A legume lectin extraction device and microfluidic detection method thereof

Abstract

The application provides a legume lectin extraction device and a microfluidic detection method thereof, the device comprising a sample bin, an eluent bin, a pretreatment module and a detection module, a first nucleic acid aptamer capable of binding to legume lectin is fixed on a thin layer plate of the pretreatment module, legume lectin is efficiently captured, after elution by an eluent, the content of various legume lectins in legume vegetables is accurately detected by the detection module, a test paper strip or an electrochemical detection component containing a second nucleic acid aptamer probe is in the detection module, and the eluent formula, the sequence of the first nucleic acid aptamer and the second nucleic acid aptamer are respectively optimized, so that the device can realize qualitative and quantitative detection of various legume lectins, the structure is simple, detection is convenient and efficient, and the accuracy of the detection result can be ensured.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of lectin detection, in particular to a legume lectin extraction device and a microfluidic detection method thereof. BACKGROUND

[0002] Legume vegetables contain a variety of allergens, including a variety of lectins. Lectins in legume vegetables are a type of protein that has the ability to bind to specific sugars. Certain types of lectins can cause discomfort or other health effects during digestion.

[0003] Existing lectin detection methods include hemagglutination, antibody method and liquid chromatography, but these methods have limitations. For example, the main problem of hemagglutination is limited specificity, background agglutination and susceptibility to operating conditions. Antibody methods such as "A simple and rapid method for the detection of lectins in seeds using dot-blot analysis" provide a dot-blot analysis method that detects legume vegetable lectins based on the principle of antigen-antibody specific binding. First, samples containing potential lectins are spotted onto nitrocellulose membranes or other suitable solid supports, then incubated with specific antibodies (antibodies against lectins). If the sample contains lectins, they will bind to the antibodies. Finally, the presence of antibody-antigen complexes is detected by colorimetric reaction or fluorescent labeling. However, the main problem of antibody detection is that cross-reactions are prone to occur, the target molecules are not sensitive enough to be detected, different batches of antibodies have quality differences, and are susceptible to operation. Liquid chromatography has obvious disadvantages such as high cost, long time required, and high sample processing requirements. In order to achieve higher economic benefits, it is necessary to develop a fast, simple and cost-effective method.

[0004] For existing detection techniques, complex equipment and longer time costs are usually required, and the respective quantification of multiple lectins in legume vegetables cannot be achieved. Different lectins have different toxicities, and how to effectively distinguish between toxic and non-toxic lectins in legume vegetables is the key to safety evaluation.

[0005] Therefore, it is urgent to find a method and device that can quickly and efficiently enrich and detect lectins in legume vegetables. The device needs to have the advantages of portability and on-site application, high throughput, high sensitivity, low cost, etc., and can also shorten the detection time, reduce the detection cost and improve the detection accuracy. SUMMARY

[0006] To solve the above problems, the application provides a legume lectin extraction device and a microfluidic detection method thereof, which comprises a sample bin, an eluent bin, a pretreatment module and a detection module. The first nucleic acid aptamer capable of binding to legume lectin is fixed on the thin layer plate of the pretreatment module to efficiently capture legume lectin. After elution by the eluent, the detection module accurately detects the content of various legume lectins in legume vegetables. The test paper strip or the electrochemical detection component containing the second nucleic acid aptamer probe in the detection module is optimized in terms of the eluent formula, the sequence of the first nucleic acid aptamer and the sequence of the second nucleic acid aptamer, so that the device can realize qualitative and quantitative detection of various legume lectins, has a simple structure, is convenient and efficient for detection, and can ensure the accuracy of the detection results.

[0007] In one aspect, the application provides a detection device, which comprises a pretreatment module and a detection module. The pretreatment module comprises an enrichment medium, and the enrichment medium is fixed with a nucleic acid aptamer capable of adsorbing a target to-be-detected substance, and is used for enriching the target to-be-detected substance to obtain a to-be-detected sample liquid. The detection module is used for detecting the target to-be-detected substance in the to-be-detected sample liquid.

[0008] The enrichment medium in the application refers to a solid-phase medium capable of intercepting, adsorbing or capturing a target to-be-detected substance from a sample, including a thin layer plate, a filter plate, a resin and the like. For a liquid sample with good flowability, any one of the thin layer plate, the filter plate and the resin can be selected as the enrichment medium. For a sample with poor flowability and high viscosity, the thin layer plate is preferably used as the enrichment medium, which can more efficiently enrich the target to-be-detected substance.

[0009] The application ingeniously uses the characteristics of high specificity and high selectivity of the nucleic acid aptamer in binding to the target substance, fixes the nucleic acid aptamer of the target to-be-detected substance on the enrichment medium, thereby significantly improving the ability of the enrichment medium to intercept and adsorb the target to-be-detected substance, enabling the nucleic acid aptamer to specifically capture the target to-be-detected substance and intercept it on the surface of the enrichment medium, adsorbing the target to-be-detected substance from the sample as much as possible, realizing efficient separation of the target to-be-detected substance from the remaining impurities in the sample, achieving the enrichment effect of the target to-be-detected substance, and obtaining the to-be-detected sample liquid containing a high concentration of the target to-be-detected substance after elution.

[0010] It can be understood that the method provided by the application can be applied to any target to-be-detected substance. Only the appropriate nucleic acid aptamer for the target to-be-detected substance is screened and fixed on the enrichment medium, and the target to-be-detected substance can be enriched and detected.

[0011] Further, the enrichment medium comprises a thin layer plate, and the thin layer plate comprises a first end and a second end. The thin layer plate is placed in an inclined manner with one end downward, and the downward end can be automatically switched between the first end and the second end.

[0012] In some embodiments, the thin layer plate is a thin layer chromatography plate made of polyester film coated with a uniform layer of adsorbent, which is an aptamer capable of adsorbing the target analyte. For example, when the target analyte is legume lectin, the use of a thin layer plate is preferred because the sample liquid is very viscous, which is more conducive to the adsorption of legume lectin protein.

[0013] In some embodiments, the thin layer plate is fixed by a plastic material such as silica gel resin, so that the thin layer plate is fixed in the detection device, and the left and right ends of the thin layer plate can be moved up and down to change the inclination angle by a motor. The inclination angle is 20-30 degrees, which is more conducive to the enrichment and elution of legume lectin. The thin layer plate can be reused or replaced.

[0014] Further, the first end of the thin layer plate is provided with a waste liquid tank, which collects the waste liquid after adsorption when the first end is downward; the second end of the thin layer plate is provided with a collection tank, which collects the sample liquid to be tested when the second end is downward; the inlet of the waste liquid tank is provided with a waste liquid tank one-way valve, and the inlet of the collection tank is provided with a collection tank one-way valve.

[0015] The one-way valve allows liquid to flow into the collection tank and the waste liquid tank in one direction, and prohibits liquid from leaving, thereby avoiding contamination of the sample.

[0016] In some embodiments, the waste liquid tank is used to collect the waste liquid after the crude extract liquid is filtered through the thin layer plate, and is located below the left side of the thin layer plate. After the process is completed, the waste liquid tank can be pulled out to pour out the waste liquid. The collection tank is connected to the detection module, and the collected sample liquid to be tested is sent to the detection module for detection.

[0017] Further, the pretreatment module further comprises a sample tank and an eluent tank. The eluent tank releases eluent to elute the sample to be tested from the thin layer plate, so as to obtain the sample liquid to be tested. The sample tank is provided with a sample tank valve below, and the eluent tank is provided with an eluent tank valve below. The sample tank valve and the waste liquid tank one-way valve are opened at the same time. The eluent tank valve and the collection tank one-way valve are opened at the same time.

[0018] The sample tank and the eluent tank are both located above the detection device, which are grooves capable of containing liquid, and are separately arranged at two positions, such as the sample tank being located at one end and the eluent tank being located at the other end.

[0019] The sample tank can be added with the sample crude extract liquid to be tested, such as the crude liquid sample obtained after the preliminary pretreatment of the sample to be tested. The eluent tank can be pre-stored with the eluent for eluting the target analyte from the thin layer plate.

[0020] In some embodiments, the sample crude extract is obtained by grinding the sample, sieving, defatting twice with petroleum ether, air-drying, extracting three times with ice-cold saline at low temperature, mixing the extracts, adding ammonium sulfate and ammonia water to the supernatant, and centrifuging to obtain the precipitate.

[0021] In some embodiments, the sample tank and the eluent tank are made of light-proof material to store the sample crude extract and the quantitative eluent, so as to avoid decomposition of the surfactant component under light. Valves are arranged below the sample tank and the eluent tank, respectively, to control the flow of the sample liquid and the eluent by a control device, so as to complete the adsorption and elution of the target analyte on the thin layer plate and obtain the sample liquid to be detected.

