DNA library building method based on MGI platform and application thereof

Abstract

The invention provides a DNA library building method based on an MGI platform and application of the DNA library building method. The DNA library building method comprises the following steps: connecting a bubble-shaped joint with a target sample to obtain a connection product; carrying out library construction on the connection product by adopting an amplification primer pair to obtain an MGI platform-based amplification library with double-end library tags; wherein the amplification primer pair is provided with double-end library tags, and the double-end library tags comprise a library tag at the 5'end and a library tag at the 3 'end; the 5'end library tag is selected from any one group of tags corresponding to phosphorylated ends with balanced four basic groups in a table 1 or a table 2, and the 3 'end library tag group is selected from tags corresponding to fixedly matched non-phosphorylated ends corresponding to the 5' end library tag group in the table 1 or the table 2. According to the method, the problem that the quality of the labels at the two ends of the MGI platform is poor when a large number of samples are loaded on a machine at the same time in the prior art is solved, development and improvement of the MGI sequencing platform are facilitated, and high economic value is achieved.

Description

Technical Field

[0001] The present invention relates to the field of DNA library construction, and in particular to a DNA library construction method based on an MGI platform and an application thereof. Background Art

[0002] With the vigorous development of high-throughput sequencing technology, high-throughput sequencers have also ushered in a new wave of development. At present, the sequencers on the market are mainly divided into Illumina sequencers, MGI sequencers and other brands of sequencers, among which Illumina sequencers and MGI sequencers account for more than half of the sequencing market. In recent years, affected by various factors, the domestic market share of MGI sequencers has seen a substantial increase, and the new market share of this sequencer is equal to or even far exceeds that of Illumina sequencers. The widespread application and development of MGI sequencers has injected sufficient impetus into the research related to MGI platform sequencing.

[0003] The design and use of sequencing adapters are essential parts of the sequencing process. Currently, the MGI sequencing platform mainly uses the software App-A to convert the Y-type adapters used in the library construction scheme of the Illumina platform into a bubble-shaped adapter structure suitable for the MGI sequencing platform. The development and use of adapters on the MGI sequencing platform lack independence and are always restricted by the Illumina platform, which is not conducive to the development of the MGI sequencing platform.

[0004] Although, in recent years, the MGI platform has made new explorations and innovations in sequencing adapters, there are still some problems. For example, in patent CN111910258B, Nanoda optimized the 4-group balance solution of MGI's double-ended unique tags, solved the problem that the MGI platform uses single-end tags to mark the library and easily causes sample crosstalk, and developed a corresponding MGI sequencing tag product, namely the MGISEQ double-end Index solution (for MGI). With the testing and application of this product in the market, the inventors found that when the base balance is a single base ≥ 12.5% ​​(MGI platform sequencing requires a single base in the base balance of not less than 12.5%), the label of this product can be well applied. However, if a large number of samples (for example, 384 samples) are loaded on the machine at the same time, the data output of the label primer combination of some samples in patent CN111910258B is not ideal. In the process of actual application, base imbalance will lead to a decrease in the quality of sequencing data and a waste of sequencing costs.

[0005] Therefore, based on the above background, it is crucial to develop a label adapter for the MGI platform that can handle a large number of samples simultaneously. Summary of the invention

[0006] The main purpose of the present invention is to provide a DNA library construction method based on the MGI platform and its application, so as to solve the problem of unsatisfactory data output when a large number of samples are loaded onto the MGI platform in the prior art.

[0007] In order to achieve the above object, according to one aspect of the present invention, a method for constructing a DNA library based on the MGI platform is provided, and the above construction method comprises:

[0008] connecting the bubble-shaped joint to the target sample to obtain a connection product;

[0009] The ligation products were subjected to library construction using amplification primer pairs to obtain an amplified library with double-end library tags based on the MGI platform;

[0010] Wherein, the above-mentioned amplification primer pair has a double-end library tag, including a library tag at the 5' end and a library tag at the 3' end;

[0011] The 5'-end library tag is selected from any group of tags corresponding to the phosphorylated end of the 4-base balance in Table 1 or Table 2, and the above-mentioned 3'-end library tag group is selected from the tags corresponding to the fixed-matched non-phosphorylated end corresponding to the above-mentioned 5'-end library tag group in Table 1 or Table 2;

[0012] The above 4-base balance refers to the balance of the tag sequence in groups of 4. The tag sequence in groups of 4 has one each of the bases A, T, G and C at positions 1 to 10 of the tag;

[0013] The bubble linker comprises a first linker sequence and a second linker sequence, the first linker sequence is SEQ ID NO: 769, and the second linker sequence is SEQ ID NO: 770;

[0014] Each of the above-mentioned amplification primer pairs further includes a 5'-end universal amplification sequence and a 3'-end universal amplification sequence, wherein the 5'-end universal amplification sequence includes a universal sequence located upstream of the library tag at the 5'-end and a universal sequence located downstream of the library tag at the 5'-end, and the 3'-end universal amplification sequence includes a universal sequence located upstream of the library tag at the 3'-end and a universal sequence located downstream of the library tag at the 3'-end;

