A method for detecting DNA methylation and its application

Abstract

The present disclosure provides a method for detecting DNA methylation and its application. The method provided by the present disclosure is simple to operate, does not require additional reagents or add too many operating steps; the effect is obvious, and the conversion effect can be significantly improved, especially for low-input library samples. It has wide applicability, and samples with small extraction amounts can be used to construct methylation libraries and sequence the present invention. It has important value in nucleic acid methylation detection, especially in the fields of early tumor screening and disease diagnosis.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to a method for detecting DNA methylation and an application thereof. Background Art

[0002] With the gradual completion of the Human Genome Project, researchers are paying more and more attention to the study of epigenetics. Epigenetics mainly studies the heritable modifications of DNA and related protein molecules without changing the gene nucleotide sequence, that is, an emerging discipline that explores the process and mechanism of gene evolution into phenotype. Its research content mainly includes two categories. One is the regulation of selective transcriptional expression of genes, including DNA methylation, gene imprinting, histone covalent modification and chromatin remodeling; the other is the regulation of gene transcription after transcription, including non-coding RNA, microRNA, antisense RNA, introns and riboswitches in the genome.

[0003] DNA methylation is a major epigenetic modification form of genomic DNA. Studies have shown that there is a very close connection between DNA methylation and cancer, and it can be used as an important indicator for early diagnosis and prognosis evaluation of tumors.

[0004] Thanks to the vigorous development of DNA sequencing technology, DNA methylation sequencing technology has made breakthrough progress. The common method of DNA methylation sequencing is to convert sequencing containing modification sites into normal DNA sequencing through a bisulfite reaction. First, the genomic DNA to be tested is treated with bisulfite, and unmethylated cytosine is converted into uracil, while methylated cytosine does not change. Then PCR amplification is performed to obtain a sequencing library. Uracil is identified as T, and methylated cytosine is still identified as C, thereby distinguishing unmethylated cytosine from methylated cytosine. General DNA sequencing technology can be used for sequencing, including next-generation DNA sequencing technology and single-molecule DNA sequencing technology. By comparing with the sequence of the reference genome, the methylation sites and coverage of the genomic DNA are determined. However, the classic bisulfite sequencing method will cause a large amount of DNA degradation, requires a high amount of DNA input, and is not friendly to samples with low DNA content, such as plasma free DNA. In addition, bisulfite converts unmethylated cytosine into T, and unmethylated cytosine accounts for more than 95% of all cytosines in the genome. Therefore, the second-generation sequencing library constructed after bisulfite treatment has poor base balance (AT accounts for >75%), and 15% phix DNA needs to be added during sequencing to balance, resulting in a large amount of sequencing data waste. Finally, the data generated by WGBS has poor sequencing quality, and special software (such as Bismark) is required when aligning to the genome. The alignment rate is poor, usually only about 70%, which further causes data waste.

[0005] The enzymatic detection method using TET enzyme to convert methylated cytosine is a mild detection method that can preserve the original state of DNA molecules to the greatest extent compared to the bisulfite conversion method. For example, TET enzyme-assisted organoborane sequencing technology uses TET enzyme to convert methylated cytosine into carboxylated cytosine, which is then further converted into dihydrouracil DHU by organoborane (such as pyridine borane). After amplification and sequencing, it can be identified as T, thereby distinguishing methylated C from unmethylated C. However, this method has a complex process, is time-consuming, and is difficult to match with automation. There are problems such as large template loss and low template recovery rate in the library construction process. For situations with limited sample size such as cfDNA, it is easy to lead to library construction failure and insufficient effective data depth.

[0006] Another example of the enzymatic conversion method includes converting 5hmC / 5mC to 5caC / 5ghmC using TET2 protein and oxidation enhancer. APOBEC enzyme (a cytosine deaminase) is then used to convert unmodified cytosine to uracil. During sequencing, the previously modified cytosine is still detected as cytosine. However, there are problems such as high cost, limited conversion rate, low detection sensitivity, and high redundancy.

[0007] Therefore, there is an urgent need for a detection method that can improve the conversion rate of TET enzymes. Summary of the invention

[0008] In order to solve at least one of the above problems, the present disclosure provides a method for detecting methylated cytosine. The method provided by the present disclosure can significantly improve the conversion effect, especially for samples with low starting amounts.

[0009] According to one aspect of the present disclosure, a method for detecting DNA methylation is provided, the steps of which include:

[0010] (A1) denaturing the double-stranded DNA to be tested into single-stranded DNA to obtain a denatured product;

[0011] (A2) using TET enzyme to convert methylated cytosine in the denatured product into carboxylated cytosine to obtain a conversion product;

[0012] (A3) detecting the transformation product.

[0013] In some embodiments, the double-stranded DNA to be tested is derived from cfDNA or fragmented genomic DNA.

[0014] In some embodiments, the double-stranded DNA to be detected includes eukaryotic double-stranded DNA or prokaryotic double-stranded DNA.

[0015] In some embodiments, the denaturation is thermal denaturation.

[0016] In some embodiments, the thermal denaturation comprises heating the double-stranded DNA to be tested at 90-99° C. for 3-15 min.

[0017] In some embodiments, the thermal denaturation comprises heating the double-stranded DNA to be tested at 90°C, 91°C, 92°C, 93°C, 94°C, 95°C, 96°C, 97°C, 98°C or 99°C for 3 min, 4 min, 5 min, 6 min, 7 min, 8 min, 9 min, 10 min, 11 min, 12 min, 13 min, 14 min or 15 min.