[0022] The valves and the one-way valves are used to control the flow direction of the filtered or eluted liquid. In the initial state, the sample tank valve and the waste tank one-way valve are opened simultaneously, and the liquid flows into the waste tank after being enriched by the thin layer plate. In the starting state, the eluent tank valve and the collection tank one-way valve are opened simultaneously, and the eluted liquid flows into the collection tank.

[0023] The collection tank is used to collect the eluted sample liquid to be detected, and is arranged below the right side of the thin layer plate in parallel with the waste tank. The detection port at the bottom is used to connect the sample liquid to be detected with the detection module.

[0024] Further, the detection module comprises one or more groups of electrochemical detection components, each group of which is used to detect one target analyte. Each group of electrochemical detection components comprises a working electrode and a probe, and the probe comprises a second aptamer for capturing the target analyte.

[0025] Further, the detection module further comprises a microfluidic channel and a test strip. The microfluidic channel is used to divide the sample liquid to be detected. The test strip is a multiplex test strip coated with an antibody for the target analyte.

[0026] In some embodiments, the detection module comprises a detection port, a camera, a detection chip, and an electrochemical socket.

[0027] The detection port is tightly connected to the collection tank and the detection chip, and the diameter is consistent with the sample addition port of the detection chip, so as to completely transfer the sample liquid to be detected into the chip and complete the detection process.

[0028] The detection chip comprises a chip top plate, a sample adding port, a micro flow channel, a test strip, an electrochemical detection component and a chip bottom plate. The test strip is a multiplex detection test strip, which can simultaneously detect five different target objects. In addition, the detection chip further comprises a chip top plate, a sample adding port, a test strip groove, an electrochemical detection groove, a screen-printed electrode and a chip bottom plate. The chip top plate comprises a top plate and a detection window; the top plate is a hard transparent plastic plate, which is used for sealing the chip to prevent aerosol pollution; the detection window is a transparent plastic sheet, which is sized to contain the T line and C line of the test strip, and is used for camera scanning; the micro flow channel is an F-shaped micron-level groove, which is used for splitting the sample liquid, and the straight end thereof is connected to the sample adding port, and the bifurcated end thereof is connected to the corresponding test strip groove and electrochemical detection groove. The test strip groove is a groove for placing the multiplex detection test strip, which is connected to the micro flow channel, and the multiplex detection test strip can be replaced through the groove after detection to realize multiple uses of a single detection chip; the electrochemical detection groove is used for placing the electrochemical detection component.

[0029] In some modes, the multiplex detection test strip is used to complete the preliminary detection of the sample liquid. The multiplex detection test strip comprises a sample pad, a marker pad, a chromatography membrane and a water absorption pad; the sample pad and the marker pad are mainly made of glass fiber material, non-woven fabric or filter paper; the water absorption pad is filter paper; the chromatography membrane is an NC nitrocellulose membrane pre-embedded with five detection lines (T lines) and one quality control line (C line); five target objects are artificial antigens as the detection lines, and goat anti-mouse secondary antibody is used as the quality control line; the upper end of the chromatography membrane is attached to the sample pad and the marker pad, and the lower end thereof is attached to the water absorption pad, and the parts are connected to complete the connection.

[0030] In some modes, the C line is separated from the T line by 30 mm, and each T line is separated by 10 mm, and the width of the C line and the T line is 5 mm.

[0031] The camera is used to scan the color change of the detection lines (T lines) and the quality control line (C line) on the test strip in the detection window, and the chroma value is transmitted back to the mobile terminal through Bluetooth or wireless network for data processing and result analysis, to complete the qualitative and semi-quantitative judgment of the sample liquid, and realize preliminary detection. The chroma value detection threshold is set for the five target objects, and if the chroma value of a certain target object in the sample liquid exceeds the detection threshold, electrochemical quantitative detection of the target object is performed for accurate analysis. The camera is located below the motor and above the chip detection window.

[0032] The electrochemical detection groove is provided with an electromagnetic valve and a groove, which are used for placing the screen-printed electrode to complete quantitative detection. The electromagnetic valve is used to control the flow of the sample liquid. The groove is five parallel grooves connected to the micro flow channel, which controls the liquid to enter through the electromagnetic valve, to complete the quantitative detection of the sample liquid.

[0033] The screen-printed electrode provides a portable and high-precision three-electrode system, and quantitative detection of target analytes can be achieved by plugging the electrochemical socket.

[0034] The working electrode is a working electrode coated with graphene with special electrical properties on the surface by deposition, plating, etc. The base material can be selected from glass fiber material, non-woven fabric or filter paper. By detecting the change of electrical properties of the working electrode, the unquantifiable biological reaction is converted into a quantifiable electrical signal.

[0035] The counter electrode forms a loop with the working electrode through the solution, providing a channel for electron transfer in the electrochemical detection process. The base material is the same as the working electrode.

[0036] The reference electrode is an Ag / AgCl reference electrode, which forms a loop with the working electrode through the solution to calibrate the electrode potential and improve the accuracy of electrochemical detection.

[0037] The probe is a nucleic acid aptamer that captures the target analyte to the surface of the working electrode, causing a change in the electrical properties of the working electrode.

[0038] The chip base plate includes a base plate and an electrode interface. The base plate is a PVC base plate that supports the chip, and each part is assembled on the base plate. The electrode interface is located in the area of the base plate below the screen-printed electrode, and there are 15 electrode interfaces (one set of three-electrode system for each target analyte) for connecting the electrochemical socket. The electrochemical socket completes quantitative detection through the electrode interface.

[0039] Further, the target analyte is a legume lectin, including any one or more of soybean lectin, concanavalin A, red bean lectin, kidney bean lectin, and red bean lectin.

[0040] Further, the nucleic acid aptamer fixed on the thin layer plate is a first nucleic acid aptamer, and the first nucleic acid aptamer includes a first nucleic acid aptamer that binds to any one or more of soybean lectin, concanavalin A, red bean lectin, kidney bean lectin, and red bean lectin. The first nucleic acid aptamer that binds to soybean lectin, concanavalin A, red bean lectin, kidney bean lectin, and red bean lectin has a nucleotide sequence as shown in SEQ ID NO. 1-5. The first nucleic acid aptamer also has a (TTTTTTTTTT)-(CCCCCCCCCCCCCCC) sequence at the 5' end.

[0041] The first nucleic acid aptamer and the second nucleic acid aptamer are both nucleic acid aptamers capable of high specificity and high selectivity binding with target substances, and are only named respectively for distinguishing the two nucleic acid aptamers. Since the two nucleic acid aptamers are used in different environments, the required nucleic acid aptamers are also screened according to the environmental characteristics to obtain more suitable sequences.

[0042] The nucleic acid aptamer of the five legume lectins is fixed on the thin layer plate in advance, and after recognizing and binding with the corresponding lectin, it is adsorbed on the thin layer plate to realize effective separation from the remaining substances. This structure can capture and intercept the lectin on the surface of the thin layer plate through the specificity of the nucleic acid aptamer to the lectin, thereby realizing the enrichment of the lectin. The final beneficial result is to intercept the lectin while passing the solvent through the thin layer plate, and to obtain a high-concentration lectin sample solution after elution.

[0043] The sequence of the nucleic acid aptamer is different from the previously reported literature. First, a repeated T sequence is added, which utilizes the hydroxyl functional group and other functional groups of thymine to realize chemical adsorption on the surface of the thin layer plate, and then a repeated C sequence is used to generate a distance between the nucleic acid aptamer sequence and the thin layer plate, thereby avoiding the close proximity of the thin layer plate and the nucleic acid aptamer sequence, which reduces the binding efficiency. Finally, the sequence of the nucleic acid aptamer is also modified individually, and experiments have confirmed that the modified aptamer sequence has better binding efficiency with lectin on the thin layer plate compared to the free state.

[0044] The first nucleic acid aptamer sequence of the soybean lectin is: 5'(TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-GGTTGTGGAGGTTCTGGTTGTGGAGGTTC TGGTTGTGGAGGTTCT-3'(Seq ID NO. 1); the first nucleic acid aptamer sequence of the concanavalin A is: 5'(TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-GTTGGTTGTGGTTGTGGTTGTGGTTGTGG TTGTGGTTGTGGTTCT-3'(Seq ID NO. 2); the first nucleic acid aptamer sequence of the Vicia faba lectin is: 5'(TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-GTTGGTTGTGGTTGTGGTTCTGGTTGTGCT TGTGGTTGTGGTTGT-3'(Seq ID NO. 3); the first nucleic acid aptamer sequence of the Phaseolus vulgaris lectin is: 5'(TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-GTTCGTAGTGGTTGTGGTTGTGGTTGTGGT TGTGGTTGTGGTTGT-3'(Seq ID NO. 4); and the first nucleic acid aptamer sequence of the erythrina lectin is: 5'(TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-GTTGGTTGTCGTTGTGGTTGTGCTTGAGG TTGTGGTTGTGGTTGT-3'(Seq ID NO. 5).

