liquefaction step.

[0111] The present invention further provides a method for producing a fermentation product, comprising: 1) obtaining glucose using the method for producing glucose described in any of the aforementioned schemes; 2) fermenting the glucose in the presence of a fermenting organism to produce a fermentation product.

[0112] The present invention further provides a method for producing a fermentation product, comprising: contacting a starch substrate with an amylase, the pullulanase mutant described in any one of the above schemes, and a fermenting organism to produce a fermentation product.

[0113] In some embodiments, the fermentation product is beer. The process of producing beer generally includes grinding, liquefaction, saccharification and fermentation. Optionally, after fermentation, it also includes a step of purifying the product (such as distillation, extraction, etc.).

[0114] Example

[0115] The embodiments of the present invention will be described in detail below in conjunction with examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention.

[0116] The culture medium formula used in the following examples is as follows:

[0117] LB solid medium: 1% Tryptone, 0.5% Yeast extract, 1% NaCl, 1.5% agar.

[0118] Seed medium: maltose syrup 4.0%, peptone 2.0%, yeast extract 0.1%, and KH2P04 0.6%.

[0119] Fermentation medium: maltose syrup 12.0%, peptone 1.0%, yeast extract 1.0%, KH2P04 0.2%, and MnCl2 0.003%.

[0120] For experimental methods in the following examples where specific conditions are not specified, reference is made to the instructions given in the present invention first, and may also be made to experimental manuals or conventional conditions in the art, or to other experimental methods known in the art, or to conditions recommended by manufacturers.

[0121] In the following specific embodiments, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument test accuracy or operation accuracy are allowed.

[0122] Example 1: Construction of pullulanase parent and mutant recombinant plasmids

[0123] The present invention adopts a pullulanase sequence with 104 amino acids truncated at the N-terminus of debranching Bacillus as a parent sequence (hereinafter referred to as pul-104), the amino acid sequence is shown in SEQ ID NO:1, and the nucleotide sequence is shown in SEQ ID NO:2.

[0124] The amyE gene promoter of Bacillus subtilis ATCC6051a strain (as shown in SEQ ID NO:3) is used to express the pul-104 gene and its mutants, the signal peptide is selected from the signal peptide of the chitinase gene of Bacillus licheniformis (as shown in SEQ ID NO:4), and the terminator is selected from the terminator sequence of the α-amylase gene (amyQ) of Bacillus amyloliquefaciens (as shown in SEQ ID NO:5). The DNA fragment containing the chitinase signal peptide and the amyQ terminator of the pul-104 gene is produced by gene synthesis of Genscript Company.

[0125] The pul-104 Bacillus subtilis integration plasmid pUC57-pul104-Cm-amyE was generated by the following method:

[0126] The pUC57-BsaI-free plasmid (obtained by destroying the BsaI restriction site in the pUC57 plasmid by point mutation) was used as the backbone for construction. The pUC57-BsaI-free plasmid was linearized with BamHI-HindIII, and the 2674 bp fragment was recovered by gel. The genomic DNA of Bacillus subtilis ATCC6051a strain was used as a template, and the amyE upstream homology arm (abbreviated as amyE-5'BsaI) was amplified with primers amyE-5'-F and amyE-5'BsaI-R. The PCR product size was 670 bp. AmyE-3'BsaI-F and amyE-3'-R are primers for amplifying the homology arm downstream of the amyE site (abbreviated as amyE-3'BsaI), and the PCR product size is 681 bp. The above three fragments of 2674 bp, 670 bp and 681 bp are recombined with CloneZ recombinase (produced by Genscript Company), and the resulting plasmid is named pUC57-BsaI-free-amyE. This plasmid has two BsaI sites inserted between the amyE-5' and amyE-3' fragments for subsequent plasmid construction. The primer sequences are shown in Table 1.