[0018] In some embodiments, the thermal denaturation comprises heating the double-stranded DNA to be tested at 90-99° C. for 3-15 min, and then immediately cooling the temperature to below 4° C. and maintaining it for more than 3 min, for example, maintaining it for 3 min, 4 min, 5 min, 6 min, 7 min, 8 min, 9 min, 10 min, 11 min, 12 min, 13 min, 14 min, 15 min, 16 min, 17 min, 18 min, 19 min, 20 min or longer.

[0019] In some embodiments, the TET enzyme includes at least one of TET1, TET2, and TET3.

[0020] In some embodiments, the TET enzyme is derived from at least one of mouse, rat, or human.

[0021] In some embodiments, the methylated cytosine includes one or more of 5-methylcytosine (5mC), 5-hydroxymethylcytosine (5hmC), and 5-formylcytosine (5fC).

[0022] In some embodiments, the conditions of the TET enzyme oxidation treatment include heating at 35-40° C. for 60-100 min.

[0023] In some embodiments, the conditions of the TET enzyme oxidation treatment include heating at 35°C, 36°C, 37°C, 38°C, 39°C or 40°C for 60 min, 61 min, 62 min, 63 min, 64 min, 65 min, 66 min, 67 min, 68 min, 69 min, 70 min, 71 min, 72 min, 73 min, 74 min, 75 min, 76 min, 77 min, 78 min, 79 min, 80 min, 81 min, 82 min, 83 min, 84 min, 85 min, 86 min, 87 min, 88 min, 89 min, 90 min, 91 min, 92 min, 93 min, 94 min, 95 min, 96 min, 97 min, 98 min, 99 or 100 min.

[0024] In some embodiments, the step (A3) further comprises: adding a reducing agent to the reaction system to convert the carboxylated cytosine into dihydrouracil, or, using a deaminase to deaminize the unmethylated cytosine to convert the unmethylated cytosine into uracil.

[0025] In some embodiments, the reducing agent comprises an organoborane.

[0026] In some embodiments, the organoborane comprises pyridine borane.

[0027] In some embodiments, the deaminase comprises an APOBEC enzyme, such as APOBEC3A.

[0028] In some embodiments, the method further comprises the step of using a ligase to connect the DNA to be tested and a linker to obtain a ligation product.

[0029] In some embodiments, the step (A3) further comprises an amplification step and / or a target sequence enrichment step.

[0030] In some embodiments, the detection in step (A3) comprises methylation sequencing, methylation-specific PCR, restriction endonuclease analysis, fluorescence quantification, methylation-sensitive high-resolution melting curve analysis or mass spectrometry.

[0031] In some embodiments, the detection of nucleic acid methylation status includes methylation sequencing, methylation-specific PCR, restriction endonuclease analysis, fluorescence quantitative analysis, methylation-sensitive high-resolution melting curve analysis or mass spectrometry, etc.

[0032] In some embodiments, the methylation sequencing includes methylated DNA immunoprecipitation sequencing, probe capture-based targeted methylation sequencing, multiplex PCR-based methylation sequencing, whole genome methylation sequencing, nanopore sequencing, and the like.

[0033] In some embodiments, the methylation sequencing includes sequencing using a sequencing platform such as Sanger, Illumina, MGI, DNBseq, Gene+Seq, SMRT or Oxford Nanopore.

[0034] In some embodiments, the method comprises the steps of:

[0035] (B1) using a ligase to connect the double-stranded DNA to be tested and the adapter to obtain a double-stranded DNA ligation product;

[0036] (B2) denaturing the double-stranded DNA to be tested into single-stranded DNA to obtain a denatured product;

[0037] (B3) subjecting the denatured product to TET enzyme oxidation to convert the methylated cytosine in the denatured product into carboxylated cytosine;

[0038] (B4) adding the reducing agent to convert the carboxylated cytosine into dihydrouracil to obtain a reduced product;

[0039] (B5) amplifying the reduced product to obtain a constructed library; optionally, further comprising a step of enriching target sequences from the constructed library;

[0040] (B6) sequencing the library or the target sequence in step (B5).

[0041] According to another aspect of the present disclosure, the application of the method provided by the present disclosure in the following is provided:

[0042] 1) Methylation detection;

[0043] 2) Early screening, diagnosis, detection or prognosis monitoring of tumors;

[0044] 3) Early screening, diagnosis, detection or prognosis monitoring of organ damage or tracing;

[0045] 4) Early screening or detection of minimal residual lesions.

[0046] In some embodiments, the methylation sequencing comprises detecting an initial amount of methylation.

[0047] In some embodiments, the methylation detection comprises methylation sequencing, methylation-specific PCR, restriction endonuclease analysis, fluorescence quantification, methylation-sensitive high-resolution melting curve analysis or mass spectrometry.

[0048] According to another aspect of the present disclosure, there is provided use of TET enzyme in converting methylated cytosine into carboxylated cytosine in single-stranded DNA.

[0049] In some embodiments, the application comprises:

[0050] 1) Methylation detection;

[0051] 2) Early screening, diagnosis, detection or prognosis monitoring of tumors;

[0052] 3) Early screening, diagnosis, detection or prognosis monitoring of organ damage or tracing;

[0053] 4) Early screening or detection of minimal residual lesions.

[0054] In some embodiments, the methylation sequencing comprises detecting an initial amount of methylation.

