Genetically engineered bacterium for producing resuscitation promoting factor Rpf and application of genetically engineered bacterium

Abstract

The invention relates to a genetically engineered bacterium for producing a resuscitation promoting factor Rpf and application of the genetically engineered bacterium, and belongs to the technical field of bioengineering. The genetically engineered bacterium is a prokaryotic cell, and the nucleotide sequence of the resuscitation promoting factor Rpf is as shown in SEQ. ID. NO.1. The genetically engineered bacterium is preserved in China Center for Type Culture Collection. The Rpf recombinant protein prepared from the genetically engineered bacterium constructed by the invention is in soluble expression, and a good research foundation is laid for subsequent detection of VBNC state pathogenic bacteria. After the recombinant protein is purified through affinity chromatography, the purity of the Rpf recombinant protein can reach 93% and is far higher than the extraction purity in the prior art.

Description

Technical Field

[0001] The invention relates to a genetic engineering bacterium for producing a recovery promoting factor Rpf and application thereof, belonging to the technical field of bioengineering. Background Art

[0002] Resuscitation Promoting Factor (Rpf) is a type of protein that is secreted or paracrine by bacteria and can promote the resuscitation and growth of dormant bacteria. This factor was first discovered in Micrococcus luteus. In addition to promoting the resuscitation and growth of dormant bacteria, it is also effective for normally growing bacteria. Its mechanism may be involved in intercellular signal transduction. The domain prediction and nuclear magnetic resonance analysis of the protein showed that it has a highly conserved domain composed of about 70 amino acid residues, which is important for promoting growth, namely the Rpf-like domain. Later, proteins with similar functions to this protein and also with Rpf-like domains were discovered in other Gram-positive bacteria, forming the Rpf protein family.

[0003] Chinese invention patent CN109402032B discloses a genetically engineered bacterium for producing a recovery-promoting factor RpfE and its application. The rpfE gene is amplified by PCR using the genomic DNA of Rhodococcus biphenylophilus TG9 as a template; the PCR product is connected with the expression vector pEASY-Blunt E1 to construct a recombinant plasmid pEASY-Blunt-rpfE, and then the recombinant plasmid is transferred into Escherichia coli to obtain a genetically engineered bacterium. The purity and enzyme activity of the recombinant protein extracted from the genetically engineered bacterium constructed by this method are both low. Summary of the invention

[0004] The invention provides a genetic engineering bacterium for producing a recovery promoting factor Rpf and application thereof.

[0005] The technical solution adopted by the present invention is as follows.

[0006] A genetically engineered bacterium for producing a resuscitation promoting factor Rpf. The genetically engineered bacterium is a prokaryotic cell. The nucleotide sequence of the resuscitation promoting factor Rpf is shown in SEQ.ID.NO.1.

[0007] Furthermore, the genetically engineered bacteria is deposited in the China Center for Type Culture Collection, the preservation address is Wuhan, China, the preservation date is November 28, 2024, the preservation number is CCTCC NO:M 20242652, and the classification name is Escherichia coli pET32a-Rpf-BL21(DE3) Escherichia colipET32a-Rpf-BL21(DE3).

[0008] The application of the above genetically engineered bacteria in the preparation of Rpf recombinant protein.

[0009] The steps include: Step S1: cloning of the recovery promoting factor Rpf gene and construction of genetically engineered bacteria; Step S2: Expression and purification of the recovery-promoting factor Rpf gene engineering bacteria; Step S3: taking the supernatant in step S2 and performing SDS-PAGE electrophoresis analysis; Step S4: large-scale induction of the expression strain and purification of the recombinant protein Rpf; Step S5: Detect the enzyme activity of the Rpf recombinant protein.

[0010] Furthermore, the enzyme activity detection method in step S5 is as follows: Step S51: preparation of 4-MUF-3-NAG storage solution and working solution; Step S52: Determination of the concentration of Rpf recombinant protein; Step S53: adding sample; Step S54: Detection of absorbance value.

[0011] Furthermore, the enzyme activity in step S5 is detected using EnzChek™ lysozyme detection kit.

[0012] Compared with the prior art, the technical effects of the present invention are as follows: 1. The present invention constructs a genetically engineered bacterium by mutating the amino acid sequence of Micrococcus luteus Rpf, and then prepares Rpf recombinant protein. The prepared Rpf recombinant protein is expressed in a soluble form, which lays a good research foundation for the subsequent detection of microorganisms such as VBNC state Enteritidis Salmonella, VBNC state Escherichia coli, VBNC state Staphylococcus aureus, VBNC Shigella and VBNC state Listeria. After the recombinant protein is purified by affinity chromatography, the purity of the Rpf recombinant protein can reach 93%, which is much higher than the purity of the protein extracted by the prior art.