[0045] For a specific medium environment, a suitable nucleic acid aptamer needs to be selected to truly improve the specific adsorption effect of the nucleic acid aptamer in the medium environment, and therefore a suitable nucleic acid aptamer for a thin layer plate must be selected. The present application improves the nucleic acid aptamer sequences of five kinds of legume lectins for the adsorption effect of the thin layer plate, so that the binding effect on the surface of the thin layer plate can be ensured, the ability to specifically adsorb specific legume lectins can be improved, and the enrichment effect of the thin layer plate can be effectively improved, thereby improving the detection sensitivity of the five kinds of legume lectins.

[0046] Further, the eluent comprises ethylene glycol monomethyl ether, sodium dihydrogen phosphate dihydrate, NaCl and a Tris buffer containing Tween 20.

[0047] In some modes, the eluent is a Tris buffer added with glycol monomethyl ether, sodium dihydrogen phosphate dihydrate, 1% NaCl, and 2% Tween 20, which is prepared with ultrapure water. The glycol monomethyl ether, sodium dihydrogen phosphate dihydrate, and ultrapure water serve to elute the legume lectin adsorbed on the thin layer plate; the 1% NaCl and 2% Tween 20 serve to push the sample liquid to be detected to run on the detection chip, and the ratio helps to control the elution speed.

[0048] The eluent can significantly improve the elution effect of legume lectin from the thin layer plate, break the hydrogen bond between the legume lectin and the nucleic acid aptamer fixed on the thin layer plate, but will not break the chemical bond between the nucleic acid aptamer and the thin layer plate, and will not elute the nucleic acid aptamer from the thin layer plate. After elution, the thin layer plate can be reused.

[0049] Further, the second nucleic acid aptamer includes a second nucleic acid aptamer that binds any one or more of soybean lectin, concanavalin A, adzuki bean lectin, phaseolus vulgaris lectin, and red bean lectin; the second nucleic acid aptamer that binds the soybean lectin, concanavalin A, adzuki bean lectin, phaseolus vulgaris lectin, and red bean lectin has a nucleotide sequence as shown in the sequence table Seq ID NO. 6-10, respectively.

[0050] The second nucleic acid aptamer sequence of the soybean lectin is: GGAGGTTCTGGTTGTGGAGGTTCTGGTTGTGGAGGTTCTGGTTGT (Seq ID NO. 6); the second nucleic acid aptamer sequence of the concanavalin A is: CGAGTAACGCTGTCTCTTCCGAATCGGGGGAAGGCGGAGGG (Seq ID NO. 7); the second nucleic acid aptamer sequence of the adzuki bean lectin is: GTTGGTTGTGCTTGTGGTTGTGGTTGTGGTAGTGGTTGTGGTTGT (Seq ID NO. 8); the second nucleic acid aptamer sequence of the phaseolus vulgaris lectin is: TGGATAATGCGCTGACACTGTCGCCTCCGATCCCAG (Seq ID NO. 9); and the second nucleic acid aptamer sequence of the red bean lectin is: GTTGGTTGTGGTTCTGGTTGTGGTAGTGGTTCTGGTTGTCGTTGT (Seq ID NO. 10).

[0051] The second nucleic acid aptamer in the electrochemical detection component is susceptible to the affinity and specificity of the nucleic acid aptamer due to the gold material background, and a more suitable nucleic acid aptamer needs to be selected to improve the effect of specific binding, so as to improve the detection sensitivity. The present application optimizes the sequence of the second nucleic acid aptamer for detecting five kinds of legume lectins respectively, and improves the accuracy and sensitivity of electrochemical detection.

[0052] Further, the multiplex detection test strip is sequentially provided with detection lines of red bean agglutinin, concanavalin agglutinin, phaseolus vulgaris agglutinin, soybean agglutinin and red bean agglutinin.

[0053] The application has been proved by research that the five test lines on the test strip are arranged in a specific order, and the red bean agglutinin antigen, the concanavalin agglutinin antigen, the phaseolus vulgaris agglutinin antigen, the soybean agglutinin antigen and the red bean agglutinin antigen are sequentially arranged from front to back after the sample enters the test strip, which can significantly reduce the mutual interference between the five kinds of legume agglutinins and improve the accuracy of detection.

[0054] In some modes, the detection device further comprises a control module, and the control module comprises a power supply device, a motor device, a control device and a display device.

[0055] The power supply device is used for power supply, and in fixed use, the power supply device is in the form of a power plug with a ground wire, and in mobile use, the power supply device is in the form of a dry battery or a storage battery.

[0056] The control device controls the electric or mechanical elements in the sample processing module, the filtering module and the detection module through the motor control device, the connecting rod and the valve.

[0057] In some modes, the control device controls the sample processing module, the eluent bin, the sample adding bin, the waste liquid bin and the collection bin through the connecting rod, so that the valves of the eluent bin and the collection bin or the valves of the sample adding bin and the waste liquid bin are simultaneously in an open state or a closed state; and the control device controls the flow state of the eluent or the legume vegetable agglutinin sample through the valve.

[0058] The display device is used for the operator to issue instructions and obtain execution results, including an elution program, a qualitative detection program and a quantitative detection program, and the working state of each part is indicated by the color of the indicator light, such as power on, standby and working.

[0059] On the other hand, the application provides a legume agglutinin detection method, which uses the detection device as described above to detect, and comprises the following steps:

[0060] (1) crushing, degreasing and extracting the sample to be detected, and collecting the crude sample;

[0061] (2) adjusting the detection device to an initial state, and the second end of the thin layer plate is higher than the first end;

[0062] (3) adding the crude sample to the sample bin;

[0063] (4) Open the sample bin and the waste liquid bin, and the target substance in the crude sample is adsorbed by the thin layer plate;

[0064] (5) Adjust the first end of the thin layer plate to be higher than the second end, and open the collection bin;

[0065] (6) Open the eluent bin, and the eluent elutes the target substance from the thin layer plate, and the collection bin collects the target sample liquid;

[0066] (7) The target sample liquid flows into the detection module for detection.

[0067] In still another aspect, the present application provides a use of an eluent for preparing a reagent for improving the elution rate of legume lectin in a thin layer plate, the thin layer plate having a nucleic acid aptamer fixed therein, the legume lectin being adsorbed by the thin layer plate through the nucleic acid aptamer; the eluent comprising ethylene glycol monomethyl ether, sodium dihydrogen phosphate dihydrate, NaCl and Tris buffer containing Tween 20; and the legume lectin comprising any one or more of soybean lectin, concanavalin A, red bean lectin, kidney bean lectin and red bean lectin.

[0068] Further, the eluent is: 3% ethylene glycol monomethyl ether, 3% sodium dihydrogen phosphate dihydrate, 1% NaCl, 2% Tween 20 Tris buffer, prepared with ultrapure water.

[0069] In still another aspect, the present application provides a method for adsorbing legume lectin based on a thin layer plate, the method comprising fixing a nucleic acid aptamer of legume lectin on a thin layer plate, and then using the thin layer plate to adsorb legume lectin in a target sample, the legume lectin comprising any one or more of soybean lectin, concanavalin A, red bean lectin, kidney bean lectin and red bean lectin; and the nucleic acid aptamer comprising a first nucleic acid aptamer that binds any one or more of soybean lectin, concanavalin A, red bean lectin, kidney bean lectin and red bean lectin.

[0070] In still another aspect, the present application provides a use of a nucleic acid aptamer for preparing a reagent for improving the adsorption effect of a thin layer plate on a filter core, the legume lectin comprising any one or more of soybean lectin, concanavalin A, red bean lectin, kidney bean lectin and red bean lectin; and the nucleic acid aptamer having a nucleotide sequence as shown in any one or more of the sequences in the sequence table Seq ID NO. 1-5.