[0055] In some embodiments, the methylation detection comprises methylation sequencing, methylation-specific PCR, restriction endonuclease analysis, fluorescence quantification, methylation-sensitive high-resolution melting curve analysis or mass spectrometry.

[0056] Beneficial effects:

[0057] 1. Simple operation, no need for additional reagents or too many operating steps;

[0058] 2. The effect is obvious and can significantly improve the conversion effect, especially for low-input library construction samples (such as 10ng).

[0059] 3. Wide applicability: The present invention can be used to construct and sequence methylation libraries for samples with small extraction amounts. It has important value in nucleic acid methylation detection, especially in the field of early tumor screening and disease diagnosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0060] Figure 1 The flowchart of the methylation library construction and sequencing method described in the present disclosure is shown.

[0061] Figure 2 The figure shows the methylated DNA conversion rate of the standard when the library construction input amount is between 10ng and 100ng. DETAILED DESCRIPTION

[0062] At present, the method of determining the methylation level of double-stranded DNA relies on TET enzyme conversion. When the input for library construction is less than 100 ng, the smaller the input, the lower the conversion rate. When the input is 10 ng, the methylated DNA conversion rate of the standard is only about 50%, which cannot meet the conversion effect requirements.

[0063] It is known that TET enzymes prefer to bind to double-stranded DNA, thereby converting methylated cytosine into carboxylated cytosine. The present disclosure unexpectedly found that after heat denaturing double-stranded DNA into single strands, the conversion effect is significantly improved by using TET enzymes compared to double-stranded DNA conversion. In some specific embodiments, the method for converting methylated cytosine includes the following steps:

[0064] (1) Denaturing the double-stranded DNA to be tested into single-stranded DNA by heating it at 90-99° C. for 3-15 min to obtain a denatured product;

[0065] (2) The denatured product is oxidized by TET enzyme to convert the methylated cytosine in the denatured product into carboxylated cytosine.

[0066] (3) subjecting the DNA treated with TET enzyme to pyridine borane reduction treatment to convert the carboxylated cytosine into dihydrouracil, or

[0067] APOBEC enzymes are used to deaminize unmethylated cytosine and convert it into uracil.

[0068] Based on the above TET enzyme conversion method, the present disclosure provides an efficient methylation sequencing method that does not require sulfite conversion. Figure 1 The sequencing process is exemplified.

[0069] In some specific embodiments, the sequencing method of methylated cytosine comprises the following steps:

[0070] Step 1: Use ligase to connect the DNA to be tested and the adapter to obtain a double-stranded DNA connection product;

[0071] Step 2: subjecting the double-stranded DNA ligation product to thermal denaturation treatment;

[0072] Step 3: Perform TET oxidation on ssDNA to obtain DNA fragments oxidized by TET enzyme;

[0073] Step 4: subjecting the DNA treated with the TET enzyme to a pyridine borane reduction treatment to obtain a pyridine borane reduction product;

[0074] Step 5: Using the DNA treated with pyridine borane as a template, perform PCR amplification to complete the pre-library construction;

[0075] Step 6: Sequence the pre-library.

[0076] In some embodiments, before step 1, the method further includes the step of performing end repair and / or adding "A" to the DNA to be tested.

[0077] In some embodiments, the DNA to be tested includes cfDNA or fragmented genomic DNA.

[0078] In some embodiments, before step 6, a target sequence enrichment step is also included. Those skilled in the art will appreciate that the target sequence enrichment step can be any currently known enrichment method, such as multiplex PCR or probe capture method.

[0079] In some embodiments, step 6 comprises sequencing the enriched target sequences.

[0080] In some embodiments, the sequencing in step 6 illustratively includes single molecule sequencing, exon or exome sequencing, intron sequencing, sequencing based on electron microscopy, chip sequencing, transistor-mediated sequencing, direct sequencing, random shotgun sequencing, Sanger dideoxy termination sequencing, whole genome sequencing, hybridization sequencing, pyrophosphate sequencing, capillary electrophoresis, duplex sequencing, cycle sequencing, single base extension sequencing, parallel bead arrays, electronic microchips, biochips, microarrays, parallel microchips, solid phase sequencing, high-throughput sequencing, massively parallel signature sequencing, emulsion PCR, low denaturation temperature co-amplification PCR (COLD-PCR), multiplex PCR, reversible dye terminator sequencing, paired end sequencing, near-terminal sequencing. sequencing), exonuclease sequencing, ligation sequencing, short read sequencing, single molecule sequencing, synthesis sequencing, real-time sequencing, reverse terminator sequencing, nanopore sequencing, 454 sequencing, Solexa Genome Analyzer sequencing, SOLiDTM sequencing, MS-PET sequencing composite probe anchor polymerase sequencing (cPAS) and their combinations.

[0081] In some embodiments, the sequencing includes targeted sequencing, genome sequencing, transcriptome sequencing or single-cell sequencing, such as metagenomic sequencing, macrovirome sequencing, epitranscriptome sequencing, spatial transcriptome sequencing, multi-sample parallel sequencing or rare sample sequencing or trace / trace nucleic acid sequencing, etc.

[0082] definition

[0083] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly used in the field to which the present invention belongs. For the purpose of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural form, and vice versa.

[0084] As used herein, the articles "a," "an," and "an" include plural referents unless the context clearly dictates otherwise.