[0015] Wherein, the universal sequence located upstream of the library tag at the 5' end is SEQ ID NO: 773, and the universal sequence located downstream of the library tag at the 5' end is SEQ ID NO: 774; the universal sequence located upstream of the library tag at the 3' end is SEQ ID NO: 775, and the universal sequence located downstream of the library tag at the 3' end is SEQ ID NO: 771, and is used in conjunction with the first linker sequence shown in SEQ ID NO: 769 and the second linker sequence shown in SEQ ID NO: 770;

[0016] Table 1

[0017]

[0018]

[0019]

[0020]

[0021]

[0022]

[0023]

[0024]

[0025]

[0026]

[0027] Notes: 1. The bold fonts in the "Tags corresponding to the phosphorylated end" and "Tags corresponding to the non-phosphorylated end" columns in the table are tags marked as excellent tags; the normal fonts are tags marked as normal tags; the underlined parts are tags marked as unqualified tags. 2. The bold fonts in the "Balanced combination" column in the table are 4-base balanced combinations marked as excellent groups; the normal fonts are 4-base balanced combinations marked as normal groups; the underlined parts are 4-base balanced combinations marked as unqualified groups.

[0028] Table 2

[0029]

[0030]

[0031]

[0032]

[0033]

[0034]

[0035]

[0036]

[0037]

[0038]

[0039] Notes: 1. The bold fonts in the "Tags corresponding to the phosphorylated end" and "Tags corresponding to the non-phosphorylated end" columns in the table are tags marked as excellent tags; the normal fonts are tags marked as normal tags; the underlined parts are tags marked as unqualified tags. 2. The bold fonts in the "Balanced combination" column in the table are 4-base balanced combinations marked as excellent groups; the normal fonts are 4-base balanced combinations marked as normal groups; the underlined parts are 4-base balanced combinations marked as unqualified groups.

[0040] In order to achieve the above-mentioned object, according to the second aspect of the present invention, a DNA library construction kit is provided, wherein the library construction kit comprises an amplification primer composition, wherein the amplification primer composition comprises a combination of a plurality of amplification primer pairs in the above-mentioned method for constructing a DNA library based on the MGI platform and a bubble connector.

[0041] In order to achieve the above object, according to the third aspect of the present invention, a sequencing library is provided, wherein the sequencing library is a library constructed using the above-mentioned MGI platform-based DNA library construction method or the above-mentioned DNA library construction kit.

[0042] By applying the technical solution of the present invention, the double-ended tags that are stable in both library output and whole genome sequencing data are further screened out from the 96 groups of 4-base balanced double-ended fixed tags provided by CN111910258B (see Table 1 of the present invention) and another group of 96 groups of 4-base balanced double-ended tags (see Table 2 of the present invention).

[0043] The paired-end tags with normalization values ​​of library output and whole genome sequencing data between 0.85 and 1.15 are marked as excellent tags; the paired-end tags with normalization values ​​of library output and / or whole genome sequencing data >1.2 or <0.8 are marked as unqualified tags; other tags are marked as ordinary tags. Because a 4-base balanced group contains a total of 4 pairs of paired-end tags, a 4-base balanced group will obtain a total of 4 tags.

[0044] According to the labeling conditions in the double-ended tags of the 4-base balance, the 4-base balance group is further labeled. If the 4 labels in the 4-base balance group are all excellent labels, the 4-base balance group is an excellent group. If the labels in the 4-base balance group have both excellent labels and ordinary labels or only ordinary labels, the 4-base balance group is marked as an ordinary group. If the labels in the 4-base balance group have unqualified labels, the 4-base balance group is an unqualified group. According to the above screening criteria, the present invention screened out 58 excellent groups, 51 ordinary groups and 83 unqualified groups from the 192 groups of 4-base balanced double-ended fixed labels in Tables 1 and 2. In order to improve the quality of sequencing data, when using the above labels, the excellent group is preferred, the ordinary group is second, and the unqualified group is eliminated.

[0045] The development and application of the present invention provides the MGI platform with more double-ended label adapters, broadens the application scope and field of the MGI sequencing platform, solves the problem in the prior art that the MGI platform is prone to crosstalk when dealing with large quantities of sequencing samples (e.g., 384 samples), and improves the sequencing quality of the MGI platform. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] The accompanying drawings constituting a part of the present invention are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the accompanying drawings:

[0047] Figure 1 The library output and whole genome sequencing data splitting evaluation of 96 sets of 4-base balanced combinations of fixed double-end unique tag combinations of patent CN111910258B (see Table 1 of the present invention) are shown.

[0048] Figure 2 The percentages of excellent groups, ordinary groups and unqualified groups in the 96 groups of 4-base balanced combinations of patent CN111910258B (see Table 1 of the present invention) are shown.

[0049] Figure 3 The library output and whole genome sequencing data splitting evaluation of the second set of 4-base balanced combinations of fixed dual-end unique tag combinations in the present invention (see Table 2 of the present invention) are shown.