[0127] The pUC57-BsaI-free-amyE plasmid was linearized with BsaI to obtain a 3876 bp fragment. The pul-104 gene synthesis plasmid was used as a template and pul104-F and pul104-R were used as primers to amplify a fragment containing the pul signal peptide, pul-104 gene and amyQ terminator. The PCR product size was 2643 bp. The genomic DNA of Bacillus licheniformis ATCC14580 was used as a template and Cm-F and Cm-R were used as primers to amplify the chloramphenicol resistance gene expression cassette. The PCR product size was 1300 bp. The above three fragments of 3876 bp, 2643 bp and 1300 bp were recombined with CloneZ recombinase (produced by Genscript). The resulting integrated plasmid was called pUC57-pul104-Cm-amyE. The primer sequences are shown in Table 1. The amyE promoter is contained at the end of the amyE-5' fragment and is directly connected to the chitinase signal peptide. The plasmid schematic diagram is shown in Figure 1 , sequence see SEQ ID NO.6.

[0128] Table 1 Primer names and sequences

[0129] Primer name Primer sequence (5'→3') amyE-3'BsaI-F gagtgtcaagatgagaccagtctcggaagctcaaaggtctcAagcgcccaagtgcccggtcag(SEQ ID NO.7) amyE-5'BsaI-R gcgctTgagacctttgagcttccgagactggtctcatcttgacactccttatttgattttttg(SEQ ID NO.8) amyE-3'-F agcaactttttttgcgcttaaaaccagtcataccaataaagcgcccaagtgcccggtcag(SEQ ID NO.9) amyE-3'-R cacacaggaaacagctatgaccatgattacgccaagcttcttcactaacgatgcctttgaaaatc(SEQ ID NO.10) amyE-5'-R aaaaacgaaaaactttttgcttttgttgatcaacattcttgacactccttatttgattttttg(SEQ ID NO.11) amyE-5'-F cggtacctcgcgaatgcatctagatatcggatccgcggcattatgtttgaatttccgttt(SEQ ID NO.12) Cm-F catcaagaggtaagcccagaccacggtaaaaagtaaaacgtcgtgactgggaaaaccctg(SEQ ID NO.13) Cm-R agccaggctgattctgaccgggcacttgggcgctttattggtatgactggttttaagcgc(SEQ ID NO.14) pul104-F gtcttcaaaaaatcaaataaggagtgtcaagaatgttgatcaacaaaagcaaaaagtttttc(SEQ ID NO.15) pul104-R agttgggtaacgccagggttttcccagtcacgacgttttactttttaccgtggtctgggc(SEQ ID NO.16)

[0130] The pullulanase mutant integration plasmid was generated by point mutation based on the pUC57-pul104-Cm-amyE integration plasmid.

[0131] Example 2: Construction of pullulanase parent and mutant recombinant strains

[0132] The method for constructing the experimental host strain A164Δ4 is ​​shown in CN104073458B. The pUC57-pul104-Cm-amyE integration plasmid or its mutant integration plasmid obtained in Example 1 was transformed into A164Δ4 competent cells by conventional Bacillus subtilis chemical transformation method, and cultured at 37°C, 200 rpm for 2 h, and then the bacterial solution was diluted to 10 -2 Then 100ul was spread on LB solid medium containing 5ng / ul chloramphenicol, and after overnight culture at 37°C, a single clone was selected for colony PCR and sequencing verification to obtain a Bacillus subtilis expression strain of pul-104 or its mutants. The specific information of the mutants is shown in Table 2.

