Ambient temperature nucleic acid amplification and detection

Abstract

The present disclosure provides improved compositions and methods for amplifying and detecting one or more target nucleic acids at ambient temperature.

Description

Background Art

[0001] Amplification and / or detection of nucleic acids in samples (eg, biological and / or environmental samples) is of increasing importance in a variety of diagnostic, therapeutic, social, and other contexts. Summary of the invention

[0002] The present disclosure recognizes that current nucleic acid amplification methods and detection methods rely on temperatures above ambient, often in conjunction with circulating temperatures. The present disclosure recognizes that alleviating the need for temperatures above ambient provides considerable advantages. The present disclosure recognizes that isothermal nucleic acid amplification at or near ambient temperature allows for sensitive diagnostic methods in point-of-care settings. The present disclosure recognizes that isothermal nucleic acid amplification at or near ambient temperature allows for sensitive diagnostic methods in resource-limited settings.

[0003] The present disclosure provides certain techniques that allow for the amplification and detection of nucleic acids in samples (eg, biological and / or environmental samples) at ambient temperature.

[0004] In some embodiments, the compositions and methods disclosed herein cause robust amplification of target nucleic acids. Robust amplification of target nucleic acid sequences refers to compositions and methods for continuously amplifying target nucleic acid sequences to detectable levels. The technology provided herein allows sensitive detection of target nucleic acids (i.e., nucleic acids whose nucleotide sequence is or comprises a target sequence). In some embodiments, the technology provided is particularly useful or applicable for detecting low abundance (e.g., less than about 10 fM, or about 1 fM, or about 100 aM) nucleic acids.

[0005] The present disclosure provides a composition, which comprises: (a) a double-stranded DNA target nucleic acid sequence, which comprises a first native restriction enzyme recognition sequence and a second native restriction enzyme recognition sequence located on opposite chains separated by a target nucleic acid region; (b) a first SDA primer, which comprises: (i) a sequence complementary to the first native restriction enzyme recognition sequence; (ii) a 3' blocking molecule; and (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides; (c) a second SDA primer, which comprises: (i) a sequence complementary to the second restriction enzyme nicking enzyme recognition sequence; (ii) a 3' blocking molecule; and (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides; (d) a shearing enzyme; (e) a DNA polymerase with strand displacement activity; (f) a single-stranded binding protein; and (g) dNTPs.

[0006] The present disclosure provides a method for amplifying a double-stranded DNA target nucleic acid sequence in a sample, the double-stranded DNA target nucleic acid sequence comprising a first native restriction enzyme recognition sequence and a second native restriction enzyme recognition sequence located on opposite strands separated by a target nucleic acid region, wherein the method comprises: (A) contacting the sample with a composition comprising: (a) a first SDA primer, the first SDA primer comprising: (i) a sequence complementary to the first native restriction enzyme recognition sequence; (ii) a 3' blocking molecule; and (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides; (b) a second SDA primer, the The second SDA primer comprises: (i) a sequence complementary to the second native restriction enzyme recognition sequence; (ii) a 3' blocking molecule; and (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides; (c) a shearing enzyme; (d) a DNA polymerase with strand displacement activity; (e) a single-stranded binding protein; (f) dNTPs; and thereby produces a reaction mixture; (B) incubating the reaction mixture under conditions that are conducive to (i) hybridization of the first and second SDA primers to double-stranded DNA target nucleic acid sequences in the sample; and (ii) amplification of the target nucleic acid, thereby producing multiple copies of the amplified target nucleic acid.

[0007] The present disclosure provides a method for detecting a double-stranded DNA target nucleic acid sequence in a sample, wherein the double-stranded DNA target nucleic acid sequence comprises a first native restriction enzyme recognition sequence and a second native restriction enzyme recognition sequence located on opposite strands separated by a target nucleic acid region, wherein the method comprises: (A) contacting at least one copy of the amplified target nucleic acid sequence as described herein with a composition comprising: (i) a guide nucleic acid comprising a nucleic acid sequence complementary to a DNA box; and (ii) a Cas enzyme having incidental cleavage activity; (iii) a nucleic acid reporter probe sensitive to the incidental cleavage activity, such that the nucleic acid reporter probe has a first, uncut state and a second, cut state that are detectably different; and (B) detecting the cutting of the nucleic acid reporter probe by detecting the difference between the first state and the second state to determine the presence of the target nucleic acid sequence in the sample.