[0071] The present application has the following beneficial effects:

[0072] 1. By fixing specific nucleic acid aptamers on a thin layer plate, the function of specific adsorption of multiple target substances is realized, ensuring that the target substances in the liquid sample can be fully extracted, and the reliability of subsequent detection is improved;

[0073] 2. The method can simultaneously detect five kinds of legume lectins in legume vegetables, including soybean lectin, jack bean lectin, red bean lectin, kidney bean lectin and red bean lectin;

[0074] 3. The sequence of -(TTTTTTTTTT)-(CCCCCCCCCCCCCCC)- is added to the 5' end of the five nucleic acid aptamers, which does not recognize any target analyte and does not produce a self-folding secondary structure; wherein

[0075] -(TTTTTTTTTT)- The nucleic acid aptamer is physically adsorbed and fixed in the thin layer plate and can be eluted by the eluent;

[0076] -(CCCCCCCCCCCCCCC)- The distance from the filter core surface avoids the destruction of the effective sequence;

[0077] 4. The sequence of the nucleic acid aptamer fixed on the thin layer plate is optimized, so that it can more efficiently and specifically adsorb and enrich the five kinds of legume lectins in the sample liquid;

[0078] 5. The most suitable eluent formula is screened, which can significantly improve the elution effect of the target analyte from the thin layer plate, destroy the connecting hydrogen bond between the target analyte and the nucleic acid aptamer, but will not destroy the chemical bond between the nucleic acid aptamer and the thin layer plate, and will not elute the nucleic acid aptamer from the thin layer plate. After elution, the thin layer plate can be reused;

[0079] 6. The nucleic acid aptamer sequence for electrochemical detection of legume lectins is optimized to improve the accuracy and sensitivity of the detection;

[0080] 7. Multi-channel detection chip, using the same sample liquid to detect five kinds of legume lectins at the same time, shortening the detection time, saving the detection sample, and improving the result rigor;

[0081] 8. By combining test strips and electrochemical technology, the target analyte is first qualitatively and semi-quantitatively detected, and then quantitatively detected according to the detection result, avoiding the blindness of detection;

[0082] 9. Simple structure, convenient and efficient detection, and can ensure the accuracy of the detection result. BRIEF DESCRIPTION OF DRAWINGS

[0083] Figure 1 It is a schematic diagram of the appearance of the detection device;

[0084] Figure 2 It is a sectional view of the detection device;

[0085] Figure 3 It is a top view of the detection device;

[0086] Figure 4 It is a schematic diagram of the use process of the detection device;

[0087] Figure 5 This is a schematic diagram illustrating the process by which nucleic acid aptamers intercept legume lectins in thin-layer chromatography.

[0088] Figure 6 This is a schematic diagram of the chip structure for testing;

[0089] Figure 7 This is a schematic diagram of the structure of a multiplex test strip;

[0090] Figure 8 This is a schematic diagram of the electrochemical detection component. Detailed Implementation

[0091] The preferred embodiments of the present invention will be described in further detail below with reference to the accompanying drawings. It should be noted that the following embodiments are intended to facilitate understanding of the present invention and are not intended to limit it in any way. The raw materials and equipment used in the specific embodiments of the present invention are all known products and were obtained by purchasing commercially available products.

[0092] In the description of this invention, it should be understood that the terms "upper," "lower," "front," "rear," "left," "right," "vertical," "horizontal," "top," "bottom," "inner," and "outer," etc., indicate the orientation or positional relationship based on the orientation or positional relationship shown in the accompanying drawings. They are used only for the convenience of describing the invention and for simplifying the description, and do not indicate or imply that the device or element referred to must have a specific orientation, or be constructed and operated in a specific orientation. Therefore, they should not be construed as limitations on the invention. Furthermore, the terms "first," "second," etc., are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of indicated technical features. Thus, a feature defined with "first," "second," etc., may explicitly or implicitly include one or more of that feature. In the description of this invention, unless otherwise stated, "a plurality of" means two or more.

[0093] In the description of this invention, it should be noted that, unless otherwise explicitly specified and limited, the terms "connected" and "linked" should be interpreted broadly. For example, they can refer to a fixed connection, a detachable connection, or an integral connection; they can refer to a mechanical connection or an electrical connection; they can refer to a direct connection or an indirect connection through an intermediate medium; and they can refer to the internal connection of two components. Those skilled in the art will understand the specific meaning of the above terms in this invention based on the specific circumstances.

[0094] Example 1: The detection equipment provided by the present invention

[0095] The detection device 1 provided in this embodiment is as follows: Figures 1-3 As shown, where Figure 1 This is a schematic diagram of the appearance of the testing equipment.Figure 2 for detecting a profile view of the device, Figure 3 for detecting a plan view of the device. The detection device 1 comprises a pre-processing module 2 and a detection module 3. The pre-processing module 2 comprises an enrichment medium 4, in which nucleic acid aptamers 5 capable of adsorbing target analytes are fixed, for enriching target analytes and obtaining a sample liquid to be tested; the detection module 3 is used for detecting the target analytes in the sample liquid to be tested. The enrichment medium 4 refers to a solid-phase medium capable of intercepting, adsorbing or capturing target analytes from a sample, including thin layer plates, filter plates, resins, etc. For liquid samples with good flowability, any one of thin layer plates, filter plates, resins can be selected as the enrichment medium; for samples with poor flowability, thin layer plates are preferred as the enrichment medium, which can more efficiently enrich target analytes. In this embodiment, the enrichment medium 4 preferably adopts a thin layer plate 6.

[0096] As Figure 4 , the thin layer plate 6 comprises a first end 7 and a second end 8; the thin layer plate 6 is placed obliquely with one end downward, and the downward end can automatically switch between the first end 7 and the second end 8. The thin layer plate 6 is a thin layer plate used in thin layer chromatography, which is made of polyester film uniformly coated on a 2mm thick acrylic plate, and the top is coated with nucleic acid aptamers capable of adsorbing target analytes. In this embodiment, the target analytes are five kinds of legume lectins, and the thin layer plate 6 is more conducive to the adsorption of legume lectin proteins. However, it should be understood that the detection device 1 provided in this embodiment can be applied to any target analyte, as long as a suitable nucleic acid aptamer is screened for the target analyte and fixed on the enrichment medium 4, which can be used to enrich and detect the target analyte. The thin layer plate 6 is fixed by using a plastic material such as silica gel resin, so that the thin layer plate 6 is fixed in the detection device 1, and the left and right ends of the thin layer plate 6 can be moved up and down to change the inclination angle by using a motor. The inclination angle is 20-30 degrees, which is more conducive to the enrichment and elution of legume lectins. The thin layer plate 6 can be reused or replaced. The first end 7 of the thin layer plate 6 is provided with a waste liquid bin 9, and when the first end 7 is downward, the waste liquid bin 9 is used to collect the waste liquid after adsorption; the second end 8 of the thin layer plate 6 is provided with a collection bin 10, and when the second end 8 is downward, the collection bin 10 is used to collect the sample liquid to be tested; a waste liquid bin one-way valve 11 is arranged at the inlet of the waste liquid bin 9, and a collection bin one-way valve 12 is arranged at the inlet of the collection bin 10. The one-way valve can allow liquid to flow into the collection bin 10 and the waste liquid bin 9 in one direction, while preventing liquid from leaving, thereby avoiding contamination of the sample. The waste liquid bin 9 is used to collect the waste liquid after the crude extract liquid is filtered through the thin layer plate, and is located at the lower left of the thin layer plate 6. After the process is completed, the waste liquid bin 9 can be pulled out to pour out the waste liquid. The collection bin 10 is connected to the detection module 3, and the collected sample liquid to be tested is sent to the detection module 3 for detection.

[0097] The pre-treatment module 2 further comprises a sample tank 13 and an eluent tank 14, the eluent tank 14 being used to elute the sample to be detected from the thin layer plate 6 to obtain the sample liquid to be detected; the sample tank 13 is provided with a sample tank valve 15 below, and the eluent tank 14 is provided with an eluent tank valve 16 below; the sample tank valve 15 and the waste tank one-way valve 11 are opened simultaneously; the eluent tank valve 16 and the collection tank one-way valve 12 are opened simultaneously. The sample tank 13 and the eluent tank 14 are both located above the detection device 1 and are groove bodies capable of containing liquid, and are separately arranged at two positions, for example, the sample tank 13 is arranged at one end and the eluent tank 14 is arranged at the other end. The sample tank 13 can be added with sample crude extract liquid to be detected, such as crude liquid sample obtained by preliminary pretreatment of the sample to be detected. The eluent tank 13 can be pre-stored with eluent for eluting the target sample to be detected from the thin layer plate 6. The sample crude extract liquid can be selected according to different samples. In this embodiment, for legume vegetables, the method for obtaining the sample crude extract liquid can be as follows: the legume vegetables are ground and crushed, sieved, defatted twice with petroleum ether, air-dried, extracted three times with ice-cold brine in a low-temperature environment, the extracted liquid is mixed, the supernatant is taken, ammonium sulfate and ammonia water are added in sequence, and the sample crude extract liquid is obtained by centrifugation and collection of the precipitate.

[0098] Preferably, the sample tank 13 and the eluent tank 14 are made of light-proof material and are used to store the sample crude extract liquid and the quantitative eluent, so as to avoid decomposition of the surfactant component under light. Meanwhile, the sample tank 13 and the eluent tank 14 are respectively provided with valves below, and the flow of the sample liquid and the eluent is controlled by a control device, so as to complete the adsorption and elution of the target sample to be detected on the thin layer plate 6 and obtain the sample liquid to be detected. The valves and the one-way valves are used to control the flow direction of the filtered or eluted liquid. In the initial state, the sample tank valve 15 and the waste tank one-way valve 11 are opened simultaneously, and the liquid flows into the waste tank 9 after being enriched by the thin layer plate; in the starting state, the eluent tank valve 16 and the collection tank one-way valve 12 are opened simultaneously, and the eluted liquid flows into the collection tank 10.

