A digital PCR kit for in vitro detection of SMA and its detection method

Abstract

The present invention provides a digital PCR kit for detecting SMA in vitro and a detection method thereof. Specifically, the present invention provides a method for simultaneously determining the absolute copy number of SMN1 exon 7, SMN1 exon 8, SMN2 exon 7 and SMN2 exon 8 in a sample to be tested for non-diagnostic purposes. The method of the present invention uses a single-tube multiplex digital polymerase chain reaction (dPCR) to simultaneously determine the copy number of SMN1 exon 7 and SMN2 exons 7 and 8. The detection method is accurate, rapid, easy to operate, and uses a small amount of DNA. It is a powerful tool for SMA molecular diagnosis, large-scale screening, and disease severity assessment.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a digital PCR kit for in vitro detection of SMA and a detection method thereof. Background Art

[0002] Spinal muscular atrophy (SMA) is an inherited neuromuscular disease that causes degeneration of alpha motor neurons in the anterior horn cells of the spinal cord, resulting in severe, progressive hypotonia and weakness. With a carrier frequency of 1 / 40-1 / 50 and an estimated incidence of 1 / 10,000 live births, SMA is the second most common autosomal recessive disorder. Affected SMA individuals have homozygous loss of function of the survival motor neuron gene SMN1 on 5q13 but retain a modified SMN2 gene. The most common mutation causing SMA is a homozygous deletion of exon 7 of the SMN1 gene, which can be easily detected and used as a targeted diagnostic test. Due to the reduced number of full-length transcripts produced by the SMN2 gene and the genotype / phenotype association between SMN2 copy number and clinical severity, the number of SMN2 copies can modify the clinical phenotype and therefore become an important predictor.

[0003] Population-based SMA carrier screening identifies carrier couples who are at risk of passing this genetic disease to their offspring and allows carriers to make informed reproductive choices or prepare for immediate treatment of affected children. Three treatments have recently been approved by the U.S. Food and Drug Administration (FDA). Nusinersen uses antisense oligonucleotides to alter splicing of SMN2 transcripts, thereby increasing the expression levels of SMN protein. Onasemnogene abeparvovec is a gene therapy that utilizes an adeno-associated virus serotype 9 vector to increase low functional SMN protein levels. Risdiplam is a small molecule that alters SMN2 splicing to increase functional SMN protein. Newborn SMA screening has been shown to successfully allow infants to receive treatment before motor neuron loss occurs and has improved clinical outcomes.

[0004] Digital PCR (dPCR) is a state-of-the-art technology for absolute nucleic acid quantification that is expected to overcome the limitations of existing methods. The applicability of dPCR in copy number variation (CNV) analysis has been demonstrated in many studies. In dPCR, the DNA template is diluted and evenly distributed in many independent reaction chambers, which can be droplet emulsions or physically isolated reaction chambers. After PCR, the fraction of PCR-positive reactions is converted to the initial concentration of the target DNA using Poisson statistics. dPCR has the following advantages: (1) no reliance on standards or references, (2) high sensitivity, (3) high precision, (4) good stability, and (5) high tolerance to PCR inhibitors.

[0005] To date, several research groups have developed SMA detection methods based on qPCR technology. However, most of them can only detect SMN1 exon 7 and / or SMN2 exon 7 in a single tube. A method for simultaneous accurate, simple, rapid, and multi-target duplication of SMN1 and SMN2 has not been reported before. Due to the large population base of SMA carriers, most of the existing methods detect whole blood samples, and the nucleic acid pretreatment is costly and time-consuming, which is not conducive to large-scale screening. At present, there is no technical solution that can achieve one-tube detection of SMN1 gene and SMN2 gene copy number, point mutations, and other genes. It has been reported that a partial deletion of exon 8 was detected in SMN1. Although this exon 8 is located downstream of the protein coding region of SMN1 mRNA, it may affect the stability of SMN1 mRNA and post-transcriptional gene regulation, and exon 8 in the SMN2 gene may also affect the stability of SMN2 mRNA and post-transcriptional gene regulation.