[0008] The present disclosure provides a method for detecting a double-stranded DNA target nucleic acid sequence in a sample, wherein the double-stranded DNA target nucleic acid sequence comprises a first native restriction enzyme recognition sequence and a second native restriction enzyme recognition sequence located on opposite strands separated by a target nucleic acid region, wherein the method comprises: (A) contacting at least one copy of the amplified target nucleic acid sequence as described herein with a composition comprising: (i) a capture probe; and (ii) a conjugate capture probe comprising a detectable label and a 3' blocking entity; and (B) detecting the presence of the detectable label bound to a solid substrate to determine the presence of the target nucleic acid sequence in the sample.

[0009] The present disclosure provides a composition, which comprises: (a) a double-stranded DNA target nucleic acid sequence, which comprises at least one native restriction enzyme recognition sequence; (b) a forward primer, which comprises: (i) a 3' nucleic acid sequence complementary to the target nucleic acid sequence located downstream or 5' of the native restriction enzyme recognition sequence; and (ii) a 5' SDA primer binding sequence comprising a portion of the restriction enzyme recognition sequence; (c) a first SDA primer, which comprises (i) a sequence complementary to the at least one native restriction enzyme recognition sequence; (ii) a 3' blocking molecule; and (iii) a 5' SDA primer binding sequence comprising about 8 to about 20 nucleic acids. (d) a second SDA primer comprising: (i) a sequence complementary to a 5'SDA primer binding sequence of a forward primer comprising a partial restriction enzyme recognition sequence; (ii) a 3' blocking molecule; and (iii) a 5'stabilizing sequence comprising about 8 to about 20 nucleotides, the 5'stabilizing sequence comprising a partial restriction enzyme recognition sequence that together with the partial restriction enzyme recognition sequence in the 5'SDA primer binding sequence forms a complete restriction enzyme recognition sequence; (e) a shearing enzyme; (f) a DNA polymerase having a strand displacement activity; (g) a single-stranded binding protein; and (h) dNTPs.

[0010] The present disclosure provides a method for amplifying a double-stranded DNA target nucleic acid sequence containing at least one native restriction enzyme sequence in a sample, wherein the method comprises (A) contacting the sample with a composition comprising: (a) a forward primer, the forward primer comprising a 3' nucleic acid sequence complementary to a target nucleic acid sequence located downstream or 5' of a native nickase recognition sequence, and a 5' SDA primer binding sequence comprising a partial nickase recognition sequence; (b) a shearing enzyme; (c) a DNA polymerase having strand displacement activity; (d) a single-stranded binding protein; (e) dNTPs; thereby generating a single-stranded DNA (ssDNA) cassette; (B) contacting the ssDNA cassette of step (A) with a composition comprising: (f) a first SDA primer, the first SDA primer comprising: (i) a 5' SDA primer binding sequence complementary to the target nucleic acid sequence in the target nucleic acid sequence; and (ii) a 5' SDA primer binding sequence complementary to the target nucleic acid sequence in the target nucleic acid sequence. at least one native restriction enzyme sequence; (ii) a 3' blocking molecule; and (iii) a stabilizing sequence comprising about 8 to about 20 nucleotides, and (g) a second SDA primer, the second SDA primer comprising: (i) a sequence complementary to a 5' SDA primer binding sequence of a forward primer comprising a partial restriction enzyme recognition sequence; (ii) a 3' blocking molecule; and (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides, the 5' stabilizing sequence comprising a partial nicking enzyme recognition sequence that together with the partial nicking enzyme recognition sequence in the 5' SDA primer binding sequence forms a complete restriction enzyme recognition sequence, thereby producing a reaction mixture; (c) incubating the reaction mixture under conditions that favor the production of multiple copies of a nucleic acid identical to or complementary to the ssDNA cassette.