[0013] 2. The activity of the Rpf recombinant protease prepared by the genetically engineered bacteria constructed in the present invention is significantly higher than that of the unmutated Rpf protease. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 The sequence characteristics and mutation design of Rpf protein of Micrococcus luteus; green represents the key amino acids for the binding of recombinant protein Rpf to substrate; red represents the mutated amino acids; signal peptide is aa1-41, signal peptide; Rpf is aa46-aa112, Rpf protease active region; LysM is aa176-aa221, LysM domain; Figure 2 Verification of the induced expression of Rpf recombinant protein (I); 1 is E. coli BL21 (DE3); 2 is the whole bacterial lysis protein of pET24a-Trx-6his-RpfI212A-BL21 (DE3); 3 is the lysis supernatant of pET24a-Trx-6his-RpfI212A-BL21 (DE3); 4 is the lysis precipitate of pET24a-Trx-6his-Rpf I212A-BL21 (DE3); M is the protein molecular weight marker; Figure 3 This is the verification of the induced expression of the Rpf recombinant protein (II); M is the protein molecular weight marker; 1 is the purified Rpf recombinant protein; Figure 4 The standard curve between absorbance value and enzyme activity. DETAILED DESCRIPTION

[0015] The principles and features of the present invention are described below in conjunction with the accompanying drawings. The examples given are only used to explain the present invention and are not used to limit the scope of the present invention.

[0016] Example: Cloning of the recovery-promoting factor gene and construction, expression and purification of genetically engineered bacteria Step S1: Cloning of the recovery-promoting factor gene and construction of genetically engineered bacteria Based on the amino acid sequence of Micrococcus luteus Rpf (Z96935.2), homology modeling was performed using SWISS-MODEL and named "Ml-Rpf Model". Discovery Studio was then used to model the Micrococcus luteus Rpf protein molecule as the receptor molecule, peptidoglycan as the ligand, and the homologous sequence region of Micrococcus luteus Rpf and LysM as the peptidoglycan interaction region, and CDOCKER was selected for molecular docking. Peptidoglycan binds to the surface of Rpf LysM to form a complex structure, and peptidoglycan N-acetylglucosamine binds to the surface of LysM through hydrophobic forces with Val214 and Trp183 respectively.

[0017] Discovery Studio was used to perform virtual single-point amino acid mutations on the complex configuration after docking, and the amino acid ILE212 that affects the binding affinity between the enzyme and the substrate was analyzed. The results are shown in Table 1. The results show that the mutation of ILE212 to ALA may lead to an increase in affinity. ILE212 is located inside LysM, and this region is not directly involved in substrate catalysis, but LysM has the ability to promote the binding of peptidoglycan as a substrate to the active center of the Rpf enzyme of Micrococcus luteus, see Figure 1 Therefore, the mutation strategy of this position was adopted.

[0018] Table 1 Analysis of virtual single-point amino acid mutations

[0019] According to the analysis results, the amino acid sequence of Micrococcus luteus Rpf (Z96935.2) ILE212 was mutated to ALA and named "Rpf". The mutated DNA sequence of Micrococcus luteus Rpf was sent to Sangon Biotech (Shanghai) Co., Ltd. for synthesis, and a recombinant plasmid was constructed and named "pET32a-RpfI212A". pET32a-RpfI212A was transformed into Escherichiacoli pET32a-Rpf-BL21 (DE3), spread on LB agar medium plates containing 100 μg / ml ampicillin, and cultured at 37°C for 12 to 16 hours.

[0020] The original sequence (Z96935.2:920-1591) was optimized for codon bias according to Escherichia coli BL21 (DE3). The original sequence and the optimized nucleotide sequence (SEQ.ID.NO.1) are as follows.