[0085] The expression "about" as used herein is understood by one of ordinary skill in the art and varies within a certain range depending on the context in which it is used. If one of ordinary skill in the art is not aware of the use of the term based on the context in which it is used, "about" will mean up to plus or minus 10% of the specified value.

[0086] In the present disclosure, the term "nucleic acid" generally refers to a monomeric or polymeric form of nucleotides of any length, which is a deoxyribonucleotide or a ribonucleotide, or an analog or variant thereof. A nucleic acid molecule may include one or more unmodified or modified nucleotides. Nucleic acids may have any three-dimensional structure and may perform any known or unknown function. The following are non-limiting examples of nucleic acids: ribonucleic acid (RNA), deoxyribonucleic acid (DNA), coding or non-coding regions of a gene or gene fragment, loci defined by linkage analysis (locus), exons, introns, messenger RNA (mRNA), transfer RNA (RNA), ribosomal RNA, short interfering RNA (siRNA), short hairpin RNA (shRNA), micro RNA (miRNA), ribozymes, complementary deoxyribonucleic acid (cDNA), recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes and primers. Nucleic acid can comprise one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs, such as peptide nucleic acids (PNA), morpholino and locked nucleic acids (LNA), glycol nucleic acids (GNA), threose nucleic acids (TNA), 2'-fluoro, 2'-OMe and thiophosphorylated DNA. Nucleic acid can include one or more subunits selected from adenosine (A), cytosine (C), guanine (G), thymine (T) and uracil (U) or variants thereof. In some instances, nucleic acid is DNA or RNA or derivatives thereof. Nucleic acid can be single-stranded or double-stranded. Nucleic acid can be circular.

[0087] In the present disclosure, the term "DNA", the full name of which is "deoxyribonucleic acid" (abbreviated as DNA), is one of the four biological macromolecules contained in biological cells, which is a type of nucleic acid. DNA carries the genetic information necessary for the synthesis of RNA and proteins, and is an essential biological macromolecule for the development and normal functioning of organisms. DNA is a macromolecular polymer composed of deoxynucleotides. Deoxynucleotides are composed of bases, deoxyribose and phosphate. There are four types of bases: adenine (A), guanine (G), thymine (T) and cytosine (C).

[0088] In the present disclosure, the term "cfDNA (Cell-free DNA)" includes DNA molecules that naturally exist in an extracellular form in a subject (e.g., in blood, serum, plasma, or other body fluids such as lymph, cerebrospinal fluid, urine, or sputum). Although cfDNA is initially present in one or more cells in a large complex biological organism (e.g., mammal), cfDNA undergoes release from the cells into the fluid present in the organism and can therefore be obtained by obtaining a sample of the fluid without the need for an in vitro cell lysis step.

[0089] In this disclosure, the term "genomic DNA" is defined as the DNA material comprising part or all of the collective gene set carried by an individual, cell or organelle.

[0090] In the present disclosure, the term "methylation" refers to the presence of a methyl group at a position where a methyl group is not present in a recognized typical nucleotide base on a nucleotide base. For example, cytosine does not contain a methyl moiety on its pyrimidine ring, but 5-methylcytosine contains a methyl moiety at the 5th position of its pyrimidine ring. In this case, cytosine is not a methylated nucleotide, and 5-methylcytosine is a methylated nucleotide. In another example, thymine contains a methyl moiety at the 5th position of its pyrimidine ring. In this article, when thymine is present in DNA, it is not considered to be a methylated nucleotide because thymine is a typical nucleotide base of DNA. The typical nucleoside bases of DNA are thymine, adenine, cytosine and guanine. The typical bases of RNA are uracil, adenine, cytosine and guanine. Accordingly, a "methylation site" is a position where methylation occurs or may occur in a target gene nucleic acid region. For example, a position containing CpG is a methylation site, wherein cytosine may be methylated or may not be methylated. A "site" may correspond to a single site, which is a single base position or a group of related base positions, for example, a CpG site. A methylation site may refer to a CpG site or a non-CpG site of a DNA molecule that is likely to be methylated. Methylation has been found on cytosine, adenine, thymine and guanine, such as 5mC (5-methylcytosine), 4mC (N4-methylcytosine), 5hmC (5-hydroxymethylcytosine), 5fC (5-formylcytosine), 5caC (5-carboxycytosine), 1mA (N1-methyladenine), 3mA (N3-methyladenine), 6mA (N6-methyladenosine), 7mA (N7-methyladenine), 3mC (N3-methylcytosine), 2mG (N2-methylguanine), 6mG (O6-methylguanine), 7mG (N7-methylguanine), 3mT (N3-methylthymine) and 4mT (O4-methylthymine). In vertebrate genomes, 5mC is the most common type of base methylation followed by guanine (i.e., forming a CpG form).

[0091] In the present disclosure, the term "DNA denaturation" refers to the breaking of hydrogen bonds of base pairs in the nucleic acid double helix, the destruction of the stacking force between bases, the conversion of double strands into single strands, and the change of the natural conformation and properties of nucleic acid, but does not involve changes in its primary structure. Any factors that can destroy the stability of the double helix (such as heating, extreme pH, organic reagents such as methanol, ethanol, urea and formamide, etc.) can cause the denaturation of nucleic acid molecules.