[0011] The present disclosure provides a method for detecting a double-stranded DNA target nucleic acid sequence comprising at least one native restriction enzyme sequence in a sample, wherein the method comprises: (A) contacting at least one copy of an amplified target nucleic acid sequence as described herein with a composition comprising: (i) a guide nucleic acid comprising a nucleic acid sequence complementary to a DNA box; and (ii) a Cas enzyme having incidental cleavage activity; (iii) a nucleic acid reporter probe sensitive to the incidental cleavage activity, such that the nucleic acid reporter probe has a first, uncut state and a second, cut state that are detectably different; and (B) detecting the cutting of the nucleic acid reporter probe by detecting the difference between the first state and the second state to determine the presence of the target nucleic acid sequence in the sample.

[0012] The present disclosure provides a method for detecting a double-stranded DNA target nucleic acid sequence comprising at least one native restriction enzyme sequence in a sample, wherein the method comprises: (A) contacting at least one copy of the amplified target nucleic acid sequence as described herein with a composition comprising: (i) a capture probe; and (ii) a conjugate capture probe comprising a detectable label and a 3' blocking entity; and (B) detecting the presence of the detectable label bound to a solid substrate to determine the presence of the target nucleic acid sequence in the sample.

[0013] The present disclosure provides a composition, which comprises: (a) an RNA target nucleic acid; (b) a reverse primer, the reverse primer comprising: (i) a 3' sequence complementary to the RNA target nucleic acid; and (ii) a 5' SDA primer binding sequence, wherein the primer binding sequence comprises a restriction enzyme recognition sequence, a portion of the restriction enzyme recognition sequence, or a complement thereof; (c) a reverse transcriptase; and (d) a forward primer, the forward primer comprising: (i) a 3' sequence complementary to the RNA target polynucleotide; and (ii) a 5' SDA primer binding, wherein the primer binding sequence comprises a restriction enzyme recognition sequence, a portion of the restriction enzyme recognition sequence, or a complement thereof; (e) a first SDA primer, the first SDA primer comprising: (i) a sequence complementary to the 5' SDA primer binding sequence of the reverse primer; (ii) a 3' blocking molecule; and (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides, and When the reverse primer contains only a partial restriction enzyme recognition sequence, the first SDA primer contains a partial restriction enzyme recognition sequence that forms a complete restriction enzyme recognition sequence together with the partial restriction enzyme recognition sequence in the 5'SDA primer binding sequence of the reverse primer; (f) a second SDA primer, the second SDA primer containing: (i) a sequence complementary to the 5'SDA primer binding sequence of the forward primer; (ii) a 3' blocking molecule; and (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides, when the forward primer contains only a partial restriction enzyme recognition sequence, the first SDA primer contains a partial restriction enzyme recognition sequence that forms a complete restriction enzyme recognition sequence together with the partial restriction enzyme recognition sequence in the 5'SDA primer binding sequence of the forward primer; (g) a shearing enzyme; (h) a polymerase with strand displacement activity; (i) a single-stranded binding protein; and (j) dNTPs.

[0014] The present disclosure provides a method for amplifying an RNA target nucleic acid sequence in a sample, the method comprising: (A) contacting the sample with a composition comprising: (a) a reverse primer comprising: (i) a 3' sequence complementary to the RNA target nucleic acid; and (ii) a 5' SDA primer binding sequence, wherein the primer binding sequence comprises a restriction enzyme recognition sequence, a partial restriction enzyme recognition sequence, or a complement thereof; (b) a reverse transcriptase; and (c) a forward primer comprising: (i) a 3' sequence complementary to the RNA target nucleic acid; and (ii) a 5' SDA primer binding sequence. (d) a first SDA primer binding sequence, wherein the primer binding sequence comprises a restriction enzyme recognition sequence, a portion of a restriction enzyme recognition sequence, or a complement thereof, thereby producing a first reaction mixture; (B) incubating the first reaction mixture under conditions that are favorable for producing a single-stranded DNA (ssDNA) cassette; (C) contacting the ssDNA cassette of (B) with a composition comprising: (d) a first SDA primer, the first SDA primer comprising: (i) a sequence complementary to the 5' SDA primer binding sequence of the reverse primer; (ii) a 3' blocking molecule; and (iii) a 5' blocking molecule comprising The invention relates to a first SDA primer comprising a 5' stabilizing sequence of about 8 to about 20 nucleotides, and when the reverse primer comprises only a partial restriction enzyme recognition sequence, the first SDA primer comprises a partial restriction enzyme recognition sequence that together with the partial restriction enzyme recognition sequence in the 5' SDA primer binding sequence of the reverse primer forms a complete restriction enzyme recognition sequence; (e) a second SDA primer comprising: (i) a sequence complementary to the 5' SDA primer binding sequence of the forward primer; (ii) a 3' blocking molecule; and (iii) comprising about 8 to about 20 nucleotides. (f) at least one cutting enzyme, a polymerase having strand displacement activity, a single-stranded binding protein, and dNTPs; and thereby producing a second reaction mixture; (D) incubating the second reaction mixture under conditions that are conducive to producing multiple copies of a nucleic acid identical to or complementary to the ssDNA cassette.