[0133] Table 2 Pullulanase variant mutation site information

[0134] Mutation point number Mutation site (numbered by amino acid position of pul-104) Parental control / M001 D239N / S388F M002 N266D / S388F M003 I324P / S388F M004 N364G / S388F M005 S388F / N389A M006 S388F / D409N M007 <h2 style=";text-align:left;direction:ltr">S388F / N422T M008 <h2 style=";text-align:left;direction:ltr"> S388F / T482C M009 <h2 style=";text-align:left;direction:ltr"> N266D / S388F / N389A M010 <h2 style=";text-align:left;direction:ltr"> N266D / S388F / N422T M011 <h2 style=";text-align:left;direction:ltr"> S388F / N389A / N422T M012 <h2 style=";text-align:left;direction:ltr"> N266D / S388F / N389A / N422T M013 <h2 style=";text-align:left;direction:ltr"> N266D / I324P / S388F / N389A / N422T M014 <h2 style=";text-align:left;direction:ltr"> N266D / N364G / S388F / N389A / N422T M015 <h2 style=";text-align:left;direction:ltr"> N266D / S388F / N389A / D409N / N422T M016 <h2 style=";text-align:left;direction:ltr"> N266D / S388F / N389A / N422T / T482C

[0135] Example 3: Shake flask fermentation

[0136] One single clone of Pul-104 and its mutant B. subtilis expression strain was selected and inoculated into 20 ml seed culture medium respectively. Cultured for 16 hours to the logarithmic phase, and then 1.2 ml of culture solution was inoculated into 30 ml fermentation medium respectively. Cultured in a shaker at 200 rpm for 48 hours. Samples (1 ml) were taken at 24 hours and 48 hours respectively, and centrifuged at 10000g for 10 minutes. The supernatant was saved and the pullulanase activity was determined.

[0137] Example 4: Enzyme activity determination and application test of mutants

[0138] Pullulanase activity assay method:

[0139] The supernatant obtained in Example 3 was subjected to activity assay. Pullulanase activity units are expressed as BPU, and the definition of 1 BPU unit is: the amount of enzyme required to produce 360 ​​μg reducing sugar (in terms of glucose) from pullulan in 1 minute at pH 4.3 and 60°C. Briefly, 1 ml of appropriately diluted pullulanase sample was mixed with 1 ml of 0.5% pullulan, incubated at 60°C for 30 minutes, then 3 ml of 3,5-dinitrosalicylic acid (DNS) solution was added and the sample was boiled for 7 minutes. The sample was cooled, and then 10 ml of water was added to mix. The reducing sugar produced was determined by the Somogyi-Nelson method (Somogyi, 1944).

[0140] Unless otherwise stated, the units used in the application tests are defined as follows:

[0141] BGU: The activity measurement unit of glucoamylase (saccharifying enzyme) is expressed in BGU. One BGU is defined as the amount of enzyme required to produce 200 mg of glucose from soluble starch per hour at 40°C and pH 4.6.

[0142] gDS: grams of dry matter

[0143] Application test method: The supernatant samples of the fermentation broth of pul-104 and its mutants were first subjected to the first round of saccharification test with corn maltodextrin solution, which was made of 31% dry matter (DS) and mixed thoroughly. The pH was adjusted to 4.3 using HCl. The reaction was carried out in a 200 ml reaction volume. The amount of glucoamylase solution added was fixed at 0.225 BGU / gDS. The amount of parent control pul-104 sample added was 0.300 BPU / gDS. Since the mutant samples had different specific enzyme activities, they were added in the same enzyme equivalent as the parent control pul-104 according to the enzyme activity ratio. Compared with the parent control pul-104, the higher the specific enzyme activity, the more significantly the amount of enzyme added to the mutant can be reduced. The reaction was sampled at 24, 40 and 48 hours, respectively, and the samples were filtered through a 0.22 μm membrane, heated up to 100 ° C to inactivate the enzyme, and used for HPLC analysis.

[0144] The enzyme activity and application test results of pul-104 and its mutants are shown in Table 3 below.