[0092] In this disclosure, the term "sequencing" refers to the process used to determine the sequence (eg, the identity and order of monomeric units) of a biological molecule, eg, a nucleic acid such as DNA or RNA. Exemplary sequencing methods include, but are not limited to, targeted sequencing, single molecule real-time sequencing, exon or exome sequencing, intron sequencing, electron microscopy-based sequencing, panel sequencing, transistor-mediated sequencing, direct sequencing, random shotgun sequencing, Sanger dideoxy terminator sequencing, whole genome sequencing, hybridization sequencing, pyrophosphate sequencing, capillary electrophoresis, duplex sequencing, cycle sequencing, single base extension sequencing, solid phase sequencing, high throughput sequencing, massively parallel signature sequencing, emulsion PCR, low denaturation temperature co-amplification PCR (COLD-PCR), multiplex PCR, reversible dye terminator sequencing, paired end sequencing, near-term sequencing, exonuclease sequencing, ligation sequencing, short read sequencing, single molecule sequencing, sequencing by synthesis, real-time sequencing, reverse terminator sequencing, nanopore sequencing, 454 sequencing, Solexa Genome Analyzer sequencing, SOLiD™ sequencing, MS-PET sequencing, DNA nanoball sequencing (DNBSEQ), composite probe anchor polymerase sequencing (cPAS), and combinations thereof. In some embodiments, sequencing can be performed by a genetic analyzer, such as a genetic analyzer commercially available from Illumina, Inc., Pacific Biosciences, Inc., Applied Biosystems / Thermo Fisher Scientific, Oxford Nanopore Technologies, Geneplus, or Shenzhen BGI Intelligent Manufacturing Technology Co., Ltd. For example, BGI DNBseq sequencing platforms such as BGISEQ-500, BGISEQ-50, MGISEQ-2000, MGISEQ-200, DNBSEQ-T7, DNBSEQ-G99, DNBSEQ-T20X2, or Illumina's HiSeq2000, HiSeq2500, HiSeq4000, HiSeqX10, NovaSeq6000, etc., Geneplus's DNBSEQ-T7, Gene+Seq high-throughput sequencing platform, Pacific Biosciences' SMRT sequencing platform, Oxford Nanopore Technologies' Oxford Nanopore sequencing platform, etc.

[0093] In the present disclosure, the term "methylation-specific PCR (MS-PCR)" is generally designed with two pairs of primers, one pair of MSP primers amplifies the DNA template treated with TET enzyme, and the other pair amplifies the unmethylated fragment. If the first pair of primers can amplify the fragment, it means that the detection site is methylated, and if the second pair of primers can amplify the fragment, it means that the detection site is not methylated.

[0094] In the present disclosure, the term "restriction endonuclease analysis" refers to a DNA sample treated with bisulfite and then amplified by PCR. The amplified product is purified and digested with a restriction endonuclease (BstUI). If the C in its recognition sequence is completely methylated (5mCG5mCG), it will remain as CGCG after PCR amplification, and BstUI I will be able to recognize and cut; if C in the sequence to be tested is not methylated, it will be converted to TGTG after PCR, and the BstUI recognition site will be lost and cannot be cut. In this way, the enzyme-cut products can be separated by electrophoresis, probe hybridization, and scanning quantification to obtain the proportion of methylation in the original sample.

[0095] In this disclosure, the term "fluorometric method (Methylight)" is the use of The method uses a probe and PCR primers to distinguish methylated and unmethylated DNA. First, the DNA fragment is treated with TET enzyme, and a probe that is complementary to the site to be tested is designed, followed by real-time quantitative PCR. The biggest advantage of this method is its high throughput and high sensitivity, and there is no need for electrophoresis, hybridization and other operations after PCR, which reduces contamination and operational errors.

[0096] In the present disclosure, the term "methylation-sensitive high-resolution melting curve analysis" means that after TET enzyme treatment, there will be sequence differences between methylated and unmethylated DNA, and this difference can be found by melting curve analysis because methylated DNA contains more GC and is relatively more difficult to melt. According to the changes in melting temperature and peak shape, complete methylation, complete non-methylation or heterozygous methylation can be easily distinguished. High-resolution melting (HRM) technology can detect very small differences.

[0097] In the present disclosure, the term "mass spec" ("Mass Spec" or "MS") or "mass spectrometry" or "mass spectrometry analysis" refers to an analytical technique for identifying compounds by their mass. MS is a method for filtering, detecting and measuring ions based on their mass-to-charge ratio or "m / z". For example, Sequenom Inc. The platform can also be used for DNA methylation analysis. EpiTYPER TMDNA methylation analysis technology combines base-specific enzyme digestion reaction and MALDI-TOF detection principle, which can realize the analysis and detection of multiple CpG. The base-specific enzyme digestion (MassCLEAVE) experiment starts with the treatment of the DNA to be tested with TET enzyme. After treatment with TET enzyme and APOBEC enzyme, the unmethylated cytosine (C) in the DNA is converted to uracil (U), thereby producing methylation-specific sequence changes in the DNA template. PCR amplification is performed using primers with T7-promoter at the 5 end, and the product is treated with SAP (shrimp alkaline phosphatase) for base-specific enzyme digestion reaction. The size and molecular weight of the DNA fragment after enzyme digestion depend on the base changes after sulfite treatment. The flight mass spectrometer can measure the molecular weight of each fragment, and the supporting software EpiTYPER can automatically report the degree of methylation of each corresponding fragment.

[0098] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments. The specific embodiments described herein are only used to explain the present invention and are not intended to constitute any limitation to the present invention.