[0006] Therefore, the field still needs to seek a new method for simultaneously determining the copy number and point mutation of SMN1 gene exon 7, SMN1 gene exon 8, SMN2 gene exon 7 and SMN2 gene exon 8 to improve the diagnostic accuracy, simplify the operation process and improve the timeliness. It can be applied to SMA carrier screening, clinical diagnosis and disease typing. Summary of the invention

[0007] The object of the present invention is to provide a digital PCR kit and a detection method thereof that can simultaneously detect the copy number of SMN1 gene exon 7, SMN1 gene exon 8, SMN2 gene exon 7 and SMN2 gene exon 8.

[0008] In a first aspect of the present invention, a method for simultaneously determining the absolute copy number of SMN1 exon 7, SMN1 exon 8, SMN2 exon 7 and SMN2 exon 8 in a sample to be tested for non-diagnostic purposes is provided, the method comprising simultaneously detecting a target gene and an internal reference gene in the sample to be tested in a tube of digital PCR reaction; simultaneously detecting the target gene and the internal reference gene in at least five fluorescent channels, calculating the target gene ratio TGR, and determining the absolute copy number of the target gene in the sample to be tested;

[0009] The target genes are SMN1 exon 7, SMN1 exon 8, SMN2 exon 7 and SMN2 exon 8.

[0010] In another preferred example, the target gene ratio TGR is the ratio of the total number of DNA copies of the target gene to the total number of DNA copies of the internal reference gene.

[0011] In another preferred embodiment, the TGR is 0, 0.5, 1, 1.5 and 2, corresponding to 0, 1, 2, 3 and 4 absolute copy numbers of the target gene, respectively.

[0012] In another preferred embodiment, the method includes simultaneously detecting SMN1 exon 7, SMN1 exon 8, SMN2 exon 7 and SMN2 exon 8 and an internal reference gene in a sample to be tested in a single tube digital PCR reaction;

[0013] SMN1 exon 7, SMN1 exon 8, SMN2 exon 7 and SMN2 exon 8 and the internal reference gene are detected simultaneously in at least five fluorescence channels, the ratio of SMN1 exon 7, SMN1 exon 8, SMN2 exon 7 and SMN2 exon 8 in the test sample to the internal reference gene is calculated, and the absolute copy number of SMN1 exon 7, SMN1 exon 8, SMN2 exon 7 and SMN2 exon 8 in the test sample is determined.

[0014] In a preferred embodiment, the method comprises an upstream primer SEQ ID NO.1: AAGCTCCAGGTCTCAAGTGA, and a downstream primer SEQ ID NO.2: AGTTTTACAAAAGTAAGATTCACTTTCATAAT for amplifying SMN1 / SMN2 exon 7; and a probe SEQ ID NO.9: CCTTACAGGGTTTCAGACAAAATC for detecting SMN1 exon 7 and a probe SEQ ID NO.10: CCTTACAGGGTTTTAGACAAAATC for detecting SMN2 exon 7;

[0015] The method includes an upstream primer SEQ ID NO.13: AACCAAATGCAATGTGAAATATTT and a downstream primer SEQ ID NO.14: AATGCTATGGTGGCATCCAT for amplifying SMN1 / SMN2 exon 8; and a probe SEQ ID NO.15: ACTGGGGTGGGGGTGGG for detecting SMN1 exon 8 and a probe SEQ ID NO.22: ACTGAGGTGGGGGTGGG for detecting SMN2 exon 8.

[0016] In a second aspect of the present invention, a digital PCR kit for detecting spinal muscular atrophy is provided, wherein the digital PCR kit is a digital PCR kit for simultaneously detecting SMN1 exon 7, SMN1 exon 8, SMN2 exon 7 and SMN2 exon 8 and an internal reference gene in a test sample in a one-tube digital PCR reaction; by simultaneously detecting SMN1 exon 7, SMN1 exon 8, SMN2 exon 7 and SMN2 exon 8 and an internal reference gene in at least five fluorescence channels, the ratio of SMN1 exon 7, SMN1 exon 8, SMN2 exon 7 and SMN2 exon 8 in the test sample to the internal reference gene is calculated, and the absolute copy number of SMN1 exon 7, SMN1 exon 8, SMN2 exon 7 and SMN2 exon 8 in the test sample is determined.