[0145] Table 3 Specific enzyme activity and application test results of pul-104 and its mutants

[0146]

[0147] From the results in Table 3, it can be seen that compared with the parental control, although the 8 two-amino acid mutants have a certain improvement in specific enzyme activity, the saccharification application performance is quite different, and only the saccharification application performance of the N266D / S388F mutant is improved. In comparison, the three-amino acid mutant and the four-amino acid mutant have better comprehensive performance, among which the four-amino acid mutant N266D / S388F / N389A / N422T has the best comprehensive performance (specific enzyme activity 142.98%, 48h glucose production 96.46%). The saccharification application performance of five or more amino acid mutants generally decreased, which may be caused by the instability of the enzymatic properties of these mutants under saccharification reaction conditions.

[0148] In summary, the pullulanase mutants obtained by directed evolution in the present invention have the characteristics of improving specific enzyme activity and / or improving saccharification application performance, and some pullulanase mutants have both better specific enzyme activity and saccharification application performance. These mutants have great application potential in the industrial application field of pullulanase.

[0149] The above-mentioned embodiments only express several implementation methods of the present invention, and the description is relatively specific and detailed, but it cannot be understood as limiting the scope of the invention patent. It should be pointed out that for ordinary technicians in this field, several modifications and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention.

Claims

1. A pullulanase mutant, comprising the following amino acid mutations relative to the amino acid position of SEQ ID NO: 1: S388, and at least one selected from D239, N266, I324, N364, N389, D409, N422, and T482, and the pullulanase mutant exhibits higher enzyme activity and / or catalytic performance than the parent pullulanase.

2. The pullulanase mutant according to claim 1, comprising the following mutations: S388F, and at least one selected from D239N, N266D, I324P, N364G, N389A, D409N, N422T, and T482C.

3. The pullulanase mutant according to claim 2, comprising any one of the following mutation combinations: D239N / S388F, N266D / S388F, I324P / S388F, N364G / S388F, S388F / N389A, S388F / D409N, S388F / N422T, S388F / T482C, N266D / S388F / N389A, N266D / S388F / N422T, S388F / N389A / N422T, N266D / S388F / N389A / N422T, N266D / I324P / S388F / N389A / N422T, N266D / N364G / S388F / N389A / N422T, N266D / S388F / N389A / D409N / N422T, N266D / S388F / N389A / N422T / T482C.

4. The pullulanase mutant according to claim 3, wherein the pullulanase mutant comprises any one of the following mutation combinations: N266D / S388F, N266D / S388F / N389A, S388F / N389A / N422T, N266D / S388F / N389A / N422T.

5. The pullulanase mutant according to claim 1, wherein The pullulanase mutant is a pullulanase with N-terminal truncations; preferably, the sequence of the parent pullulanase is shown in SEQ ID NO:

1.

6. An isolated nucleic acid encoding the pullulanase mutant according to any one of claims 1 to 5.

7. A nucleic acid construct comprising the isolated nucleic acid of claim 6. A recombinant vector comprising the isolated nucleic acid of claim 6 .

9. A host cell comprising the isolated nucleic acid of claim 6.

10. A composition comprising the pullulanase mutant according to any one of claims 1 to 5 and another enzyme.

11. The composition according to claim 10, wherein The additional enzyme is selected from one or more of amylase, cellulase, hemicellulase, isomerase, lipase, phytase, and protease; preferably, the amylase is selected from at least one of α-amylase, glucoamylase, and isoamylase; preferably, the cellulase is selected from at least one of β-glucosidase, cellobiohydrolase, and endoglucanase.

12. Use of the pullulanase mutant according to any one of claims 1 to 5 or the composition according to claim 10 or 11 in any of the following aspects: (1) food processing; (2) feed processing; (3) textile industry; (4) leather processing; (5) paper preparation; (6) auxiliary cleaning. 13 . A method for hydrolyzing α-1,6-glycosidic bonds, comprising: using the pullulanase mutant according to any one of claims 1 to 5 or the composition according to claim 10 or 11.

14. A method for producing glucose, comprising: The starch liquefaction product is mixed with the pullulanase mutant according to any one of claims 1 to 5 or the composition according to claim 10 or 11 to produce glucose.

Images