[0099] The actual protection scope of the present invention is set forth in the claims. In the following description, descriptions of well-known structures and techniques are omitted to avoid unnecessary confusion of the concepts of the present disclosure. Such structures and techniques are also described in many publications. The equipment, instruments, reagents and / or kits used in the following examples are all commercially available or obtained by conventional methods known to those skilled in the art without mentioning their sources.

[0100] Example

[0101] In the following examples and comparative examples, unless otherwise specified, the magnetic beads used are purchased from Axygen, also known as Axygen magnetic beads, the product name is AxyPrep Magnetic Bead Purification Kits, the product number is MAG-PCR-CL-250, and the beads are in the form of a suspension.

[0102] In the following examples and comparative examples, unless otherwise specified, "room temperature" refers to 23°C ± 2°C. In the following examples and comparative examples, unless otherwise specified, "80% ethanol" refers to ethanol with a volume percentage concentration of 80%, also known as "80% (V / V) ethanol", which is prepared by ethanol and NF-H2O (nuclease-free water, also known as Nuclease-Free Water) in a volume ratio of 4:1.

[0103] In the following examples, precooled ethanol refers to ethanol precooled to 4° C. In the following examples and comparative examples, TE Buffer was purchased from Invitrogen, catalog number 12090015. The composition is as follows: 10 mM Tris-HCl (pH 8.0), 0.1 mM EDTA.

[0104] Example 1

[0105] 1. Prepare 140-160bp methylated DNA standards with reference to the method described in Publication No. CN113817723A, add 0.5% (the mass of the methylated DNA standards is 0.5% of the mass of the healthy human fragmented gDNA) of the fragmented healthy human embryonic kidney cell line 293F cell line gDNA (referred to as healthy human fragmented gDNA) of the methylated DNA standards (referred to as the standards) as the test sample for subsequent library construction and sequencing, the library construction includes the steps of end repair and adding "A", ligation reaction and purification after ligation, DNA thermal denaturation, TET enzyme oxidation reaction, pyridine borane reduction reaction and pre-library amplification.

[0106] 2. End repair and adding "A"

[0107] The library construction kit Hieff (catalog number 12201ES96) of Yisheng Biotechnology was used. The Ultima Pro DNA Library Prep Kit performs end repair and "A" addition on the samples to be tested. The operation is carried out according to the instructions to obtain end repair & A addition products for subsequent experiments. The end repair and A addition reaction system is shown in Table 1, and the reaction procedure is shown in Table 2.

[0108] Table 1 End repair and A addition reaction system

[0109]

[0110]

[0111] Table 2 End repair and A addition reaction procedures

[0112] step temperature time End repair 20℃ 20min Add "A" reaction 65℃ 20min Keep 4℃ ∞

[0113] Note: The temperature of the heated lid is 85°C.

[0114] 3. Ligation Reaction and Post-ligation Purification

[0115] (1) Ligation reaction

[0116] The library construction kit Hieff (catalog number 12201ES96) of Yisheng Biotechnology was used. Ultima Pro DNA Library Prep Kit was used to perform ligation reaction and post-ligation purification on the end repair & A addition products according to the instructions. The ligation reaction system is shown in Table 3, the reaction procedure is shown in Table 4, and the ligation products were used for subsequent experiments.

[0117] Table 3 Ligation reaction system

[0118] Components volume End repair & A-addition products 60μL Connectors 5μL Ligation Buffer 30μL Ligase 5μL Total volume 100μL

[0119] Table 4 Ligation reaction procedure

[0120] temperature time 20℃ 30min 4℃ ∞

[0121] The double-ended UMI adapter of this embodiment refers to Table 2 in paragraph 52 of the specification of the Chinese patent "Short adapter, double index adapter primer and double index library construction system for gene sequencer" with publication number CN112626189A. If other sequencing platforms are used, replace the corresponding adapter.

[0122] (2) Post-ligation purification

[0123] 1) Take out the magnetic beads half an hour in advance and equilibrate them at room temperature; prepare fresh 80% ethanol;

[0124] 2) Add 87 μL of magnetic beads to 100 μL of reaction solution and vortex to mix;

[0125] 3) shaking and mixing, centrifuging, and incubating at room temperature for 5-10 minutes to bind the ligation product obtained in step (1) to the magnetic beads;

[0126] 4) Place the EP tube on a magnetic stand for 2 minutes, let the solution become clear, and remove the supernatant;

[0127] 5) Add 200 μL of 80% ethanol, let stand for 30 seconds, and remove the ethanol; repeat once; centrifuge briefly and discard the liquid;

[0128] 6) After drying the ethanol at room temperature, the magnetic beads should not be noticeably shiny or cracked;

[0129] 7) Add 21 μL of enzyme-free water to elute the DNA to obtain the purified product.

[0130] 4. DNA thermal denaturation

[0131] The purified product was placed in a PCR instrument preheated to 95°C and heated for 5 minutes. The PCR tube was then quickly transferred to an ice bath and cooled for 10 minutes to obtain a denatured product.

[0132] 5.TET enzyme oxidation reaction

[0133] (1) Prepare the TET enzyme oxidation reaction system on ice as shown in Table 5:

[0134] Table 5 TET enzyme oxidation reaction system

[0135] Reaction mixture volume Denatured products 20μL TET enzyme oxidation buffer 7.88μL <![CDATA[1.5mMFe(NH4)2(SO4)2]]> 3.33μL TET enzymes 18μL Enzyme-free water Make up to 50 μL

[0136] NOTE: Turn off the heated lid temperature.