[0050] Figure 4 The percentages of the excellent group, the ordinary group and the unqualified group of the second group of 4-base balanced combinations of the fixed double-end unique tag combinations in the present invention (see Table 2 of the present invention) are shown. DETAILED DESCRIPTION

[0051] It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present invention can be combined with each other. The present invention will be described in detail below in conjunction with the embodiments.

[0052] Terminology explanation:

[0053] Fixed 4 balanced label combination evaluation: In the evaluation process of the present invention, the label combination of 10bp upstream and downstream of the 4-base balanced label combination will be fixedly paired for evaluation. Since the library output and whole genome sequencing data splitting need to be evaluated, the 4 sets of label combinations are fixed first, and the upstream and downstream label combinations are fixed. The combination cannot be changed at will, and changes must be re-evaluated.

[0054] Normalization of library output: ultrasonically shear the samples to obtain 200-400bp DNA fragments; use different label adapters to construct different DNA libraries with equal amounts of DNA, except for the different labels, all other conditions are the same; the value obtained by dividing the library output of a single DNA library by the average value of all DNA libraries is the normalization value of the library, and the closer the value is to 1, the better.

[0055] Whole genome sequencing data splitting and normalization: Use different labels to build libraries for the same sample to obtain DNA libraries with different labels. The above library construction process is the same except for the different labels. The different libraries constructed with different labels are mixed with equal quality and sent for testing. Generally, 0.2-0.5G data is arranged for each label. The value obtained by dividing the data produced by sequencing each library by the average value of the data produced by sequencing all libraries is the whole genome sequencing data splitting and normalization value. The closer the value is to 1, the better.

[0056] Since the launch of the MGI sequencer, the number of newly installed sequencers in the domestic market has exceeded that of the Illumina sequencer for the first time. Although MGI has won the favor of the market in the domestic market due to its domestic production and price, the platform mainly uses Illumina sequencing adapters converted by App-A for installation. From the perspective of customer application, Nanoda has optimized the 4-group balanced solution of MGI's double-end unique tags, see patent CN111910258B. With the application and testing of the MGISEQ double-end Index solution (forMGI) developed using the CN111910258B patent in the market, it was found that the tag sequence can obtain good sequencing quality under the condition of meeting the minimum base balance required by MGI, that is, the single base is greater than or equal to 12.5%. Since the MGI machine has stricter requirements for base balance than the Illumina machine, the main problem solved by CN111910258B is that the combination of adapter tags with 4 or 8 balances is conducive to the MGI machine.

[0057] With the application of the products developed by patent CN111910258B, the inventors found that although the products developed by CN111910258B solved the base balance problem on the MGI sequencing platform, the library construction efficiency of some fixed double-end label combination primers and the data splitting of equal proportion mixing on the machine fluctuated greatly, seriously affecting the sequencing quality of the MGI platform and failing to meet customer needs. CN111910258B solved the problem of absolute balance of bases in groups of 4 or 8 and the problem of the impact of different labels on library output through secondary structures. After evaluation and actual application, the dimensional fluctuation of library output was relatively stable. However, due to the large differences in the reading of bases by the sequencer itself, the data splitting after equal proportion mixing of the specific fixed group label combination fluctuated greatly.

[0058] Since the MGI sequencer requires that each composition of the base cannot be less than 12.5%, if a large number of samples (for example, 384 samples) are loaded at the same time, the data output of the label primer combination of some samples is not ideal, which will affect customer satisfaction. In addition, since MGI has not yet solved the base reading preference, the current sequencer throughput has successively launched DNBSEQ-T7 to output 6Tb data and DNBSEQ-T20X2 to output 72Tb data sequencers to meet the needs of colleagues with a large number of samples. Based on patent CN111910258B, in order to meet the customer's better product satisfaction, the present invention has carried out strict screening and evaluation on the two dimensions of library output and sequencing data splitting on the basis of a fixed upstream and downstream label group of 4 balances, and has given better usage suggestions.

[0059] As mentioned in the background technology, the prior art MGI platform double-end sequencing tags have the problem of unsatisfactory data output when a large number of samples (for example, 384 samples) are loaded onto the machine at the same time. The present invention strictly evaluates and screens the two dimensions of library output and whole genome sequencing data splitting of DNA libraries constructed with different tags on the basis of a fixed balance of four upstream and downstream tags in a group. The method of the present invention provides a new solution for the selection of sequencing tags on the MGI platform, improves the accuracy of sequencing data when a large number of samples (for example, 384 samples) are loaded onto the machine at the same time, and promotes the development of sequencing on the MGI platform. Based on the above problems, the inventors have proposed a series of protection schemes of the present invention.