[0017] In a preferred embodiment, the kit includes an upstream primer SEQ ID NO.1: AAGCTCCAGGTCTCAAGTGA, and a downstream primer SEQ ID NO.2: AGTTTTACAAAAGTAAGATTCACTTTCATAAT for amplifying SMN1 / SMN2 exon 7; and a probe SEQ ID NO.9: CCTTACAGGGTTTCAGACAAAATC for detecting SMN1 exon 7 and a probe SEQ ID NO.10: CCTTACAGGGTTTTAGACAAAATC for detecting SMN2 exon 7.

[0018] In a preferred embodiment, the kit also includes an upstream primer SEQ ID NO.13: AACCAAATGCAATGTGAAATATTT, and a downstream primer SEQ ID NO.14: AATGCTATGGTGGCATCCAT for amplifying SMN1 / SMN2 exon 8; and a probe for detecting SMN1 exon 8 SEQ ID NO.15: ACTGGGGTGGGGGTGGG and a probe for detecting SMN2 exon 8 SEQ ID NO.22: ACTGAGGTGGGGGTGGG.

[0019] In a preferred embodiment, the kit comprises primers and probes for amplifying and detecting at least one internal reference gene.

[0020] In a preferred embodiment, the kit includes an upstream primer SEQ ID NO.28: GCTTGCACACATTTAGATGTGGAT and a downstream primer SEQ ID NO.29: ACTTTCAGAGAGCCCAAACAG for amplifying the internal reference gene RPP30, and a probe SEQ ID NO.30: ATGACGTGGCAAATCTAGGC for detecting the internal reference gene RPP30.

[0021] In a preferred embodiment, the fluorescent group labeled at the 5' end of the detection probe for detecting SMN1 exon 7, SMN1 exon 8, SMN2 exon 7, SMN2 exon 8 and the internal reference gene is FAM, FITC, Cy3, VIC, HEX, ROX, TET, NED, Cy5 or Cy5.5; the label at the 3' end is MGB, BHQ-1, BHQ-2 or BHQ-3; each probe is labeled with a different fluorescence.

[0022] The third aspect of the present invention provides use of the kit according to the second aspect of the present invention in detecting spinal muscular atrophy.

[0023] The fourth aspect of the present invention provides a use of the kit described in the second aspect of the present invention in clinical diagnosis of SMA, screening of SMA carriers and disease typing.

[0024] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here.

[0025] Compared with the prior art, the present invention has the following technical effects:

[0026] The method provided by the present invention is to measure the simultaneous determination of the copy number of SMN1 exon 7 and SMN2 exons 7 and 8 by a single-tube multiplex digital polymerase chain reaction (dPCR). The detection method is accurate, rapid, easy to operate, and uses a small amount of DNA. It is a powerful tool for SMA molecular diagnosis, large-scale screening, and disease severity assessment. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] The following drawings are used to illustrate specific embodiments of the present invention and are not used to limit the scope of the present invention defined by the claims.

[0028] Figure 1 The SMN1 exon 7 primer-probe dPCR results of different groups are shown.

[0029] Figure 2 Shown are the SMN2 exon 7 primer-probe dPCR results for different groups.

[0030] Figure 3 Shown are the SMN1 exon 8 primer-probe dPCR results for different groups.

[0031] Figure 4 Shown are the SMN2 exon 8 primer-probe dPCR results for different groups.

[0032] Figure 5 The dPCR results of the internal reference RPP30 primers and probes of different groups are shown.

[0033] Figure 6 The annealing temperature optimization results for different primer probes are shown.

[0034] Figure 7 The results of dPCR tests with different primer probe specificities are shown.

[0035] Figure 8 Primer-probe performance validation dPCR results are shown.

[0036] Fig. 9 Primer-probe performance validation linearity plots are shown. DETAILED DESCRIPTION

[0037] In order to more easily understand the present invention, some technical and scientific terms are specifically defined below. Unless otherwise clearly defined in this article, all other technical and scientific terms used herein have the meanings commonly understood by those of ordinary skill in the art to which the present invention belongs. Before describing the present invention, it should be understood that the present invention is not limited to the specific methods and experimental conditions described, because such methods and conditions can be changed. It should also be understood that the terms used herein are intended only to describe specific embodiments, and are not intended to be restrictive, and the scope of the present invention will be limited only by the appended claims.