[0137] The TET enzyme comes from NEB's Enzymatic Methyl-seq Conversion Module (Cat. No. E7125L), specifically mTET2.

[0138] The specific components of TET oxidation buffer are as follows: 167mM HEPES (Sigma), 333mM NaCl (Sangon Biotech), 3.3mM α-ketoglutarate (α-KG) (Sigma-Aldrich), 6.67mM ascorbic acid (Sigma-Aldrich), 4mM ATP (Sigma), 8.33mM DTT (Sigma). The concentrations of each component here are the concentrations before the TET oxidation buffer is mixed with other components such as DNA, TET enzyme, Fe(NH4)2(SO4)2 (Sigma-Aldrich), and enzyme-free water, that is, the initial concentration, not the final concentration.

[0139] The redox system is 50ul; 10ng starting amount for library construction: oxidation concentration is about 0.22ng / ul, reduction concentration is about 0.18ng / ul; 30ng starting amount for library construction: oxidation concentration is about 0.62ng / ul, reduction concentration is about 0.40ng / ul; 50ng starting amount for library construction: oxidation concentration is about 1.04ng / ul, reduction concentration is about 0.64ng / ul.

[0140] (2) Reaction conditions: 37°C, 80 min.

[0141] (3) Add 1.5 μL of proteinase K (0.8 U) to the oxidation reaction system and incubate at 50°C for 30 min.

[0142] (3) Add 2.5× magnetic beads to the product.

[0143] (4) Vortex to mix and centrifuge.

[0144] (5) Incubate at room temperature for 5 to 10 minutes to allow the DNA to bind to the magnetic beads.

[0145] (6) Place the EP tube on a magnetic rack for 2 minutes to allow the solution to become clear.

[0146] (7) Aspirate the supernatant.

[0147] (8) Add 200 μL of 80% (V / V) ethanol.

[0148] (9) Let stand for 30 seconds.

[0149] (10) Aspirate the ethanol and rinse again with 80% (V / V) ethanol.

[0150] (11) When dried at room temperature, the beads do not show any noticeable shiny or cracking.

[0151] (12) Elution with 37 μL of enzyme-free water gave the oxidized product.

[0152] 6. Pyridine borane reduction reaction

[0153] (1) The reduction reaction system is prepared as shown in Table 6.

[0154] Table 6 Reduction reaction system

[0155] Reaction mixture volume Oxidation products 35μL 3M Sodium Acetate (pH 4.3) 10μL 10M pyridine borane 5μL Total volume 50μL

[0156] (2) Reaction conditions: 37°C, 1200 rpm, incubation for 16 h.

[0157] (3) Purification and recovery

[0158] 1) Preparation of RPB solution: Axygen magnetic beads and 50% PEG aqueous solution (Sigma) were mixed at a volume ratio of 1:1 to prepare RPB solution;

[0159] 2) RBP was equilibrated at room temperature for 0.5 h;

[0160] 3) Remove the EP tube, spin off instantly, and then add 200-600 μL RPB (400 μL in this example) into the EP tube;

[0161] 4) Place in a constant temperature mixer, incubate at 1000-2000 rpm, 25-30° C. for 15-20 min (25° C., 2000 rpm, 15 min in this embodiment);

[0162] 5) Centrifuge immediately, place the EP tube on a magnetic rack, leave at room temperature for 15 to 30 minutes (15 minutes in this example), and remove the supernatant;

[0163] 6) Add 0.4-1.5 mL of pre-cooled 80-90% ethanol (1.2 mL of 90% ethanol was added in this example) and let stand for 60 seconds;

[0164] 7) Remove the supernatant, repeat the washing twice, and discard the clean liquid;

[0165] 8) After the ethanol is dried, the magnetic beads should not be shiny or cracked.

[0166] 9) Add 25 μL low TE buffer (Invitrogen), vortex and centrifuge, place in a constant temperature mixer, rotate at 1000-2000 rpm, incubate at 30-60° C. for 10-25 min (the rotation speed in this example is 1800 rpm, incubate at 37° C. for 10 min);

[0167] 10) Quickly spin off the rack and take out the supernatant, which is the DNA treated with pyridine borane.

[0168] 6. Pre-library amplification

[0169] (1) The PCR amplification reaction system was prepared according to Table 7, and the reaction procedure was shown in Table 8:

[0170] Table 7 PCR amplification reaction system

[0171] Components volume Pyridine borane treated DNA 20μL KAPAHiFiHotStartUracil+ReadyMix(2×) 25μL Primers 5μL Total volume 50μL

[0172] Table 8 PCR amplification reaction program

[0173]

[0174] The primers used are determined according to the sequencing platform used and the adapter used. The primer sequences used in this embodiment are F (5'-3'): P'-TCTCAGTACGTCAGCAGTTCATTGGTCAACAACTCCTTGGCTCACAGAACGACATGGCTACGATCCGACT (SEQ ID NO: 1) and R (5'-3'): GGCATGGCGACCTTATCAG TTGACCAATGTTGTCTTCCTAAGACCGCTTGGCC (SEQ ID NO: 2). The final concentration of the primers in the system is 0.5-2 μM. The primers in this embodiment are from the MGI platform, and the final concentration of the primers is 1 μM. After the reaction, the library for sequencing can be obtained by purification with 0.9× magnetic beads.