[0060] In a first typical embodiment of the present invention, a method for constructing a DNA library based on the MGI platform is provided, the construction method comprising: connecting a bubble linker to a target sample to obtain a connection product;

[0061] The ligation products were subjected to library construction using amplification primer pairs to obtain an amplified library with double-end library tags based on the MGI platform;

[0062] Wherein, the amplification primer pair has a double-end library tag, including a library tag at the 5' end and a library tag at the 3' end;

[0063] The 5'-end library tag is selected from any group of tags corresponding to the phosphorylated end of the 4-base balance in Table 1 or Table 2, and the above-mentioned 3'-end library tag group is selected from the tags corresponding to the fixed-matched non-phosphorylated end corresponding to the above-mentioned 5'-end library tag group in Table 1 or Table 2;

[0064] The above 4-base balance refers to the balance of the tag sequence in groups of 4. The tag sequence in groups of 4 has one each of the bases A, T, G and C at positions 1 to 10 of the tag;

[0065] The bubble linker comprises a first linker sequence and a second linker sequence, the first linker sequence is SEQ ID NO: 769, and the second linker sequence is SEQ ID NO: 770;

[0066] Each of the above-mentioned amplification primer pairs further includes a 5'-end universal amplification sequence and a 3'-end universal amplification sequence, wherein the 5'-end universal amplification sequence includes a universal sequence located upstream of the library tag at the 5'-end and a universal sequence located downstream of the library tag at the 5'-end, and the 3'-end universal amplification sequence includes a universal sequence located upstream of the library tag at the 3'-end and a universal sequence located downstream of the library tag at the 3'-end;

[0067] Among them, the universal sequence located upstream of the library tag at the above-mentioned 5' end is SEQ ID NO: 773, and the universal sequence located downstream of the library tag at the above-mentioned 5' end is SEQ ID NO: 774; the universal sequence located upstream of the library tag at the above-mentioned 3' end is SEQ ID NO: 775, and the universal sequence located downstream of the library tag at the above-mentioned 3' end is SEQ ID NO: 771, and is used in conjunction with the first linker sequence shown in SEQID NO: 769 and the second linker sequence shown in SEQ ID NO: 770.

[0068] In a second typical embodiment of the present invention, a DNA library construction kit is provided, which includes an amplification primer composition, and the amplification primer composition includes a combination of amplification primer pairs in a DNA library construction method based on a plurality of MGI platforms and a bubble connector.

[0069] In a third typical embodiment of the present invention, a sequencing library is provided. The sequencing library is a library constructed using the above-mentioned MGI platform-based DNA library construction method or DNA library construction kit.

[0070] The beneficial effects of the present invention will be further explained in detail below in conjunction with specific embodiments.

[0071] Example 1 Evaluation of library output and whole genome sequencing data splitting of different combinations of double-ended unique tag library construction adapters in Table 1 of CN111910258B

[0072] The specific experimental steps are as follows:

[0073] Step 1: Sample fragmentation

[0074] Using Covaris TM The genomic DNA standard sample (Promega, G1521) was fragmented using a DNA ultrasonic disruptor to an average fragment size of 250-300 bp.

[0075] Step 2: End repair & A addition ( DNA universal library construction kit, catalog number: #1002101, Nanoda), the specific steps are as follows:

[0076] 1. Take out End Repair & A-Tailing Buffer and dissolve it at room temperature, mix well, and place on ice for later use.

[0077] 2. Take out End Repair & A-Tailing Enzyme and place it on ice to thaw naturally. Mix well and centrifuge instantly for later use.

[0078] 3. Prepare the reaction system in a 0.2 mL PCR tube placed on ice according to the following table. The reaction system is shown in Table 3:

[0079] Table 3

[0080] Fragmented DNA 40μL (10ng) End Repair & A-Tailing Buffer 6μL End Repair & A-Tailing Enzyme 4μL Total volume 50μL

[0081] 4. Mix well and centrifuge briefly to place all the reaction solution at the bottom of the PCR tube.

[0082] 5. Start the following reaction program on the PCR instrument. When the temperature stabilizes to 20°C, put the reaction tube into the PCR instrument. The reaction program is shown in Table 4:

[0083] Table 4

[0084] 20℃ 30min 65℃ 30min 10℃ Hold

[0085] Step 3: Connect the connector

[0086] 1. Universal Stubby Adapter is formed by annealing primers SEQ ID NO: 770 and SEQ ID NO: 769. After mixing the two primers in equal moles, incubate at 95°C for 2 minutes and then slowly cool down to 20°C to form Universal Stubby Adapter, where

[0087] The sequence of SEQ ID NO: 770 is: ttgtcttcctaacaggaacgacatggctacgatccgact*t, where * represents thio modification;

[0088] The sequence of SEQ ID NO: 769 is: / 5Phos / agtcggaggccaagcggtcttaggaagacaa, where / 5Phos / represents phosphorylation modification; these two sequences are the same as those in CN 111910258 B, and have the same functions and effects.

[0089] 2. Take out the Ligation Buffer and dissolve it at room temperature, mix well, and place it on ice for later use.

[0090] 3. Take out the DNA Ligase and place it on ice to thaw naturally. Mix well and centrifuge it for instant use.

[0091] 4. Take out the PCR reaction tube in step 2 from the PCR instrument, place it on ice, and prepare the reaction system according to the following table. The reaction system is shown in Table 5:

[0092] Table 5

[0093]

[0094]

[0095] 4. Mix well and centrifuge briefly to place all the reaction solution at the bottom of the PCR tube.