[0021] Original sequence: ATGGACACCATGACTCTCTTCACCACTTCCGCCACCCGCTCCCGCCGTGCCACCGCCTCGATCGTCGCGGGCATGACCCTCGCCGGCGCCGCCGCCGTGGGCTTCTCCGCCCCGGCCCAGGCCGCCACCGTGGACACCTGGGACCGCCTCGCCGAGTGCGAGTCCAACGGCACCTGGGACATCAACACCGGCAACGGCTTCTACGGCGGCGTGCAGTTCACCCTGTCCTCCTGGCAGGCCGTCGGCGGCGAAGGCTACCCGCACCAGGCCTCGAAGGCCGAGCAGATCAAGCGCGCCGAGATCCTCCAGGACCTGCAGGGCTGGGGCGCGTGGCCGCTGTGCTCGCAGAAGCTGGGCCTGACCCAGGCTGACGCGGACGCCGGTGACGTGGACGCCACCGAGGCCGCCCCGGTCGCCGTGGAGCGCACGGCCACCGTGCAGCGCCAGTCCGCCGCGGACGAGGCTGCCGCCGAGCAGGCCGCTGCCGCGGAGCAGGCCGTCGTCGCCGAGGCCGAGACCATCGTCGTCAAGTCCGGTGACTCCCTCTGGACGCTCGCCAACGAGTACGAGGTGGAGGGTGGCTGGACCGCCCTCTACGAGGCCAACAAGGGCGCCGTCTCCGACGCCGCCGTGGCCTACGTCGGCCAGGAGCTCGTCCTGCCGCAGGCCTGA。

[0022] The optimized nucleotide sequence (SEQ.ID.NO.1) is as follows: .

[0023] Step S2: Expression and purification of the recovery-promoting factor Rpf gene engineering bacteria Step S21: Inoculation and overnight culture Take the colonies grown on the plate, inoculate them into LB medium containing 100 μg / ml ampicillin, and culture them overnight (14 to 16 hours) at 37°C and 180 r / min with shaking.

[0024] Step S22: Expanding the culture Take fresh bacterial liquid and inoculate it into LB medium containing 100 μg / ml ampicillin at a ratio of 1:50 (V / V), and culture it at 37°C and 180 r / min with shaking for 2 hours until the OD600 value is 0.4-0.6.

[0025] Step S23: Induce expression Add IPTG inducer to a final concentration of 1 mmol / L and incubate at 37 °C and 180 r / min. The shaking culture was continued for 6 hours.

[0026] Step S24: Collecting bacteria Take 2 mL of the induced bacterial solution and centrifuge it at 8000 r / min for 2 minutes, discard the supernatant, and collect the bacterial precipitate. As the whole bacterial protein sample of induced bacteria.

[0027] Step S25: Ultrasonic lysis Take another 2 mL of the induced bacterial solution and centrifuge it at 8000 r / min for 2 minutes, discard the supernatant, and wash it with 2 mL of 500 After resuspending in 10 mmol NaCl and 10 mmol Tris buffer (pH=8.0), place in an ice bath and lyse with an ultrasonic disruptor at a power of 150 W, ultrasonic for 5 seconds, pause for 5 seconds, and the effective time is 3 minutes.

[0028] Step S26: Separation of supernatant and precipitate The ultrasonic lysis product was centrifuged at 12000 r / min for 15 minutes, and the supernatant was taken as the ultrasonic lysis supernatant sample. The precipitate was resuspended in 0.2 mL of 500 mM NaCl, 10 mmol pH=8.0 Tris buffer as the ultrasonic lysis sample.

[0029] Step S3: Take the supernatant and perform SDS-PAGE electrophoresis analysis The sample in step S26 was mixed evenly with 5× SDS protein loading buffer at a ratio of 1:4 (V / V), incubated in a boiling water bath for 10 minutes, and centrifuged at 8000 r / min for 1 minute. The supernatant was analyzed by SDS-PAGE electrophoresis. At the same time, a control of E. coli BL21 (DE3) was set up (see Figure 2 ); Step S4: large-scale induction of expression strains and purification of Rpf recombinant protein; Induce the expression strain in large quantities: take fresh bacterial liquid and inoculate it into 500mL LB medium containing 100μg / ml ampicillin at a ratio of 1:50 (V / V), and shake and culture it at 37℃ and 180 r / min for 2 hours until the OD600 value is 0.4-0.6, then add IPTG inducer to make its final concentration 1 mmol / L, and continue to shake and culture it at 37℃ and 180 r / min for 6 hours.

[0030] The induced product was centrifuged at 8000 r / min for 10 minutes to collect the bacterial precipitate; the bacterial precipitate was washed three times with 500 mM NaCl, 10 mmol pH=8.0 Tris buffer, and then resuspended with 500 mM NaCl, 10 mmol pH=8.0 Tris buffer equivalent to 1 / 10 of the original culture volume, and ultrasonically lysed in an ice bath.