[0038] It should be noted that the type of sample to be tested is not particularly limited, and can be blood, dried blood spots, other body fluids, tissues or oral swabs, etc., which can be selected according to needs. In addition, the fluorescent group labeled at the 5' end of the detection probe used can be FAM, FITC, Cy3, VIC, HEX, ROX, TET, NED, Cy5, Cy5.5, and the label at the 3' end can be MGB, BHQ-1, BHQ-2, BHQ-3.

[0039] The specific technical solution of the present invention is:

[0040] The detection method of SMN1 and SMN2 genes in the present invention detects four target genes in total: SMN1 exon 7 and exon 8 and SMN1 exon 7 and exon 8. An SMA detection kit (digital PCR method) is developed to simultaneously detect SMN1 and SMN2 genes in a single reaction.

[0041] The kit contains 3 primer pairs and 5 hydrolysis probes (Table 1). The primer BLAST results show that they target SMN1 exon 7 and 8, SMN2 exon 7 and 8, and the reference gene ribonuclease P protein subunit p30 (RPP30). SMN1 exon 7 and SMN2 exon 7 are targeted by the same primer pair, but two different minor groove binder (MGB) probes are fluorescently labeled with FAM and HEX, respectively. Similarly, SMN1 exon 8 and SMN2 exon 8 are targeted by the same primer pair, but two different locked nucleic acid (LNA) probes are fluorescently labeled with Cy5.5 and Cy5, respectively. RPP30 is targeted by the RPP30-2 set of primer probes and the ROX labeled probe.

[0042] Result interpretation and analysis: The disease condition of the person being tested is determined by calculating the target gene ratio (TGR).

[0043] TGR = total number of DNA copies of target gene / total number of DNA copies of reference gene

[0044] The target gene in this formula refers to SMN1 exon 7, SMN1 exon 8, SMN2 exon 7 or SMN2 exon 8. Since the reference gene is usually present in two copies of the diploid genome, the copy number of the target gene can be known based on TGR. In theory, TGR of 0, 0.5, 1, 1.5 and 2 corresponds to 0, 1, 2, 3 and 4 copies of the target gene, respectively.

[0045] Table 1

[0046]

[0047]

[0048] The kit also contains PCR reagents (10×dPCR Taq Master Mix), including Taq DNA polymerase, uracil-n-glycosylase (UNG), MgCl2, dNTPs and optimal concentration of reaction buffer for effective PCR amplification. The SMA detection kit (digital PCR method) of the present invention adopts AccuONE-200 digital PCR detection system (ZHENZHUN, Shanghai, China). The configuration system is shown in Table 2:

[0049] Table 2

[0050] Element 20μL system 10×dPCRTaqMasterMix 2μL Final concentration of F / R / PMix 0.5μM DNATemplate 2-17 μL RNase-free Water Make up to 20 μL

[0051] 20 μL of the reaction mixture was evenly added to the microchamber chip through a sample preparation instrument AccuONE-L100B (ZHENZHUN, Shanghai, China), and the chip was placed in an amplifier AccuONE-P100B (ZHENZHUN, Shanghai, China), and the reaction mixture was amplified using the PCR conditions shown in Table 2.

[0052] Note: The PCR reaction solution with the sample added or the chip that has been loaded with the sample should be put on the machine for experiment immediately; if it cannot be put on the machine for reaction in time due to special reasons, the PCR reaction solution or the chip that has been loaded with the sample should be stored at 4℃ for no more than 12 hours. The PCR amplification program is shown in Table 3:

[0053] Table 3

[0054]

[0055] The amplified chip was placed in the chip reader AccuONE-R200B (ZHENZHUN, Shanghai) for chip reading analysis. The chip analyzer contains 6 fluorescence channels (ATTO, FAM, HEX, ROX, CY5, CY5.5). The chip analyzer detects the fluorescence signal of each channel for each microdroplet, records the peak height of the fluorescence signal, and detects the corresponding fluorescence signal. The fluorescence intensity in the microdroplet is digitized by the fluorescence classification threshold, and the microdroplets with strong fluorescence are judged as "1" (positive), and the microdroplets with weak fluorescence are judged as "0" (negative). The number of "1" and "0" is counted, and the total copy number of the target gene labeled by the multi-channel in the input template can be calculated by correction through the Poisson distribution model.