[0096] 5. Start the following reaction program on the PCR instrument. When the temperature stabilizes to 20°C, put the reaction tube into the PCR instrument. The reaction program is shown in Table 6:

[0097] Table 6

[0098] 20℃ 15min 4℃ Hold

[0099] Step 4: Purification of ligation product

[0100] 1. Take out the SP Beads, vortex and mix thoroughly, and equilibrate at room temperature for 30 minutes before use.

[0101] 2. Add 40 μL of the ligation reaction product from step 3 SP Beads, mix well, and incubate at 25°C for 5–10 min.

[0102] 3. Centrifuge the PCR tube briefly and place it on a magnetic rack for 5 minutes until the liquid is completely clear. Use a pipette to remove and discard the supernatant.

[0103] 4. Slowly add 150 μL of 80% ethanol along the side wall of the PCR tube, being careful not to disturb the magnetic beads. Let it stand for 30 seconds and use a pipette to remove and discard the supernatant.

[0104] 5. Repeat step 4 once.

[0105] 6. Centrifuge the PCR tube briefly and place it on a magnetic rack. Use a 10μL pipette tip to remove a small amount of residual ethanol, being careful not to suck up the magnetic beads.

[0106] 7. Open the PCR tube cap and let it stand at room temperature for about 5 minutes until the ethanol evaporates completely.

[0107] 8. Remove the PCR tube, add 20 μL Nuclease Free Water to the PCR tube, and proceed to step 5 with the magnetic beads.

[0108] Step 5: Universal Stubby Adapter ligation product amplification

[0109] Remove 2X HiFi PCR Master Mix and Place Universal Stubby Adapter PrimerMix on ice to thaw naturally, mix well, and centrifuge briefly for later use. Universal Stubby Adapter Primer Mix is ​​formed by mixing primers SEQ ID NO: 771 and SEQ ID NO: 772 in equal moles; wherein

[0110] The sequence of SEQ ID NO: 771 is: TTGTCTTCCTAAGACCGCTTGGCC;

[0111] The sequence of SEQ ID NO: 772 is: CACAGAACGACATGGCTACGA.

[0112] 2. Prepare the reaction system in a 0.2 mL PCR tube placed on ice according to the following table (add from top to bottom in sequence). The reaction system is shown in Table 7:

[0113] Table 7

[0114]

[0115] 3. Place the PCR tube into the PCR instrument and start the following program. The reaction program is shown in Table 8:

[0116] Table 8

[0117]

[0118] Step 6: Purification and quantification of Universal Stubby Adapter amplification products

[0119] 1. Take out the SP Beads, vortex and mix thoroughly, and equilibrate at room temperature for 30 minutes before use.

[0120] 2. Add 50 μL of amplification product from step 5 SP Beads, mix well, and incubate at 25°C for 5–10 min.

[0121] 3. Centrifuge the PCR tube briefly and place it on a magnetic rack for 5 minutes until the liquid is completely clear. Use a pipette to remove and discard the supernatant.

[0122] 4. Slowly add 150 μL of 80% ethanol along the side wall of the PCR tube, being careful not to disturb the magnetic beads. Let it stand for 30 seconds and use a pipette to remove and discard the supernatant.

[0123] 5. Repeat step 4 once.

[0124] 6. Centrifuge the PCR tube briefly and place it on a magnetic rack. Use a 10μL pipette tip to remove a small amount of residual ethanol, being careful not to suck up the magnetic beads.

[0125] 7. Open the PCR tube cap and let it stand at room temperature for about 5 minutes until the ethanol evaporates completely.

[0126] 8. Remove the PCR tube, add 50 μL Nuclease Free Water to the PCR tube, use a pipette to evenly suspend the magnetic beads, and incubate at 25°C for 2 minutes.

[0127] 9. Centrifuge the PCR tube briefly and place it on a magnetic rack for 2 minutes until the liquid is completely clear. Use a pipette to carefully transfer the supernatant to a new 0.2 mL PCR tube, being careful not to absorb the magnetic beads.

[0128] 10. Quantify the purified product using methods such as Qubit or quantitative PCR.

[0129] 11. Use Nuclease Free Water to dilute the purified product to a final concentration of 1 ng / μL.

[0130] Step 7: Universal MDI-Index Primer Mix Amplification

[0131] 1. Take out 2X HiFi PCR Master Mix and Place Universal MDI-Index Primer Mix on ice to thaw naturally, mix well, and centrifuge instantly for later use. Universal MDI-Index Primer Mix is ​​formed by mixing primer 1 and primer 2 in equal moles; wherein,

[0132] The sequence of primer 1 is as follows: 5'-SEQ ID NO: 773-nnnnnnnnnn-SEQ ID NO: 774-3', the 5' end contains phosphorylation modification; the sequence of SEQ ID NO: 773 is: ctctcagtacgtcagcagtt; the sequence of SEQ ID NO: 774 is: caactccttggctcacagaacgacatggctacga; nnnnnnnnnn is selected from SEQ ID NO: 1-384 in patent CN 111910258 B (forward application, see Table 1 of the present invention);