[0099] As Figures 6-8The detection module 3 comprises electrochemical detection components 18, the number of which is one or more groups (five groups in this example), each group of electrochemical detection components 18 being used to detect one target analyte; each group of electrochemical detection components 18 comprises a working electrode 19 and a probe, the probe comprising a second nucleic acid aptamer for capturing the target analyte. The detection module 3 further comprises a microfluidic channel 22 and a test strip 23, the microfluidic channel 22 being used to divide the sample liquid to be detected; the test strip 23 is a multiplex detection test strip coated with an antibody of the target analyte. Preferably, the detection module 3 is provided with a detection port 17, a camera 24, a detection chip 25, and an electrochemical socket 26. The detection port 17 is tightly connected to the collection bin 10 and the detection chip 25, and the diameter is consistent with the sample addition port 27 of the detection chip 25, so that the sample liquid to be detected is completely transferred to the detection chip 25, and the detection process is completed.

[0100] As Figure 6 The detection chip 25 comprises a chip top plate 28, a sample addition port 27, a microfluidic channel 22, a test strip 23, electrochemical detection components 18, and a chip bottom plate 29. The test strip 23 is a multiplex detection test strip that can simultaneously detect five different target analytes. In addition, the detection chip 25 further comprises a test strip groove 30, an electrochemical detection groove 31, and a screen-printed electrode 32. The chip top plate 28 comprises a top plate 33 and a detection window 34; the top plate 33 is a hard transparent plastic plate used to seal the detection chip 25 to prevent aerosol pollution; the detection window 34 is a transparent plastic sheet with a size that can contain the T line 35 and the C line 36 of the test strip T, and is used for scanning by the camera 24; the microfluidic channel 22 is a micron-level groove in the shape of F, which is used to divide the sample liquid to be detected, and the linear end is connected to the sample addition port 27, and the bifurcated end is respectively connected to the corresponding test strip groove 30 and electrochemical detection groove 31. The test strip groove 30 is a groove for placing the test strip 23, which is connected to the microfluidic channel 22, and the test strip 23 can be replaced through the groove after the detection is completed, so that the single detection chip 25 can be used multiple times; the electrochemical detection groove 31 is used to place the electrochemical detection components 18. The test strip 23 is used to complete the preliminary detection of the sample liquid to be detected. The test strip 23 is composed of a sample pad 37, a label pad 38, a chromatographic membrane 39, and a water-absorbing pad 40; the materials of the sample pad 37 and the label pad 38 are mainly selected from glass fiber materials, non-woven fabrics, or filter paper; the water-absorbing pad 40 is filter paper; the chromatographic membrane 39 is an NC nitrocellulose membrane pre-embedded with five detection lines (T lines) 35 and one quality control line (C line) 36; the five target analyte artificial antigens are used as the detection lines 35, and the goat anti-mouse secondary antibody is used as the quality control line 36; the chromatographic membrane is attached to the sample pad 37 and the label pad 38 at the upper end, and is attached to the water-absorbing pad 40 at the lower end, and the parts are connected to complete the connection. Preferably, the C line 36 is separated from the T line 35 by 30 mm, each T line 35 is separated by 10 mm, and the C line 36 and the T line 35 are 5 mm wide.

[0101] The camera 24 is used to scan the color change of the detection line (T line) 35 and the quality control line (C line) 36 on the test strip 23 in the detection window 34, and the chroma value is transmitted back to the mobile terminal through Bluetooth or wireless network for data processing and result analysis, so as to complete the qualitative and semi-quantitative judgment of the sample liquid to be tested and realize preliminary detection. The chroma value detection threshold is set for the five target test objects, and if the chroma value of a certain target test object in the sample liquid to be tested exceeds the detection threshold, electrochemical quantitative detection of the target test object is performed for accurate analysis. The camera 24 is located below the motor and above the chip detection window 34.

[0102] The electrochemical detection groove 31 is provided with an electromagnetic valve 41 and a groove 42 for placing the screen-printed electrode 32 to complete quantitative detection. The electromagnetic valve 41 is used to control the flow of the sample liquid to be tested. The groove 42 is five parallel grooves connected with the microchannel 22, and the liquid is controlled to enter by the electromagnetic valve 41 to complete the quantitative detection of the sample liquid to be tested. The screen-printed electrode 32 provides a portable and high-precision three-electrode system, which can complete the quantitative detection of the target test object by inserting the electrochemical socket 43, and is composed of a working electrode 19, a counter electrode 44, a reference electrode 45 and a probe. The working electrode 19 is a working electrode coated with graphene with special electrical properties on the surface by deposition, plating and the like, and the base material can be selected from glass fiber material, non-woven fabric or filter paper. The unquantifiable biological reaction is converted into a quantifiable electrical signal by detecting the change of the electrical property of the working electrode 19. The counter electrode 44 forms a loop with the working electrode 19 through the solution to provide a channel for electron transfer in the electrochemical detection process, and the base material is the same as the working electrode 19. The reference electrode 45 is an Ag / AgCl reference electrode, which forms a loop with the working electrode 19 through the solution to calibrate the electrode potential and improve the accuracy of electrochemical detection. The probe is an aptamer, which captures the target test object to the surface of the working electrode 19 to change the electrical property of the working electrode 19.

[0103] The chip bottom plate 29 includes a bottom plate 46 and an electrode interface 47. The bottom plate 46 is a PVC bottom plate supporting the chip, and each part is assembled on the bottom plate 46. The electrode interface 47 is located in the area of the bottom plate 46 below the screen-printed electrode 32, and there are 15 electrode interfaces 47 for connecting the electrochemical socket 26. The electrochemical socket 26 completes quantitative detection through the electrode interface 47.

[0104] The target sequence in this embodiment is CCCCCCCCCC)-GTTGGTTGTGGTTGTGGTTGTGGTTGTGGTTGTGGTTGTGGTTCT-3' (Seq ID NO.2); the first nucleic acid aptamer sequence of the adzuki bean lectin is: 5'(TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-GTTGGTTGTGGTTGTGGTTCTGGTTGTGCTTGTGGTTGTGGTTGT-3' (Seq ID NO.3); the first nucleic acid aptamer sequence of the common bean lectin is: 5'(TTTTTTTTTT)-(CCCCCCCCCCCCCC)-GTTCGTAGTGGTTGTGGTTGTGGTTGGTTGTGGTTGTGGTTGGTTGT-3' (Seq ID NO.4); the first nucleic acid aptamer sequence of the red bean lectin is: 5'(TTTTTTTTTT)-(CCCCCCCCCCCCCC)-GTTGGTTGTCGTTGTGGTTGTGCTTGAGGTTGTGGTTGTGGTTGT-3' (Seq ID NO.4). NO.5).

[0105] like Figure 5 Five aptamers 5 representing legume lectins were pre-immobilized on a thin-layer plate 6. After recognizing and binding to their respective lectins 48, these aptamers adsorbed onto the thin-layer plate 6, achieving effective separation from other substances. This structure enables the specific capture and retention of lectin 48 by the aptamer 5 on the surface of the thin-layer plate 6, thereby enriching the lectins. The beneficial result is that the solvent passes through the thin-layer plate 6 while retaining the lectins, yielding a high-concentration lectin sample solution after elution. The sequence of the aptamer 5 differs from previously reported literature. First, a repeating T sequence is added, utilizing the hydroxyl and other functional groups of thymine to achieve chemisorption on the surface of the thin-layer plate 6. Subsequently, a repeating C sequence is used to create distance between the aptamer sequence and the thin-layer plate 6, preventing the thin-layer plate 6 from being too close to the aptamer sequence, which would reduce the binding efficiency. Finally, the sequence of nucleic acid aptamer 5 was modified with a few bases. Experiments confirmed that the modified aptamer sequence had better binding efficiency with lectins on thin-layer plate 6 compared to the free state. For specific media environments, it is necessary to select appropriate nucleic acid aptamers to truly improve the specific adsorption effect of the aptamers in that environment. Therefore, for thin-layer plate 6, it is essential to select nucleic acid aptamers suitable for thin-layer plate 6. To improve the adsorption effect of thin-layer plate 6, the nucleic acid aptamer sequences of five legume lectins were improved, ensuring both binding effectiveness on the surface of thin-layer plate 6 and enhancing the ability to specifically adsorb specific legume lectins. This effectively improves the enrichment effect of thin-layer plate 6, thereby increasing the detection sensitivity of the five legume lectins.