[0056] Result interpretation criteria: The reading results are presented as a two-dimensional scatter plot, such as Figure 1 As shown in the figure, the upper shaded part is the gray value (brightness) of the positive point, and the lower shaded part is the gray value (brightness) of the negative point; the positive point has a high gray value, and the negative point has a low gray value. The gap value between the negative point and the positive point represents the brightness difference between the positive and negative points. Therefore, the larger the gap value between the positive and negative points, the higher the binding specificity of the probe to the target gene, and the better the detection effect. The digital PCR detection system will calculate the true concentration of the sample according to the statistical formula Poisson distribution, and output the results in copy / ul.

[0057] Example 1. Primer probe screening

[0058] (1) dPCR was performed on samples of known concentration (70 copies / μL) using primers and probes of SMN1 exon 7 group 1 (SMN1 E7-1), group 2 (SMN1 E7-2), and group 3 (SMN1E7-3). Figure 1From left to right, the first, second, and third groups of primer probes for SMN1 exon 7 screened in Table 1 of the present invention are shown in the dPCR result graphs. It can be seen from the figure that the first group of primer probes detects the sample copy number closest to the ideal value, and the amplification results of the second group of primer probes show that the copy number is nearly 60% lower than that of the first group, and the gray value of the positive point is low. The amplification results of the third group of primer probes show that the copy number is about 14% lower than that of the first group, and the gray value of the positive point is low. This shows that the efficiency of the second and third groups of primer probes in binding to the template is low and the detection range is small. Therefore, the first group of primer probes for SMN1 exon 7 (SEQ ID NO.1 to SEQ ID NO.3) has the best detection effect and can be used for subsequent SMN1 exon 7 microchamber digital PCR detection.

[0059] (2) dPCR detection was performed on samples of known concentration (420 copies / μL) using the first, second, and third group of primers and probes for SMN2 exon 7, respectively. Figure 2 From left to right are the result graphs of dPCR of the first, second and third groups of primer probes for SMN2 exon 7 screened in Table 1 of the present invention. It can be seen from the figure that the copy number of the sample detected by the first group of primer probes is closest to the ideal value, and the gray value of the positive point is high. The copy number of the sample detected by the second and third groups of primer probes is lower than the ideal value. In comparison, the first group is better than the second and third groups of primers and probes. Therefore, SMN2 exon 7 is amplified by microchamber digital PCR using the first group of primer probes (SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.10).

[0060] (3) dPCR detection was performed on samples of known concentration (170 copies / μL) using the first, second, and third group of primers and probes for SMN1 exon 8, respectively. Figure 3 From left to right, the first, second, and third groups of primer probes for SMN1 exon 8 screened in Table 1 of the present invention are shown in the dPCR result graphs. It can be seen from the figure that the first group of primer probes detects the sample copy number closest to the ideal value, and the positive point gray value is high. The amplification results of the second group of primer probes show that the copy number is about 23% lower than that of the first group, and the positive point gray value is low. The amplification results of the third group of primer probes show that the copy number is about 23% lower than that of the first group. This shows that the efficiency of the second and third groups of primer probes in binding to the template is low and the detection range is small. Therefore, the first group of primer probes for SMN1 exon 8 (SEQ ID NO.13 to SEQ ID NO.15) has the best detection effect and can be used for subsequent SMN1 exon 8 microchamber digital PCR detection.

[0061] (4) dPCR detection was performed on samples of known concentration (200 copies / μL) using the first, second, and third group of primers and probes for SMN2 exon 8, respectively. Figure 4 From left to right, the first, second, and third groups of primer probes for SMN2 exon 8 screened in Table 1 of the present invention are shown in the dPCR result graphs. It can be seen from the figure that the first group of primer probes detects the sample copy number closest to the ideal value, and the positive point gray value is high. The amplification results of the second group of primer probes show that the copy number is about 75% lower than the first group, and the positive point gray value is low. The amplification results of the third group of primer probes show that the copy number is about 40% lower than the first group, and the positive point gray value is low. This shows that the efficiency of the second and third groups of primer probes in binding to the template is low and the detection range is small. Therefore, the first group of primer probes for SMN2 exon 8 (SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.22) has the best detection effect and can be used for subsequent SMN2 exon 8 microchamber digital PCR detection.