[0015] The present disclosure provides a method for detecting an RNA target nucleic acid sequence in a sample, wherein the method comprises: (A) contacting at least one copy of a nucleic acid identical to or complementary to an ssDNA box as described herein with a composition comprising: (i) a guide nucleic acid comprising a nucleic acid sequence complementary to the DNA box; and (ii) a Cas enzyme having an incidental cleavage activity; (iii) a nucleic acid reporter probe sensitive to the incidental cleavage activity, such that the nucleic acid reporter probe has a first, uncleaved state and a second, cleaved state that are detectably different; and (B) detecting cleavage of the nucleic acid reporter probe by detecting the difference between the first state and the second state to determine the presence of the RNA target nucleic acid sequence in the sample.

[0016] The present disclosure provides a method for detecting an RNA target nucleic acid sequence in a sample, wherein the method comprises: (A) contacting at least one copy of an amplified RNA target nucleic acid sequence as described herein with a composition comprising: (i) a capture probe; and (ii) a conjugate capture probe comprising a detectable label and a 3' blocking entity; and (B) detecting the presence of the detectable label bound to a solid substrate to determine the presence of the RNA target nucleic acid sequence in the sample.

[0017] The present disclosure provides a composition comprising: (a) a target polynucleotide; (b) a first probe comprising: a 3'SDA primer binding sequence comprising a partial nickase recognition site or its complement, a nucleic acid sequence complementary to the target nucleic acid, and a first nucleic acid sensor component; (c) a second probe comprising: a 5'SDA primer binding sequence comprising a partial nickase recognition site or its complement, a nucleic acid sequence complementary to the target nucleic acid, and a second nucleic acid sensor component, wherein each nucleic acid sensor component comprises a sequence encoding a first and a second reporter element component, respectively, or templates the first and second reporter element components; (d) at least one gap filling oligonucleotide; and (e) a ligase, which, when the first probe and the second probe are ligated together, produces a single-stranded DNA box encoding at least one reporter and comprising a 3'SDA primer binding sequence and a 5'SDA primer binding sequence, wherein the SDA primer binding sequence comprises a partial nickase recognition sequence or its complement.

[0018] The present disclosure provides a composition comprising: (a) a single-stranded DNA cassette encoding at least one reporter and comprising a 3'SDA primer binding sequence and a 5'SDA primer binding site, wherein the 3'SDA primer binding sequence and the 5'SDA primer binding sequence comprise a portion of a nickase recognition sequence or its complement; (b) a first SDA primer comprising: (i) a sequence complementary to the 3'SDA primer binding sequence; (ii) a 3' blocking molecule; and (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides, the 5' stabilizing sequence comprising a 3'SDA primer binding site. (c) a second SDA primer, the second SDA primer comprising: (i) a sequence complementary to the 5' SDA primer binding sequence; (ii) a 3' blocking molecule; and (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides, the 5' stabilizing sequence comprising a partial nicking enzyme recognition site that together with the partial nicking enzyme recognition sequence in the 5' SDA primer binding sequence forms a complete nicking enzyme primer binding sequence; and (d) at least one nicking enzyme, a polymerase with strand displacement activity, a single-stranded binding protein and dNTPs.