[0133] The sequence of primer 2 is as follows: 5'-SEQ ID NO: 775-nnnnnnnnn-SEQ ID NO: 771-3'; the sequence of SEQ ID NO: 775 is: gcatggcgaccttatcag; the sequence of SEQ ID NO: 771 is: ttgtcttcctaagaccgcttggcc; nnnnnnnnnn is selected from SEQ ID NO: 384-1 in patent CN 111910258 B (reverse application, see Table 1 of the present invention);

[0134] It should be noted that nnnnnnnnnn of primer 1 and nnnnnnnnnn of primer 2 are in a one-to-one fixed matching relationship. For example, when nnnnnnnnnn of primer 1 is the sequence shown in SEQ ID NO: 1 in Table 1, nnnnnnnnnn of primer 2 is the sequence shown in SEQ ID NO: 384 in Table 1;

[0135] For another example, when nnnnnnnnnn of primer 1 is the sequence shown in SEQ ID NO: 2 in Table 1, nnnnnnnnnn of primer 2 is the sequence shown in SEQ ID NO: 383 in Table 1;

[0136] For example, when nnnnnnnnnn of primer 1 is the sequence shown in SEQ ID NO: 3 in Table 1, nnnnnnnnnn of primer 2 is the sequence shown in SEQ ID NO: 382 in Table 1, and so on, a total of 384 pairs of fixed double-end tag combinations are obtained for library construction. As shown in Table 1, the corresponding relationship ensures the balance of the 4 bases and limits the combination of specific upstream and downstream tags. The purpose of this is to evaluate the two indicators of library output and sequencing data splitting through this determined relationship.

[0137] It should be noted that the tag sequences in Table 1 of the present invention are derived from Table 1 in patent CN 111910258 B. The tags in Table 1 of patent CN 111910258 B are fixedly matched to obtain 384 pairs of fixedly matched upstream and downstream tag pairs. This example further measures the balance of the library output and the whole genome sequencing data based on the 384 pairs of fixedly matched upstream and downstream tag pairs in Table 1 of the present invention, thereby evaluating the 384 pairs of fixedly matched upstream and downstream tag pairs as excellent, ordinary or unqualified.

[0138] 2. Prepare the reaction system in a 0.2 mL PCR tube placed on ice according to the following table (add from top to bottom in sequence). The reaction system is shown in Table 9:

[0139] Table 9

[0140]

[0141] 3. Place the PCR tube into the PCR instrument and start the following program. The reaction program is shown in Table 10:

[0142] Table 10

[0143]

[0144] Step 8: Amplification library purification and quantification

[0145] 1. Take out the SP Beads, vortex and mix thoroughly, and equilibrate at room temperature for 30 minutes before use.

[0146] 2. Add 25 μL of amplification product from step 7 SP Beads, mix well, and incubate at 25°C for 5–10 min.

[0147] 3. Centrifuge the PCR tube briefly and place it on a magnetic rack for 5 minutes until the liquid is completely clear. Use a pipette to remove and discard the supernatant.

[0148] 4. Slowly add 150 μL of 80% ethanol along the side wall of the PCR tube, being careful not to disturb the magnetic beads. Let it stand for 30 seconds and use a pipette to remove and discard the supernatant.

[0149] 5. Repeat step 4 once.

[0150] 6. Centrifuge the PCR tube briefly and place it on a magnetic rack. Use a 10μL pipette tip to remove a small amount of residual ethanol, being careful not to suck up the magnetic beads.

[0151] 7. Open the PCR tube cap and let it stand at room temperature for about 5 minutes until the ethanol evaporates completely.

[0152] 8. Remove the PCR tube, add 30 μL TE Solution to the PCR tube, use a pipette to evenly suspend the magnetic beads, and incubate at 25°C for 2 minutes.

[0153] 9. Centrifuge the PCR tube briefly and place it on a magnetic rack for 2 minutes until the liquid is completely clear. Use a pipette to carefully transfer the supernatant to a new 0.2 mL PCR tube, being careful not to suck up the magnetic beads.

[0154] 10. Quantify the purified product using methods such as Qubit or quantitative PCR.

[0155] Step 9: Direct sequencing by isocratic mixing

[0156] 5 ng of each library was taken and mixed together. After isotropic mixing, 200 ng of the mixed library was taken for sequencing. 0.5G of each library was taken for sequencing on the MGI2000 sequencer.

[0157] Step 10: Whole genome sequencing data splitting

[0158] According to the 384 pairs of double-end tags shown in step 7, the data is split, and the library output and whole genome sequencing data split are evaluated. The library products and whole genome sequencing data corresponding to each pair of tags are normalized to obtain the evaluation data corresponding to each pair of tags, such as Figure 1 The present invention classifies and counts the double-end tags (tag pairs) in Table 1 from the two perspectives of library output and data splitting according to the classification standards of "0.85≤normalization value≤1.15", "0.80≤normalization value<0.85 or 1.15<normalization value≤1.20" and "normalization value>1.2 or normalization value<0.80". The statistical results are shown in Table 11.