[0062] (5) dPCR detection was performed on samples of known concentration (250 copies / μL) using the first, second, and third groups of primers and probes of the internal reference RPP30. Figure 5 From left to right, the results of the first, second, and third groups of primer probes of RPP30 screened in Table 1 of the present invention in dPCR are shown. It can be seen from the figure that the second group of primer probes detects the sample copy number closest to the ideal value, and the positive point gray value is high. The amplification results of the first group of primer probes show that the copy number is about 20% lower than that of the second group, and the positive point gray value is low. The amplification results of the third group of primer probes show that the copy number is about 10% lower than that of the second group. This shows that the efficiency of the first and third groups of primer probes in binding to the template is low, so the internal reference RPP30 second group of primer probes (SEQ ID NO.28 to SEQ ID NO.30) has the best detection effect and can be used for subsequent internal reference RPP30 microchamber digital PCR detection.

[0063] Example 2. Primer probe annealing temperature screening

[0064] In the reaction conditions of microchamber digital PCR, annealing temperature is an important key parameter. Therefore, the present invention optimizes the annealing temperature. The specific operation process is as follows:

[0065] The chip-based digital PCR reaction system was prepared according to Table 4, wherein the primer probe sequence with the best effect in Example 1 was selected as the primer probe sequence, and the mixed configuration system was shown in Table 4:

[0066] Table 4

[0067] Element 20μL system 10×dPCRTaqMasterMix 2μL SMN1E7FRP (10 μM) 1μL SMN1E8FRP (10 μM) 1μL SMN2E7FRP (10 μM) 1μL SMN2E8FRP (10 μM) 1μL Internal reference RPP30FRP (10 μM) 1μL DNATemplate 2μL RNase-free Water 11μL

[0068] After mixing the reaction system prepared above, the reaction mixture was centrifuged at room temperature (speed 4000 rpm) for 3-5 seconds, and 20 μL of the reaction mixture was loaded on each chip. The digital PCR reaction program is shown in Table 5:

[0069] Table 5

[0070]

[0071] Figure 6 This is the result of digital PCR annealing temperature optimization. The annealing temperatures are set to 52°C, 54°C, 56°C, and 58°C from left to right. Figure 6 The results showed that when the annealing temperature was 56°C, the corresponding gap value of each channel was the largest. According to the generated effective positive value and copy number, 56°C was determined to be the optimal annealing temperature, and TGR of each channel was ≈ 1. The optimal reaction procedure of the microchamber digital PCR of SMA was finally determined as shown in Table 3. The optimized digital PCR reaction conditions had a good amplification result for SMA, and the negative and positive grayscale boundaries were clear.

[0072] Example 3. Primer-probe specific detection

[0073] In the reaction optimization of multiplex digital PCR, primer probe specificity is one of the important key parameters, ensuring that each primer probe can only bind to its own target template, and has no special amplification with other templates and other primer probes. Therefore, the present invention tests the primer probe specificity. The test sample is an SMN plasmid sample synthesized by Jierui Bio, and the number of synthesized strips is 2, one is an SMN1 plasmid containing intron 6 to part of intron 8 sequence, and the other is an SMN2 plasmid containing intron 6 to part of intron 8 sequence. The two plasmid sequences only differ in two single bases of SMN1 and SMN2 exons 7 and 8 themselves, and the rest of the sequences are the same. The specific operation process is as follows:

[0074] (1) The chip-based digital PCR reaction system was prepared according to Tables 6 to 8 below, wherein the primer probe sequence with the best effect in Example 1 was selected as the primer probe. After the prepared reaction system was mixed, the reaction mixture was centrifuged at room temperature (speed 4000 rpm) for 3-5 seconds, and 20 μL of the reaction mixture was loaded on each chip. The digital PCR reaction procedure was as shown in Table 3, wherein the SMN1, SMN2 and SMN1 and SMN2 primer probe specificity test configuration systems were shown in Tables 6 to 8 respectively:

[0075] Table 6

[0076]

[0077]

[0078] Table 7

[0079] Element 20μL system 10×dPCRTaqMasterMix 2μL SMN2E7FRP (10 μM) 1μL SMN2E8FRP (10 μM) 1μL SMN1 Plasmid 2μL RNase-free Water 14μL