[0031] The ultrasonic lysis product was then centrifuged at 12000 r / min for 15 minutes, the supernatant was taken, filtered with a 0.22 μm filter, and then purified using an AKTA protein purification system and a HisTrap FF Crude chromatography column to prepare the Rpf recombinant protein; the Rpf recombinant protein obtained after purification was subjected to SDS-PAGE electrophoresis to analyze the purity of the protein sample.

[0032] Step S5: Detect the enzyme activity of the Rpf recombinant protein.

[0033] Step S51: Preparation of 4-MUF-3-NAG storage solution and working solution Dissolve 4-MUF-3-NAG in a mixture of pyridine and water (1:1) to a concentration of 5 mg / mL, which is the 4-MUF-3-NAG stock solution. When used, dilute the 4-MUF-3-NAG stock solution with a 50 mmol / L sodium citrate aqueous solution (50 mmol / L sodium citrate, 5 mmol / L MgSO4, pH 6.0) to a final concentration of 8 μmol / L, which is the 4-MUF-3-NAG working solution. Step S52: Determination of the concentration of Rpf recombinant protein The concentration of Rpf recombinant protein was detected using the BCA protein concentration detection kit; Step S53: Add sample Dilute the Rpf recombinant protein sample to be tested to 20 μg / mL with Tris-phosphate buffer at pH 6.0, take a 96-well enzyme-linked reaction plate, add the Rpf recombinant protein sample to be tested, 150 μl / well, add 50 μl of 4-MUF-3-NAG working solution to each well, shake gently to mix, and incubate the enzyme-linked reaction plate at 37°C for 3 hours; Step S54: Detection of absorbance value The absorbance value was detected by fluorescence microplate reader, the excitation light was set to 360nm, the detection wavelength of absorbance value was set to 455nm, 4-methylumbelliferone was dissolved in methanol, and 0nM / mL, 12.5nM / mL, 25nM / mL, 50nM / mL, 100nM / mL, 200nM / mL and 400nM / mL were taken as standard solutions, and the standard curve between absorbance value and enzyme activity was established after parallel detection. The enzyme activity unit was calculated according to the obtained equation, and the enzyme activity unit was defined as 1.0 nM 4-methylumbelliferone produced per milligram of protein sample per hour, that is, 1 enzyme activity unit (1U). It can be seen from Table 2 that the enzyme activity of Rpf recombinant protein is 317, which is significantly higher than the enzyme activity of Rpf protein.

[0034] Table 2 Enzyme activity detection

[0035] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A genetically engineered bacterium for producing a recovery-promoting factor Rpf, characterized in that: The genetically engineered bacteria is a prokaryotic cell, and the nucleotide sequence of the genetically engineered bacteria is shown in SEQ.ID.NO.

1.

2. The genetically engineered bacteria for producing the recovery-promoting factor Rpf according to claim 1, characterized in that: The genetically engineered bacteria is deposited in the China Center for Type Culture Collection, the storage address is Wuhan, China, the storage date is November 28, 2024, the storage number is CCTCC NO: M 20242652, and the classification name is Escherichia coli pET32a-Rpf-BL21 (DE3) Escherichia colipET32a-Rpf-BL21 (DE3).

3. Use of the genetically engineered bacteria producing the recovery-promoting factor Rpf according to claim 1 or 2 in preparing Rpf recombinant protein.

4. The use according to claim 3, characterized in that: The steps include: Step S1: cloning of the recovery promoting factor Rpf gene and construction of genetically engineered bacteria; Step S2: Expression and purification of the recovery-promoting factor Rpf gene engineering bacteria; Step S3: taking the supernatant in step S2 and performing SDS-PAGE electrophoresis analysis; Step S4: large-scale induction of expression strains and purification of Rpf recombinant protein; Step S5: Detect the enzyme activity of the Rpf recombinant protein.

5. The use according to claim 4, characterized in that: The enzyme activity detection method in step S5 is as follows: Step S51: preparation of 4-MUF-3-NAG storage solution and working solution; Step S52: Determination of the concentration of Rpf recombinant protein; Step S53: adding sample; Step S54: Detection of absorbance value.

6. The use according to claim 5, characterized in that: The enzyme activity in step S5 is detected using the EnzChek™ lysozyme detection kit.

Images