[0159] Table 11 Output of single library and data splitting after normalization

[0160]

[0161] In order to optimize the use of label combinations, the present invention first classifies 384 pairs of fixed-pair double-end label combinations into 96 groups of 4-base balance groups (as described in step 7 of Example 1) according to the rule of 4-base balance, and then further evaluates each pair of double-end labels from the two perspectives of uniformity of library output and uniformity of whole genome sequencing data splitting. Double-end labels with normalization values ​​of library output and whole genome sequencing data of 0.85 to 1.15 are marked as excellent labels; double-end labels with normalization values ​​of library output and / or whole genome sequencing data of >1.2 or <0.8 are marked as unqualified labels; other labels are marked as ordinary labels. Because a 4-base balance group contains a total of 4 pairs of double-end labels, a 4-base balance group will obtain a total of 4 labels.

[0162] The 4-base balanced group is further labeled according to the labeling conditions in the 4-base balanced double-end labels. If the 4 labels in the 4-base balanced group are all excellent labels, then the 4-base balanced group is an excellent group. If the labels in the 4-base balanced group include both excellent labels and ordinary labels or only ordinary labels, then the 4-base balanced group is labeled as an ordinary group. If the labels in the 4-base balanced group include unqualified labels, then the 4-base balanced group is an unqualified group. According to the above screening criteria, the present invention screened out 33 excellent groups (combinations marked with bold fonts in the balanced combination column in Table 1), 26 ordinary groups (combinations marked with ordinary fonts in the balanced combination column in Table 1) and 37 unqualified groups (combinations marked with underlined fonts in the balanced combination column in Table 1) from the 96 groups of 4-base balanced double-end fixed labels in Table 1 (see Table 13). The proportion of each group is shown in Figure 2 .

[0163] It should be noted that, since Table 1 of patent CN 111910258 B groups the bases into 4 balanced groups, the sequences shown in SEQ ID NO: 1-4 in Table 1 of CN111910258B together constitute 4 balanced group number 1; the sequences shown in SEQ ID NO: 5-8 together constitute 4 balanced group number 2; the sequences shown in SEQ ID NO: 9-12 together constitute 4 balanced group number 3; the sequences shown in SEQ ID NO: 13-16 together constitute 4 balanced group number 4, and so on.

[0164] Therefore, in the present invention, when nnnnnnnnnn of primer 1 is the sequence shown in SEQ ID NO: 1-4 in Table 1, nnnnnnnnnn of primer 2 is the fixed sequence shown in SEQ ID NO: 384-381 in Table 1, the sequences shown in SEQ ID NO: 1-4 also constitute a 4-base balanced group, which is recorded as the first balanced combination.

[0165] For another example, in the present invention, when nnnnnnnnnn of primer 1 is the sequence shown in SEQ ID NO: 5-8 in Table 1, nnnnnnnnnn of primer 2 is the sequence shown in SEQ ID NO: 380-377 in Table 1, and the sequences shown in SEQ ID NO: 5-8 also constitute a 4-base balanced group, which is recorded as the second balanced combination. By analogy, the 384 pairs of fixed-paired double-end label combinations used for library construction in the present invention are further classified into 96 groups of 4-base balanced groups, as shown in Table 1.

[0166] Example 2 Evaluation of balanced library output and data direct sequencing splitting of different combinations of double-ended unique tag library construction adapters in Table 2

[0167] The experimental steps of this example are the same as those of Example 1, but in the sequence of primer 1 of Example 2: nnnnnnnnnn is selected from the tags corresponding to the phosphorylated ends in Table 2 of the present invention, and in the sequence of primer 2 of Example 2: nnnnnnnnnn is selected from the tags corresponding to the non-phosphorylated ends in Table 2 of the present invention. The normalized values ​​of the library output and whole genome data splitting of each pair of double-end tags in Table 2 are shown in Figure 3 .

[0168] It should be noted that the labels corresponding to the phosphorylated ends and the labels corresponding to the non-phosphorylated ends in Table 2 are fixed one-to-one matches. For example, the pair of labels numbered M2-001 are fixed matches. When the nnnnnnnnnn of primer 1 selects the label corresponding to the phosphorylated end in M2-001, the nnnnnnnnnn of primer 2 can only be the label corresponding to the non-phosphorylated end in M2-001.

[0169] It should be noted that Table 2 provides a total of 384 pairs of double-end tags. According to the principle of 4-base balance, the 384 pairs of double-end tags are divided into 96 groups of 4-base balance combinations. The specific tag sequences are shown in Table 2.

[0170] The same screening method as in Example 1 was used to classify and count the double-end tags (tag pairs) in Table 2 of the present invention from the two perspectives of library output and whole genome sequencing data splitting. The statistical results are shown in Table 12.

[0171] Furthermore, the double-ended tags in Table 2 of the present invention are marked as "excellent tags", "ordinary tags" and "unqualified tags" respectively according to the same marking principle as in Example 1. Furthermore, the balanced combinations in Table 2 are marked according to the same standards as in Example 1 based on the marking results. The marking results show that the present invention screened out 25 excellent groups (combinations marked with bold fonts in the balanced combination column in Table 2), 25 ordinary groups (combinations marked with ordinary fonts in the balanced combination column in Table 2) and 46 unqualified groups (combinations marked with underlined fonts in the balanced combination column in Table 2) from the 96 groups of 4-base balanced double-ended fixed tags in Table 2 (see Table 13). The proportion of each group is shown in Figure 4 .