[0080] Table 8

[0081] Element 20μL system 10×dPCRTaqMasterMix 2μL SMN1E7FRP (10 μM) 1μL SMN1E8FRP (10 μM) 1μL SMN2E7FRP (10 μM) 1μL SMN2E8FRP (10 μM) 1μL SMN1 Plasmid + SMN2 Plasmid 2μL+2μL RNase-free Water 10μL

[0082] Figure 7 This is a graph of the specificity test results of digital PCR primer probes. From left to right, the primer probes for exons 7 and 8 of SMN1 were mixed with the SMN2 plasmid for amplification, the primer probes for exons 7 and 8 of SMN2 were mixed with the SMN1 plasmid for amplification, and the primer probes for four detection target genes (exons 7 and 8 of SMN1 and exons 7 and 8 of SMN2) were mixed with the SMN1 and SMN2 plasmids.

[0083] Figure 7 The results showed that all four target genes could be detected, the copy numbers of SMN1 exons 7 and 8 (FAM, CY5.5 channels) were 1:1, and the copy numbers of SMN2 exons 7 and 8 (HEX, CY5 channels) were 1:1. The primer probes for SMN1 exons 7 and 8 could not bind to the SMN2 plasmid, indicating that the primer probes for SMN1 exons 7 and 8 could only specifically bind to the SMN1 gene, and the two sets of primer probes had excellent specificity. The primer probes for SMN2 exons 7 and 8 could not bind to the SMN1 plasmid, indicating that the primer probes for SMN2 exons 7 and 8 could only specifically bind to the SMN2 gene, and the two sets of primer probes had excellent specificity. In general, the four target gene primer probes of the present invention would not produce non-specific amplification and had good specificity.

[0084] Example 4. Primer probe performance analysis

[0085] The digital PCR reaction system was prepared as shown in Table 4, wherein the samples to be tested were human extracted DNA samples with three concentration gradients of theoretical original concentrations of 1000, 100, and 10 copies / μL:

[0086] After the reaction system prepared above was mixed, the reaction mixture was centrifuged at room temperature (speed 4000 rpm) for 3-5 seconds, and 20 μL of the reaction mixture was loaded on each chip. The digital PCR reaction program is shown in Table 2.

[0087] Figure 8 The figure is a copy number result diagram of samples with different concentrations amplified by digital PCR of the present invention, and the samples with theoretical original concentrations of 1000, 100, and 10 copies / μL are shown from left to right; Figure 8It can be seen that TGR (SMN1 exon 7) = TGR (SMN1 exon 8) = TGR (SMN2 exon 7) = TGR (SMN2 exon 8) = 1, indicating that the primer probe of the present invention can accurately detect the target gene and the internal reference copy number. As the sample concentration decreases, the copy number and the number of positive points decrease accordingly.

[0088] Fig. 9 This is a linear relationship between the sample concentrations and the copy number of the digital PCR amplification of the present invention. The horizontal axis is the sample dilution multiple, and the vertical axis is the copy number (copies / μL) obtained by detection. Fig. 9 It can be seen that the copy number changes of samples with different concentrations show a linear correspondence with the dilution multiple of the sample concentration, and R2 is greater than or equal to 0.9999; Figure 8 and Fig. 9 It can be seen that the digital PCR reaction system established above is suitable for absolute quantitative analysis of SMA.

[0089] In addition, the present invention also tested normal people, SMA carriers and SMA patients. The results showed that it is of great significance to detect SMN1 exon 7, SMN1 exon / 8, SMN2 exon 7 and SMN2 exon 8 simultaneously in one tube in SMA detection. The copy number detection of different exons can be used for SMA carrier screening and diagnosis, or can assist in SMA typing and guide medication. Detecting these four targets in one tube effectively shortens the detection time, simplifies the operation steps, and makes the detection results more accurate based on digital PCR technology.

[0090] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A method for simultaneously determining the absolute copy number of SMN1 exon 7, SMN1 exon 8, SMN2 exon 7 and SMN2 exon 8 in a test sample for non-diagnostic purposes, characterized in that: The method includes simultaneously detecting the target gene and the internal reference gene in the sample to be tested in a tube of digital PCR reaction; simultaneously detecting the target gene and the internal reference gene in at least five fluorescent channels, calculating the target gene ratio TGR, and determining the absolute copy number of the target gene in the sample to be tested; The target genes are SMN1 exon 7, SMN1 exon 8, SMN2 exon 7 and SMN2 exon 8.