[0106] The eluent in the embodiment is: 3% ethylene glycol monomethyl ether, 3% sodium dihydrogen phosphate dihydrate, 1% NaCl, 2% Tween 20 in Tris buffer, prepared with ultrapure water. The functions of ethylene glycol monomethyl ether, sodium dihydrogen phosphate dihydrate and ultrapure water are to elute the adsorbed legume lectin on the thin layer plate; 1% NaCl, 2% Tween 20 functions to push the sample liquid to be tested to run on the detection chip. The eluent can significantly improve the effect of eluting legume lectin from the thin layer plate 6, destroy the hydrogen bond between legume lectin and the immobilized nucleic acid aptamer 5 in the thin layer plate 6, but will not destroy the chemical bond between the nucleic acid aptamer 5 and the thin layer plate 6, and will not elute the nucleic acid aptamer 5 from the thin layer plate 6. After elution, the thin layer plate 6 can be reused.

[0107] The second nucleic acid aptamer 21 in the embodiment includes a second nucleic acid aptamer that binds any one or more of soybean lectin, concanavalin A, red bean lectin, phaseolus vulgaris lectin and red bean lectin; wherein the second nucleic acid aptamer sequence of soybean lectin is: GGAGGTTCTGGTTGTGGAGGTTCTGGTTGTGGAGGTTCTGGTTGT (Seq ID NO. 6); the second nucleic acid aptamer sequence of concanavalin A is: CGAGTAACGCTGTCTCTTCCGAATCGGGGGAAGGCGGAGGG (Seq ID NO. 7); the second nucleic acid aptamer sequence of red bean lectin is: GTTGGTTGTGCTTGTGGTTGTGGTTGTGGTAGTGGTTGTGGTTGT (Seq ID NO. 8); the second nucleic acid aptamer sequence of phaseolus vulgaris lectin is: TGGATAATGCGCTGACACTGTCGCCTCCGATCCCAG (Seq ID NO. 9); and the second nucleic acid aptamer sequence of red bean lectin is: GTTGGTTGTGGTTCTGGTTGTGGTAGTGGTTCTGGTTGTCGTTGT (Seq ID NO. 10). The second nucleic acid aptamer in the electrochemical detection component 18 is gold material, which can affect the affinity and specificity of the nucleic acid aptamer. Therefore, a more suitable nucleic acid aptamer needs to be selected to improve the effect of specific binding, so as to improve the detection sensitivity. Therefore, the sequence of the second nucleic acid aptamer for detecting five kinds of legume lectins respectively is optimized, and the accuracy and sensitivity of electrochemical detection are improved.

[0108] Preferably, the test strip 23 is provided with red bean agglutinin detection line 49, concanavalin detection line 50, phaseolus vulgaris detection line 51, soybean agglutinin detection line 52, and red bean agglutinin detection line 53 in sequence. The five test lines on the test strip 23 are arranged in a specific order, from front to back in the order of red bean agglutinin antigen, concanavalin antigen, phaseolus vulgaris antigen, soybean agglutinin antigen, and red bean agglutinin antigen after the sample enters the test strip 23, which can significantly reduce the mutual interference between the five kinds of legume agglutinins and improve the accuracy of detection.

[0109] In addition, the detection device 1 also includes a control module 54, which includes a power supply device 56, a motor device, a control device, and a display device 55. The power supply device 56 is used for power supply, and in fixed use, it is in the form of a power plug with a ground wire, and in mobile use, it is in the form of a dry battery or a storage battery. The motor device is used to provide power, and the up and down movement of the thin layer plate at both ends is realized by a stepping motor. The control device controls the electric or mechanical elements in the sample processing module, the filtration module, and the detection module through the motor control device, the connecting rod, and the valve. The control device realizes the linkage control of the sample processing module eluent bin, the sample addition bin, the waste liquid bin, and the collection bin through the connecting rod, so that the valves of the eluent bin and the collection bin or the valves of the sample addition bin and the waste liquid bin are in the same open or closed state; the flow state of the eluent or legume agglutinin sample is controlled through the valve. The display device 55 is used for the operator to issue instructions and obtain execution results, including elution program, qualitative detection program, quantitative detection program, and the working state of each part is indicated by the color of the indicator light.

[0110] Example 2, detection method

[0111] This embodiment uses the detection device 1 provided in example 1 to detect the agglutinin in legume vegetables, which specifically includes the following steps:

[0112] I) sample pretreatment

[0113] 1. Turn on the switch of the power supply device in the control module 54 to power on the device, and wait for the indicator light of the display device 55 to light up to indicate that the detection device 1 is turned on.

[0114] 2. After grinding and crushing the sample (such as 10g of soybeans), sieve it, immerse the powder in petroleum ether, and perform degreasing through filtration and centrifugation. After degreasing twice, dry it in a low-temperature environment (4℃), and extract it three times with ice-cold saline (0.1-0.2mol / L NaCl solution) in a low-temperature environment (4℃). After mixing the extract, take all the supernatant, add 10ml of 30% ammonium sulfate and 3ml of 1mol / L ammonia water, and then stand it. After centrifugation, collect the precipitate to obtain about 1g of sticky paste-like agglutinin crude sample.

[0115] 3、Thin layer plate 6 left and right sides of the motor start to run to make the thin layer plate 6 right end higher than the left end of 20 degrees tilt angle. 1g paste agglutinin crude sample is added to the sample bin 13, and the sample bin 13 is added to the thin layer plate 6, and the valve of the sample bin 13 and the waste liquid bin 14 is opened, and the crude sample is enriched by the aptamer 5 on the thin layer plate 6 and flows into the waste liquid bin 9.

[0116] 4、The eluent is added to the eluent bin 14, and the left and right sides of the motor of the thin layer plate 6 start to run to make the left end of the thin layer plate 6 higher than the right end of 20 degrees tilt angle. The valve of the eluent bin 14 and the collection bin 10 is opened, and the eluent flows through the thin layer plate 6, elutes the agglutinin attached to the aptamer, flows into the collection bin 10, and obtains 2ml agglutinin detection sample liquid.

[0117] II) Sample detection

[0118] 1、Qualitative detection

[0119] 1) Five kinds of agglutinin multiple test strips 23 are put into the test strip slot 30, the assembly of the detection chip 25 is completed, the sample inlet 27 of the detection chip 25 is attached to the detection port 17 at the bottom of the collection bin 10, and the chip bottom plate 29 is attached to the electrochemical socket 43.

[0120] 2) The 2ml agglutinin detection sample liquid obtained in step 1) is stored in the collection bin 10, and the "qualitative detection program" is started through the display device 55, the valve is opened, the agglutinin sample liquid flows into the detection chip 25, and is evenly divided into the test strip slot 30 and the electrochemical slot 31 through the microchannel 22, and the test strip 23 flows into 1ml agglutinin sample liquid.

[0121] 3) The camera 24 is powered on and started, and the scanning function is controlled by the mobile terminal. The color development time of the test strip 23 is 3-5 minutes, and whether the color of the T line 35 and the C line 36 changes can be directly observed through the camera 24, and the qualitative detection is completed. The appearance of T line 35 and C line 36 at the same time indicates that the agglutinin sample liquid contains the agglutinin to be detected; only the appearance of C line 36 indicates that the agglutinin sample liquid does not contain the agglutinin; the non-appearance of C line 36 indicates that the test result of the test strip 23 is invalid. After the detection result of T line 35 and C line 36 appears, the camera 24 is used for scanning, the colorimetric value result of scanning is transmitted to the mobile terminal through Bluetooth or wireless network, the data is analyzed according to the colorimetric-concentration standard curve, and the semi-quantitative detection is completed.

[0122] 2、Quantitative detection

[0123] 1) After the semi-quantitative detection is completed, the colorimetric value of a certain kind of legume agglutinin exceeds the threshold range, and the electrochemical quantitative detection of the legume agglutinin is carried out.

[0124] 2) Start the "quantitative detection program" by the display device 55, open the electromagnetic valve 41 corresponding to the kind of lectin, 1ml sample liquid flows into the electrochemical detection cell 31, and electrochemical analysis is carried out to complete the quantitative detection of the sample liquid.

[0125] Example 3, influence of different enrichment methods on detection results

[0126] Different enrichment methods will directly affect the extraction and detection effect of lectin in legume vegetables. In this embodiment, 10g of soybeans are detected using the detection equipment provided in Example 1. The thin layer plate is treated in the following three ways: 1. Directly use the untreated thin layer plate; 2. Use the thin layer plate on which five kinds of lectin antibodies (20cm 2 The surface of the thin layer plate is uniformly coated with 0.5% to 2% glutaraldehyde, which is first coated on the thin layer plate and placed for 2 hours, and then 1mL of 0.5mol / L antibody solution with a total concentration is coated, completing the glutaraldehyde cross-linking method fixation. The concentration of each antibody in the antibody solution is 0.1mol / L); 3. Use the thin layer plate on which the first nucleic acid aptamer of five kinds of lectin (20cm 2 The surface of the thin layer plate is uniformly coated with 1ml of nucleic acid aptamer solution, and the concentration of each nucleic acid aptamer in the nucleic acid aptamer solution is 20μmol / L). Then the test strip and the electrochemical detection component of the detection module are detected respectively, and the detection method is as shown in Example 2. The detection results are shown in Table 1.