[0175] 7. Sequencing and bioinformatics analysis to identify conversion rate Each sample was sequenced 90G using the MGI T7 platform PE150 mode. All CpGs in the methylation positive standard were methylated, so the conversion rate was calculated as the ratio of C to T in the sequencing results. The formula is: methylated DNA conversion rate (abbreviated as conversion rate) = number of methylated sites / (number of methylated sites + number of unmethylated sites).

[0176] Example 2.

[0177] A denaturation group (single-strand conversion) and a control group (double-strand conversion) were set for the same sample. The denaturation group was sequenced according to steps 1 to 7 in Example 1, and the control group did not perform step 4 DNA thermal denaturation. Other conditions were the same as the denaturation group. The starting amount of library construction was set to 10 ng, 50 ng and 100 ng for each group, respectively.

[0178] The results are as follows Figure 2 As shown in Table 9, after NGS sequencing analysis, when the library input was between 10ng and 100ng, the methylated DNA conversion rate of the standard in the denaturation group was above 94%. When the library input was 10ng, the conversion rate of the denaturation group was 44.48% higher than that of the control group; when the library input was 50ng, the conversion rate of the denaturation group was 6.12% higher than that of the control group; when the library input was 100ng, the conversion rate of the denaturation group was 3.78% higher than that of the control group. It is proved that denaturation before TET enzyme conversion can improve the conversion rate of methylated DNA, especially for low starting amount library construction.

[0179] Table 9 Methylated DNA conversion rate of standard samples when the library input amount is between 10ng and 100ng

[0180]

[0181] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. All technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. A method for detecting DNA methylation, comprising the steps of: (A1) denaturing the double-stranded DNA to be tested into single-stranded DNA to obtain a denatured product; (A2) using TET enzyme to convert methylated cytosine in the denatured product into carboxylated cytosine to obtain a conversion product; (A3) detecting the transformation product.

2. The method according to claim 1, characterized in that The double-stranded DNA to be tested is derived from cfDNA or fragmented genomic DNA; Preferably, the double-stranded DNA to be detected includes eukaryotic double-stranded DNA or prokaryotic double-stranded DNA.

3. The method according to claim 1, characterized in that The denaturation is thermal denaturation; Preferably, the thermal denaturation comprises heating the double-stranded DNA to be tested at 90 to 99° C. for 3 to 15 min; Preferably, the thermal denaturation comprises heating the double-stranded DNA to be tested at 90-99° C. for 3-15 min, and then immediately cooling the temperature to below 4° C., preferably maintaining the temperature for more than 3 min.

4. The method according to claim 1, characterized in that: The TET enzyme includes at least one of TET1, TET2, and TET3; and / or The methylated cytosine includes one or more of 5-methylcytosine, 5-hydroxymethylcytosine, and 5-formylcytosine.

5. The method according to claim 1, characterized in that The conditions for the TET enzyme oxidation include heating at 35-40° C. for 60-100 min.

6. The method according to claim 1, characterized in that The step (A3) further comprises: Adding a reducing agent to the reaction system to convert the carboxylated cytosine into dihydrouracil, or, Deaminase is used to deaminize unmethylated cytosine and convert it into uracil. Preferably, the reducing agent comprises an organic borane; more preferably pyridine borane; Preferably, the deaminase comprises an APOBEC enzyme, such as APOBEC3A.

7. The method according to claim 1, characterized in that The method further comprises the step of connecting the double-stranded DNA and the adapter using a ligase to obtain a connection product; Preferably, the step (A3) further comprises an amplification step and / or a target sequence enrichment step; Preferably, the detection in step (A3) comprises methylation sequencing, methylation-specific PCR, restriction endonuclease analysis, fluorescence quantitative analysis, methylation-sensitive high-resolution melting curve analysis or mass spectrometry.

8. The method according to claim 1, characterized in that It includes the following steps: (B1) using a ligase to connect the double-stranded DNA to be tested and the adapter to obtain a double-stranded DNA ligation product; (B2) denaturing the double-stranded DNA to be tested into single-stranded DNA to obtain a denatured product; (B3) subjecting the denatured product to TET enzyme oxidation to convert the methylated cytosine in the denatured product into carboxylated cytosine; (B4) adding the reducing agent to convert the carboxylated cytosine into dihydrouracil to obtain a reduced product; (B5) amplifying the reduced product to obtain a constructed library; optionally, further comprising a step of enriching target sequences from the constructed library; (B6) sequencing the library or the target sequence in step (B5).

9. Use of the method according to any one of claims 1 to 8 in: 1) Methylation detection; preferably low starting amount methylation detection; Preferably, the methylation detection includes methylation sequencing, methylation-specific PCR, restriction endonuclease analysis, fluorescence quantitative analysis, methylation-sensitive high-resolution melting curve analysis or mass spectrometry; 2) Early screening, diagnosis, detection or prognosis monitoring of tumors; 3) Early screening, diagnosis, detection or prognosis monitoring of organ damage or tracing; 4) Early screening or detection of minimal residual lesions.

10. Application of TET enzyme in converting methylated cytosine in single-stranded DNA into carboxylated cytosine: 1) Methylation detection; preferably low starting amount methylation detection; Preferably, the methylation detection includes methylation sequencing, methylation-specific PCR, restriction endonuclease analysis, fluorescence quantitative analysis, methylation-sensitive high-resolution melting curve analysis or mass spectrometry; 2) Early screening, diagnosis, detection or prognosis monitoring of tumors; 3) Early screening, diagnosis, detection or prognosis monitoring of organ damage or tracing; 4) Early screening or detection of minimal residual lesions.

Images