2. The method according to claim 1, characterized in that: In the method, the upstream primer SEQ ID NO.1: AAGCTCCAGGTCTCAAGTGA and the downstream primer SEQ ID NO.2: AGTTTTACAAAAGTAAGATTCACTTTCATAAT are used to amplify SMN1 / SMN2 exon 7; and the probe SEQ ID NO.9: CCTTACAGGGTTTCAGACAAAATC and the probe SEQ ID NO.10: CCTTACAGGGTTTTAGACAAAATC are used to detect SMN1 exon 7; The method includes an upstream primer SEQ ID NO.13: AACCAAATGCAATGTGAAATATTT and a downstream primer SEQ ID NO.14: AATGCTATGGTGGCATCCAT for amplifying SMN1 / SMN2 exon 8; and a probe SEQ ID NO.15: ACTGGGGTGGGGGTGGG for detecting SMN1 exon 8 and a probe SEQ ID NO.22: ACTGAGGTGGGGGTGGG for detecting SMN2 exon 8.

3. A digital PCR kit for detecting spinal muscular atrophy, characterized in that: The digital PCR kit is a digital PCR kit for simultaneously detecting SMN1 exon 7, SMN1 exon 8, SMN2 exon 7 and SMN2 exon 8 and an internal reference gene in a sample to be tested in a one-tube digital PCR reaction; by simultaneously detecting SMN1 exon 7, SMN1 exon 8, SMN2 exon 7 and SMN2 exon 8 and an internal reference gene in at least five fluorescence channels, the ratio of SMN1 exon 7, SMN1 exon 8, SMN2 exon 7 and SMN2 exon 8 in the sample to be tested to the internal reference gene is calculated, and the absolute copy number of SMN1 exon 7, SMN1 exon 8, SMN2 exon 7 and SMN2 exon 8 in the sample to be tested is determined.

4. The digital PCR kit according to claim 3, characterized in that: The kit includes an upstream primer SEQ ID NO.1: AAGCTCCAGGTCTCAAGTGA and a downstream primer SEQ ID NO.2: AGTTTTACAAAAGTAAGATTCACTTTCATAAT for amplifying SMN1 / SMN2 exon 7; and a probe SEQ ID NO.9: CCTTACAGGGTTTCAGACAAAATC for detecting SMN1 exon 7 and a probe SEQ ID NO.10: CCTTACAGGGTTTTAGACAAAATC for detecting SMN2 exon 7.

5. The digital PCR kit according to claim 3, characterized in that: The kit also includes an upstream primer SEQ ID NO.13: AACCAAATGCAATGTGAAATATTT and a downstream primer SEQ ID NO.14: AATGCTATGGTGGCATCCAT for amplifying SMN1 / SMN2 exon 8; and a probe SEQ ID NO.15: ACTGGGGTGGGGGTGGG for detecting SMN1 exon 8 and a probe SEQ ID NO.22: ACTGAGGTGGGGGTGGG for detecting SMN2 exon 8.

6. The digital PCR kit according to claim 3, characterized in that: The kit includes primers and probes for amplifying and detecting at least one internal reference gene.

7. The digital PCR kit according to claim 3, characterized in that: The kit includes an upstream primer SEQ ID NO.28: GCTTGCACACATTTAGATGTGGAT and a downstream primer SEQ ID NO.29: ACTTTCAGAGAGCCCAAACAG for amplifying the internal reference gene RPP30, and a probe SEQ ID NO.30: ATGACGTGGCAAATCTAGGC for detecting the internal reference gene RPP30.

8. The digital PCR kit according to any one of claims 3 to 7, characterized in that: The fluorescent group labeled at the 5' end of the detection probe for detecting SMN1 exon 7, SMN1 exon 8, SMN2 exon 7, SMN2 exon 8 and the internal reference gene is FAM, FITC, Cy3, VIC, HEX, ROX, TET, NED, Cy5 or Cy5.5; the label at the 3' end is MGB, BHQ-1, BHQ-2 or BHQ-3; each probe is labeled with a different fluorescence.

9. Use of the kit according to claim 3 in detecting spinal muscular atrophy.

10. Use of the kit according to claim 3 in clinical diagnosis of SMA, screening of SMA carriers and disease typing.

Images