[0172] Table 12 Library output and data splitting data of normalized label pairs

[0173]

[0174]

[0175] It should be noted that the labels in Table 2 and Table 1 have different sources and different sequences, but the present invention uses the same criteria for evaluating the labels in the two tables, so the labels in Table 2 and Table 1 can be sequenced together. Combining the evaluation results of Table 1 and Table 2, the present invention provides a total of 58 excellent groups, 51 ordinary groups and 83 unqualified groups (see Table 13).

[0176] Table 13

[0177]

[0178] In order to take into account both high sequencing quality and the simultaneous sequencing of a large number of samples, we recommend the following standards: When the number of samples does not exceed 232, the four-base balanced label pairs in the excellent group are preferred. When the number of samples is 233-436, the four-base balanced label pairs in the excellent group and the ordinary group are preferred. When the number of samples is 437-768, the four-base balanced label pairs in the excellent group, the ordinary group and the unqualified group are preferred. It should be noted that when the number of samples is 233-567, if the four-base balance is not considered, the label pairs in the excellent group + the excellent label pairs in the ordinary group + the excellent label pairs in the unqualified group are preferred. Similarly, when the number of samples is 567-666, if the four-base balance is not considered, the excellent label pairs and the ordinary label pairs in all combinations are preferred. In addition, if the number of samples is not a multiple of 4, for example, the sample size is 14, 12 of which use 4-base balanced double-end labels, and the remaining 2 samples can ignore the 4-base balance.

[0179] From the above description, it can be seen that the above embodiments of the present invention achieve the following technical effects: In order to meet the increasingly higher requirements for the types and quality of sequencing tags in the prior art, the present invention provides 192 groups of 4-base balanced groups of double-end tags, and marks the above 192 groups of 4-base balanced groups into 58 excellent groups, 51 ordinary groups and 83 unqualified groups from the two perspectives of library output and whole genome data splitting. Further, the present invention gives the use suggestions of the above double-end tags based on the evaluation results, and meets the requirements of high sequencing quality on the basis of realizing the simultaneous sequencing of a large number of samples. The development and application of the present invention further improves the screening criteria of the double-end tags of the MGI platform, improves the sequencing quality of the MGI platform, solves the problem of poor quality of the double-end tags of the MGI platform when a large number of samples (for example, 384 samples) are simultaneously sequenced in the prior art, contributes to the development and improvement of the MGI sequencing platform, and has high economic value.

[0180] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A method for constructing a DNA library based on the MGI platform, characterized in that: The construction method comprises: connecting the bubble-shaped joint to the target sample to obtain a connection product; The ligation products were subjected to library construction using amplification primer pairs to obtain an amplified library with double-end library tags based on the MGI platform; Wherein, the amplification primer pair has a double-end library tag, including a library tag at the 5' end and a library tag at the 3' end; The 5'-end library tag is selected from any group of tags corresponding to the phosphorylated end of the 4-base balance in Table 1 or Table 2, and the 3'-end library tag group is selected from the tags corresponding to the fixed-matched non-phosphorylated end corresponding to the 5'-end library tag group in Table 1 or Table 2; The 4-base balance refers to the balance of the tag sequence in groups of 4, where the tag sequence in groups of 4 has one each of the bases A, T, G and C at positions 1 to 10 of the tag; The bubble linker comprises a first linker sequence and a second linker sequence, the first linker sequence is SEQ ID NO: 769, and the second linker sequence is SEQ ID NO: 770; Each of the amplification primer pairs further comprises a 5'-end universal amplification sequence and a 3'-end universal amplification sequence, wherein the 5'-end universal amplification sequence comprises a universal sequence located upstream of the library tag at the 5'-end and a universal sequence located downstream of the library tag at the 5'-end, and the 3'-end universal amplification sequence comprises a universal sequence located upstream of the library tag at the 3'-end and a universal sequence located downstream of the library tag at the 3'-end; Wherein, the universal sequence located upstream of the library tag at the 5' end is SEQ ID NO: 773, and the universal sequence located downstream of the library tag at the 5' end is SEQ ID NO: 774; the universal sequence located upstream of the library tag at the 3' end is SEQ ID NO: 775, and the universal sequence located downstream of the library tag at the 3' end is SEQ ID NO: 771, and is used in conjunction with the first linker sequence shown in SEQ ID NO: 769 and the second linker sequence shown in SEQ ID NO: 770; Table 1 Table 2 。 2. A DNA library construction kit, characterized in that: The library construction kit comprises an amplification primer composition, which comprises a combination of amplification primer pairs in the method for constructing a DNA library based on the MGI platform according to claim 1 and a bubble adapter.

3. A sequencing library, characterized in that: The sequencing library is a library constructed using the method for constructing a DNA library based on the MGI platform described in claim 1 or the DNA library construction kit described in claim 2.

Images