[0019] The present disclosure provides a composition comprising: (a) a single-stranded DNA (ssDNA) cassette encoding at least one reporter and comprising a 3'SDA primer binding sequence and a 5'SDA primer binding sequence, wherein the 3'SDA primer binding sequence and the 5'SDA primer binding sequence comprise a partial nickase recognition sequence or a complement thereof; (b) a first SDA primer comprising: (i) a sequence complementary to the 3'SDA primer binding sequence; (ii) a 3' blocking molecule; and (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides, the 5' stabilizing sequence comprising a partial nickase recognition site that together with the partial nickase recognition sequence in the 3'SDA primer binding sequence forms a complete nickase primer binding sequence; (c) a second SDA primer, the second SDA primer comprising: (i) a sequence complementary to the 3'SDA primer binding sequence; (ii) a 3' blocking molecule; and (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides, the 5' stabilizing sequence comprising a partial nickase recognition site that forms a complete nickase primer binding sequence together with the partial nickase recognition sequence in the 3'SDA primer binding sequence; The primer comprises: (i) a sequence complementary to a 5'SDA primer binding sequence; (ii) a 3' blocking molecule; and (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides, the 5' stabilizing sequence comprising a partial nicking enzyme recognition site that together with the partial nicking enzyme recognition sequence in the 5'SDA primer binding sequence forms a complete nicking enzyme primer binding sequence; and (d) a detection system, the detection system comprising: (i) a guide nucleic acid comprising a nucleic acid sequence complementary to a DNA box; and (ii) a Cas enzyme having incidental cleavage activity; (iii) a nucleic acid reporter probe sensitive to the incidental cleavage activity, such that the nucleic acid reporter probe has a first, uncut state and a second, cleaved state that are detectably different; and (e) at least one nicking enzyme, a polymerase having a strand displacement activity, a single-stranded binding protein, and dNTPs.

[0020] The present disclosure provides a method for detecting a target nucleic acid sequence in a sample, the method comprising: (A) contacting the sample with a composition comprising: (a) a first probe, the first probe comprising: a 3'SDA primer binding sequence comprising a partial nickase recognition sequence or its complement, a nucleic acid sequence complementary to the target nucleic acid, and a first nucleic acid sensing component; (b) a second probe, the second probe comprising: a 5'SDA primer binding sequence comprising a partial nickase recognition sequence or its complement, a nucleic acid sequence complementary to the target nucleic acid, and a second nucleic acid sensor component, wherein each nucleic acid sensing component comprises a first and a second reporter element component, respectively, encoding the first and second reporter element components, or templates the first and second reporter element components. (B) incubating the first reaction mixture under conditions favorable for producing a single-stranded DNA (ssDNA) cassette, (C) contacting the ssDNA cassette of (B) with a composition comprising: (i) a first SDA primer comprising: a 5' SDA primer binding sequence and a 3' SDA primer binding sequence; and (ii) a ligase. 'SDA primer binding sequence; a 3' blocking molecule; and a stabilizing sequence comprising about 8 to about 20 nucleotides, the stabilizing sequence comprising a portion of the nickase recognition site that together with the portion of the nickase recognition sequence in the 3'SDA primer binding sequence forms a complete nickase primer binding sequence; (ii) a second SDA primer, the second SDA primer comprising: a sequence complementary to the 5'SDA primer binding sequence; a 3' blocking molecule; and a 5' stabilizing sequence comprising about 8 to about 20 nucleotides, the 5' stabilizing sequence comprising a portion of the nickase recognition site that together with the portion of the nickase recognition sequence in the 5'SDA primer binding sequence forms a complete nickase primer binding sequence. point; and (iii) at least one nicking enzyme, a polymerase with strand displacement activity, and a single-stranded binding protein; thereby producing a second reaction mixture; (D) incubating the second reaction mixture under conditions that favor the production of multiple copies of a nucleic acid identical to or complementary to the ssDNA cassette; (E) contacting at least one copy of a nucleic acid identical to or complementary to the ssDNA cassette with a composition comprising a cell-free extract, thereby producing a third reaction mixture; (F) incubating the third reaction mixture under conditions that favor the production of the at least one reporter encoded by the ssDNA cassette; and (G) measuring the expression of the reporter protein produced in step (F) to determine the presence and / or amount of the target nucleic acid sequence in the sample.