[0127] Table 1, influence of different enrichment methods on detection results

[0128]

[0129] According to Table 1, compared with the first to third groups, compared with the untreated thin layer plate, the antibodies fixed on the thin layer plate or the first nucleic acid aptamer of the target to be detected can significantly improve the extraction effect of the target to be detected from the sample.

[0130] At the same time, compared with the second and third ways, compared with the way of fixing antibodies on the thin layer plate, the way of fixing nucleic acid aptamer on the thin layer plate has better extraction effect and can detect more kinds and contents of lectin. The reason may be that the nucleic acid aptamer is smaller in volume and can form an orderly nucleic acid aptamer tentacle after being fixed on the thin layer plate to capture the target to be detected; while the antibody protein molecule is larger and more chaotic after being fixed. Because the antibodies are fixed on the surface of the thin layer plate in a random arrangement, after being fixed by cross-linking, the orientations of different antibodies are different. When the effective binding sites on the surface of the antibody face down, the capture efficiency of the thin layer plate is reduced. The fixation of the nucleic acid aptamer is carried out by physical repair of the fixed base arrangement at one end to ensure the fixed direction, so that it has better combination efficiency with the target and the capture effect is obviously better than that of the antibody.

[0131] Example 4, Sequence improvement of the first aptamer immobilized on the thin layer plate

[0132] 1. Adding specific sequence

[0133] This example is to make the first aptamer more firmly immobilized on the thin layer plate (the material of the thin layer plate is polyester), and to increase the immobilization effect of the first aptamer by adding specific sequence at the 5' end of the aptamer, while ensuring that the adsorption of the target analyte will not be affected. The sequence of the first aptamer is shown in Table 2, and the trend of the aptamer of different legume lectins is consistent. This example uses the first aptamer sequence of concanavalin A for research, which is immobilized on the thin layer plate as described in Example 1. The sample contains a solution of concanavalin A with a concentration of 60 (μg / mL), and the sample is pretreated, eluted and detected by the method provided in Example 2. After elution, the same sample is pretreated, eluted and detected again, and the detection results of the filter core reused twice are investigated. The results are shown in Table 2.

[0134] Table 2, First aptamer with added specific sequence

[0135]

[0136] As can be seen from Table 2, when the 5' end of the first aptamer has no added sequence, its immobilization effect is poor, resulting in poor adsorption and extraction efficiency. Moreover, when the thin layer plate is reused for the second time, since the first aptamer has been completely eluted, only part of the concanavalin A remaining on the thin layer plate can be detected.

[0137] Most preferably, the sequence (TTTTTTTTTT)-(CCCCCCCCCCCCCCC) is added to the 5' end of the first aptamer, which has the highest detection accuracy and the thin layer plate can be reused. Compared with the sequence (TTTTTTTTTT)- and (TTTTTTTTTT)-(CCCCCCCC)- added to the 5' end of the first aptamer, the adsorption and extraction efficiency of concanavalin A can be improved, thereby improving the detection accuracy. Although the first detection result is also relatively accurate when the sequence (AAAAAAAAAA)-(CCCCCCCCCCCCCCC) is added to the 5' end or the sequence (TTTTTTTTTT)-(GGGGGGGGGGGGGGG) is added to the 5' end, the detection accuracy decreases when reused for the second time. The reason may be that part of the first aptamer has poor immobilization effect and is eluted together with the eluent, resulting in a decrease in enrichment effect.

[0138] 2. Optimization of the sequence of the first aptamer

[0139] The first nucleic acid aptamer sequences of five kinds of legume lectins are optimized respectively in this embodiment to improve the specific adsorption and extraction effect of legume lectins. The first nucleic acid aptamer sequences of five kinds of legume lectins before and after optimization are shown in Tables 3 and 4 respectively. The samples contain 30 (μg / mL) of soybean lectin, 30 (μg / mL) of concanavalin A, 30 (μg / mL) of red bean lectin, 30 (μg / mL) of kidney bean lectin, and 30 (μg / mL) of red bean lectin. The sample is filtered, eluted and detected by the method provided in Example 2, and the electrochemical detection results are converted into specific concentration content by preparing a standard curve. The detection results are shown in Table 3.

[0140] Table 3, optimization of first nucleic acid aptamer sequence

[0141]

[0142] According to Table 3, the first nucleic acid aptamer sequences of five kinds of legume lectins are optimized in this embodiment. The optimized first nucleic acid aptamer can improve the specific adsorption and extraction effect of five kinds of legume lectins, and can significantly improve the accuracy of the detection results.

[0143] Example 5, effect of different eluents on detection results

[0144] Different eluents will also directly affect the elution effect of legume lectins in the thin layer plate, and will also affect the reuse effect of the thin layer plate. In this embodiment, 10g of soybean is detected by the detection equipment provided in Example 1. The eluents are five kinds of eluents in Table 4. The detection results are detected by the test paper and electrochemical detection layer of the detection module. The detection results are taken as an example of soybean lectin. The detection method is as described in Example 2. The detection results are shown in Table 4.

[0145] Table 4, effect of different eluents on detection results

[0146]

[0147] According to Table 4, the elution effect of different eluents is obviously different. The most preferred is the eluent of the third group, which has the highest elution efficiency for legume lectins in the thin layer plate. Moreover, the thin layer plate after elution can be reused. It can be seen that it can elute legume lectins from the first nucleic acid aptamer, but will not destroy the chemical bond between the first nucleic acid aptamer and the thin layer plate.

[0148] However, if a strong eluent is used to elute the first nucleic acid aptamer from the thin layer plate, the thin layer plate cannot be reused. The eluent provided in this embodiment is helpful for the reuse of the thin layer plate, especially the third group, which can also improve the accuracy of the detection results.

[0149] Example 6, Influence of the order of detection lines in the multiplex test strip on the qualitative detection result

[0150] In this example, the multiplex test strip provided in Example 1 was used to qualitatively detect samples containing five kinds of legume lectins, wherein the samples contained soybean lectin at a concentration of 10 (μg / mL), concanavalin A at a concentration of 10 (μg / mL), mung bean lectin at a concentration of 10 (μg / mL), kidney bean lectin at a concentration of 10 (μg / mL), and red bean lectin at a concentration of 10 (μg / mL). The order of the detection lines in the multiplex test strip was as shown in Table 5. The detection results when different orders were used in the multiplex test strip were investigated.

[0151] Table 5, Influence of the order of detection lines on the detection result

[0152]

[0153]

[0154] As can be seen from Table 5, red bean lectin is most easily affected by the other four kinds of legume lectins. The red bean lectin detection line must be placed first. If it is placed further back, the detection result of the test strip will directly change from positive to weak positive or negative. At the same time, if the concanavalin A detection line is placed in a rear position, weak positive phenomenon is also likely to occur. Therefore, the order of the detection lines in the multiplex test strip must be red bean lectin detection line, concanavalin A detection line, kidney bean lectin detection line, soybean lectin detection line, and mung bean lectin detection line.

[0155] Example 7, Optimization of the second aptamer sequence in electrochemical detection

[0156] In this example, the second aptamer sequences of five kinds of legume lectins were optimized to improve the detection accuracy and sensitivity of the target legume lectins. The second aptamer sequences of the five kinds of legume lectins before and after optimization are shown in Table 6. The second aptamer sequences were immobilized on the thin layer plates as described in Example 1. The samples contained soybean lectin at a concentration of 30 (μg / mL), concanavalin A at a concentration of 30 (μg / mL), mung bean lectin at a concentration of 30 (μg / mL), kidney bean lectin at a concentration of 30 (μg / mL), and red bean lectin at a concentration of 30 (μg / mL). The sample detection was performed using the electrochemical detection component provided in Example 1. The electrochemical detection results were converted into specific concentration contents by preparing a standard curve, and the results are shown in Table 6.

[0157] Table 6, Optimization of the second aptamer sequence

[0158]

[0159]

[0160] According to Table 6, it can be seen that the second nucleic acid aptamer after optimization can improve the detection accuracy of each legume lectin compared with the second nucleic acid aptamer before optimization.

[0161] The technical features of the above-described embodiments can be combined in any manner. In order to make the description concise, not all possible combinations of the technical features in the above-described embodiments are described, however, as long as the combinations of the technical features do not exist contradictions, they should be considered as the scope of the present disclosure. Although the present disclosure is disclosed as above, the present disclosure is not limited thereto. The scope of the present disclosure can be extended as long as it is within the scope of the application. Any person skilled in the art can make various modifications and changes without departing from the spirit and scope of the present disclosure, and therefore, the scope of the present disclosure should be defined by the scope of the claims.