[0021] The present disclosure provides a composition, which comprises: (a) a single-stranded DNA box, which encodes at least one reporter and comprises a 3'SDA primer binding sequence and a 5'SDA primer binding sequence, wherein the 3'SDA primer binding sequence and the 5'SDA primer binding sequence comprise a nickase recognition sequence or a portion of the nickase recognition sequence, or a complement thereof; (b) a first SDA primer, which comprises: (i) a sequence complementary to the 3'SDA primer binding sequence; (ii) a 3' blocking molecule; and (iii) a T7 promoter sequence and / or a stabilizing sequence comprising about 8 to about 20 nucleotides, the stabilizing sequence comprising a nickase recognition site on the 3'SDA primer binding sequence that forms a nickase recognition site. a partial nickase recognition site of a complete nickase primer binding sequence; (c) a second SDA primer comprising: (i) a sequence complementary to the 5' SDA primer binding sequence; (ii) a 3' blocking molecule; and (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides, the 5' stabilizing sequence comprising a partial nickase recognition site that together with the partial nickase recognition sequence in the 5' SDA primer binding sequence forms a complete nickase primer binding sequence; and (d) a detection system comprising: (i) a capture probe; and (ii) a conjugate capture probe comprising a detectable label and a 3' blocking molecule; and (e) at least one nickase, a polymerase having strand displacement activity, a single-stranded binding protein, and dNTPs.

[0022] The present disclosure provides a method for detecting an RNA target nucleic acid sequence in a sample, the method comprising: (A) contacting the sample with a composition comprising: a reverse primer comprising: (i) a 3' sequence complementary to the RNA target nucleic acid; and (ii) a 5' SDA primer binding sequence, wherein the primer binding sequence comprises a nickase recognition sequence, or a portion of the nickase recognition sequence or its complement, a reverse transcriptase, a forward primer comprising: (i) a 3' sequence complementary to the RNA target polynucleotide; and (ii) a 5' SDA primer binding sequence, wherein the primer binding sequence comprises a nickase recognition sequence, or a portion of the nickase recognition sequence or its complement; (B) incubating the first reaction mixture under conditions that favor the production of a single-stranded DNA (ssDNA) cassette; (C) contacting the ssDNA cassette of (B) with a composition comprising: (i) a first SDA primer comprising: a sequence complementary to the 5' SDA primer binding sequence; a 3' blocking molecule; and a T7 promoter sequence, and / or a stabilizing sequence comprising or consisting of about 8 to about 20 nucleotides, and when the 5' SDA primer binding sequence comprises only a partial nickase recognition site, the stabilizing sequence (i) a first SDA primer comprising a partial nickase recognition site that together with the partial nickase recognition site on the SDA primer binding sequence forms a complete nickase primer binding site; (ii) a second SDA primer comprising: a sequence complementary to the 3' SDA primer binding sequence of the reverse primer; a 3' blocking molecule; and a stabilizing sequence comprising or consisting of at least 8-12 nucleotides, and when the 3' SDA primer binding sequence comprises only a partial nickase recognition site, the stabilizing sequence comprises a partial nickase recognition site that together with the partial nickase recognition site on the 3' SDA primer binding sequence forms a complete nickase primer binding site. (d) incubating the second reaction mixture under conditions that favor the production of multiple copies of a nucleic acid identical or complementary to the ssDNA box; (e) contacting at least one copy of a nucleic acid identical or complementary to the ssDNA box with a composition comprising (i) a capture probe; and (ii) a conjugate capture probe comprising a detectable label and a 3' blocking molecule; and (f) detecting the presence of the detectable label bound to the solid substrate to determine the presence of the target nucleic acid sequence in the sample.