[0162] The contents of the articles, patents, patent applications, and all other documents and electronically available information described or cited herein are hereby incorporated by reference in their entirety as if each individual publication were specifically and individually indicated to be incorporated by reference. Applicants reserve the right to publish any of the above-referenced articles, patents, patent applications, and other documents or electronically available information at any time in the future.

[0163] SEQUENCE LIST

[0164] Seq ID NO. 1

[0165] The first nucleic acid aptamer sequence of soybean lectin: 5' (TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-GGTTGTGGAGGTTCTGGTTGTGGAGGTTCTGGTTGTGGAGGTTCT-3'

[0166] Seq ID NO. 2

[0167] The first nucleic acid aptamer sequence of concanavalin A: 5' (TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-GTTGGTTGTGGTTGTGGTTGTGGTTGTGGTTGTGGTTGTGGTTGTGGTTGTGGTTCT-3'

[0168] Seq ID NO. 3

[0169] The first nucleic acid aptamer sequence of red bean lectin: 5' (TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-GTTGGTTGTGGTTGTGGTTCTGGTTGTGCTTGTGGTTGTGGTTGT-3'

[0170] Seq ID NO. 4

[0171] First nucleic acid aptamer sequence of Phaseolus vulgaris agglutinin: 5' (TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-GTTCGTAGTGGTTGTG GTTGTGGTTGTGGTTGTGGTTGTGGTTGT-3'

[0172] Seq ID NO. 5

[0173] First nucleic acid aptamer sequence of Phaseolus vulgaris agglutinin: 5' (TTTTTTTTTT)-(CCCCCCCCCCCCCCC)-GTTCGTAGTGGTTGTG GTTGTGGTTGTGGTTGTGGTTGTGGTTGT-3'

[0174] Seq ID NO. 6

[0175] Second nucleic acid aptamer sequence of Phaseolus vulgaris agglutinin: GGAGGTTCTGGTTGTGGAGGTTCTGGTTGTGGAGGTTCTGG TTGT;

[0176] Seq ID NO. 7

[0177] Second nucleic acid aptamer sequence of Phaseolus vulgaris agglutinin: CGAGTAACGCTGTCTCTTCCGAATCGGGGGAAGGCGGAGGG; Seq ID NO. 8

[0178] Second nucleic acid aptamer sequence of Phaseolus vulgaris agglutinin: CGAGTAACGCTGTCTCTTCCGAATCGGGGGAAGGCGGAGGG; Seq ID NO. 8

[0179] Seq ID NO. 9

[0180] Second nucleic acid aptamer sequence of Phaseolus vulgaris agglutinin: TGGATAATGCGCTGACACTGTCGCCTCCGATCCCAG Seq ID NO. 10

[0181] Second nucleic acid aptamer sequence of Phaseolus vulgaris agglutinin: TGGATAATGCGCTGACACTGTCGCCTCCGATCCCAG Seq ID NO. 10

[0182] Second nucleic acid aptamer sequence of Phaseolus vulgaris agglutinin: TGGATAATGCGCTGACACTGTCGCCTCCGATCCCAG Seq ID NO. 10

[0183] GGT TGT GGA GGT TAC GGT TGT GGA GGT TCT GGT TGT GGA GGT TCT Seq ID NO. 12

[0184] Nucleic acid aptamer sequence of concanavalin A before optimization:

[0185] GTT GGT TGT GGT TGT CCT TGT GGT TGT GGT TGT GGT TGT GGT TCT Seq ID NO. 13

[0186] Nucleic acid aptamer sequence of concanavalin A before optimization:

[0187] GTT GGT TGT GGT TGT GGT ACT GGT TGT GCT TGT GGT TGT GGT TGT Seq ID NO. 14

[0188] Nucleic acid aptamer sequence of concanavalin A before optimization:

[0189] GTT CGT AGT GGT TGT GGT TGC GGT TGT GGT TGT GGT TGT GGT TG Seq ID NO. 15

[0190] Nucleic acid aptamer sequence of concanavalin A before optimization:

[0191] GTT GGT TGT CGT TGT GGA AGT GCT TGA GGT TGT GGT TGT GGT TGT

Claims

1. A detection device, characterized by The application relates to a sample pretreatment and detection device, which comprises a pretreatment module and a detection module, wherein the pretreatment module comprises an enrichment medium, the enrichment medium is fixed with nucleic acid aptamers capable of adsorbing target substances to be detected, is used for enriching the target substances to be detected, and obtains a sample liquid to be detected; the detection module is used for detecting the target substances to be detected in the sample liquid to be detected; the enrichment medium comprises a thin layer plate, the thin layer plate comprises a first end and a second end; the thin layer plate is placed in an inclined manner with one end downward, and the downward end can be automatically switched between the first end and the second end; a waste liquid bin is arranged below the first end of the thin layer plate, waste liquid after adsorption is collected through the waste liquid bin when the first end is downward; a collection bin is arranged below the second end of the thin layer plate, the sample liquid to be detected is collected through the collection bin when the second end is downward; a waste liquid bin one-way valve is arranged at the inlet of the waste liquid bin, and a collection bin one-way valve is arranged at the inlet of the collection bin; the pretreatment module further comprises a sample bin and an eluent bin, the eluent bin is used for eluting the sample to be detected from the thin layer plate by releasing an eluent, and obtains the sample liquid to be detected; a sample bin valve is arranged below the sample bin, and an eluent bin valve is arranged below the eluent bin; the sample bin valve and the waste liquid bin one-way valve are simultaneously opened; the eluent bin valve and the collection bin one-way valve are simultaneously opened. The nucleic acid aptamer fixed on the thin layer plate is a first nucleic acid aptamer, the first nucleic acid aptamer further has a TTTTTTTTTTCCCCCCCCCCCCCCC sequence at the 5' end; the eluent comprises ethylene glycol monomethyl ether, sodium dihydrogen phosphate dihydrate, NaCl and a Tris buffer solution containing Tween20.

2. The detection device of claim 1, wherein, The detection module comprises an electrochemical detection component, the number of the electrochemical detection component is one group or more groups, each group of the electrochemical detection component is used for detecting one target substance to be detected; each group of the electrochemical detection component comprises a working electrode and a probe, and the probe comprises a second nucleic acid aptamer for capturing the target substance to be detected.

3. The detection device of claim 2, wherein, The detection module further comprises a micro flow channel and a test strip, the micro flow channel is used for shunting the sample liquid to be detected; and the test strip is a multiple detection test strip, which is coated with an antibody of the target substance to be detected.

4. The detection device of claim 3, wherein, The target substance to be detected is a legume lectin, which comprises any one or more of soybean lectin, kidney bean lectin, red bean lectin, kidney bean lectin and red bean lectin.

5. The detection device of claim 4, wherein, The first nucleic acid aptamer comprises a first nucleic acid aptamer for binding any one or more of soybean lectin, kidney bean lectin, red bean lectin, kidney bean lectin and red bean lectin; the first nucleic acid aptamer for binding soybean lectin, kidney bean lectin, red bean lectin, kidney bean lectin and red bean lectin respectively has a nucleotide sequence as shown in the sequence table Seq ID NO. 1-5; the second nucleic acid aptamer comprises a second nucleic acid aptamer for binding any one or more of soybean lectin, kidney bean lectin, red bean lectin, kidney bean lectin and red bean lectin; the second nucleic acid aptamer for binding soybean lectin, kidney bean lectin, red bean lectin, kidney bean lectin and red bean lectin respectively has a nucleotide sequence as shown in the sequence table Seq ID NO. 6-10.

6. The detection device of claim 5, wherein, The multiple detection test paper strip is sequentially provided with detection lines of red bean agglutinin, concanavalin, phaseolus vulgaris agglutinin, soybean agglutinin and red bean agglutinin.

7. A method for detecting a legume lectin, characterized by, The detection device as claimed in any one of claims 1 to 6 is used for detection, comprising the following steps: (1) crushing, degreasing and extracting the sample to be detected, and collecting the crude sample; (2) adjusting the detection device to an initial state, with the second end of the thin layer plate being higher than the first end; (3) adding the crude sample into the sample bin; (4) opening the sample bin and the waste liquid bin, and the sample to be detected in the crude sample is adsorbed by the thin layer plate; (5) adjusting the first end of the thin layer plate to be higher than the second end, and opening the collection bin; (6) opening the eluent bin, and the eluent elutes the sample to be detected from the thin layer plate, and the collection bin collects the sample liquid to be detected; (7) the sample liquid to be detected flows into the detection module for detection.

Images