[0023] The present disclosure provides a method for detecting a target nucleic acid sequence in a sample, the method comprising: (a) contacting the sample with a composition comprising: (i) a first probe, the first probe comprising: a 3'SDA primer binding sequence comprising a partial nickase recognition site or its complement, a nucleic acid sequence complementary to the target nucleic acid, and a first nucleic acid sensor component; (ii) a second probe, the second probe comprising: a 5'SDA primer binding sequence comprising a partial nickase recognition site or its complement, a nucleic acid sequence complementary to the target nucleic acid, and a second nucleic acid sensor component, wherein each nucleic acid sensor component comprises a sequence encoding a first and a second reporter element component, respectively; (iii) at least one a gap filling oligonucleotide, wherein; and (iv) a ligase, which when ligated together produces a single-stranded nucleotide box encoding at least one reporter and comprising a 3' SDA primer binding sequence and a 5' SDA primer binding sequence, wherein the primer binding sequence comprises a nickase recognition sequence or a portion of a nickase recognition sequence, thereby producing a first reaction mixture; (b) incubating the first reaction mixture under conditions that are conducive to the production of a single-stranded nucleotide box, (c) contacting the nucleotide box of (b) with a composition comprising: (i) a first SDA primer, the first SDA primer comprising: (a) a sequence complementary to the 3' SDA primer binding sequence; (b) a 3' blocking molecule; and (c) comprising about 8 to about 20 nucleotides. nucleotides and comprising a stabilizing sequence of a partial nickase recognition site that together with the partial nickase recognition site on the 3' SDA primer binding sequence forms a complete nickase primer binding site; (c) a second SDA primer, the second SDA primer comprising: (i) a sequence complementary to the 5' SDA primer binding sequence; (ii) a 3' blocking molecule; and (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides, the 5' stabilizing sequence comprising a partial nickase recognition site that together with the partial nickase recognition sequence in the 5' SDA primer binding sequence forms a complete nickase primer binding sequence; and (ii) at least one nickase, a polymerase having strand displacement activity, and a single-stranded binding protein, thereby producing a second reaction mixture ; (d) incubating a second reaction mixture under conditions that are favorable for producing multiple copies of a nucleic acid identical to or complementary to the nucleotide box; (e) contacting at least one copy of a nucleic acid identical to or complementary to the nucleotide box with a composition comprising: (i) a guide nucleic acid comprising a nucleic acid sequence complementary to the nucleotide box; and (ii) a Cas enzyme having an incidental cleavage activity; (iii) a nucleic acid reporter probe sensitive to the incidental cleavage activity, such that the nucleic acid reporter probe has a first, non-cut state and a second, cut state that are detectably different; and (f) detecting the cutting of the nucleic acid reporter probe by detecting the difference between the first state and the second state to determine the presence of the target nucleic acid sequence in the sample. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 .Amplification of the dual epitope cassette (analog trigger, Seq 1) with different SDA primers. S158 ROI: specific target region of interest (ROI) in the SARS genome. 3xF 1xS: expression cassette containing an open reading frame of three FLAG epitope tags (3xF) followed by a StrepII epitope tag (1xS). High / Low Bsu: high or low concentration Bsu DNA polymerase product.

[0025] Figure 2 .Amplification of bi-epitope cassettes of different lengths.

[0026] Figure 3 .Amplification of bi-epitope cassettes of different lengths.

[0027] Figure 4 . Lateral flow LOD of the cartridge using Cap-SDA.

[0028] Figure 5 . Reduction of NTC background signal from ligation reactions amplified by Cap-SDA using ET-SSB.

[0029] Figure 6 .Reduction of NTC background signal from ligation reactions amplified by Cap-SDA using new probe design. ROI 20945: Region of interest (ROI) in the SARS genome. This probe design has an A probe followed by a GFO followed by a B probe. Old design: The ribosome binding site (RBS) is located on the GFO (gap filling oligonucleotide). New design: The ribosome binding site (RBS) is located on one of the A probes.

[0030] Figure 7 .Detection of SARS gRNA target in ligation reactions amplified by Cap-SDA using different probe designs. Three different probes were used: a "30bp Standard" probe with two 30bp hybridization regions with no gap between them, a "40bp Gap" probe with two 30bp hybridization regions with a 40bp gap between them, and a "51bp HybSeq" probe with two 51bp hybridization regions with no gap between them, either of unequal length on either probe arm, or of equal length on either probe arm. ROI S20945: Region of interest (ROI) in the SARS genome.

[0031] Figure 8 Detection of synthetic ssDNA targets containing the ORF1 SARS sequence. HC: high concentration of DNA polymerase. LC: low concentration of DNA polymerase.

[0032] Fig. 9 . Detection of synthetic ssDNA targets containing the ORF1 SARS sequence. KF treated: Reactions performed using SDA primers that were pre-treated with the 3' exonuclease activity of Klenow Large Fragment DNA Polymerase prior to addition to the reaction.

[0033] Figure 10. Detection of SARS irradiated virions using reverse transcriptase (left) or ligase reactions (right) followed by Cap-SDA amplification. BEI: inactivated SARS viral material.

[0034] Fig.11 Detection of SARS gRNA using reverse transcriptase followed by Cap-SDA amplification.

[0035] Fig.12 Detection of SARS gRNA using reverse transcriptase followed by Cap-SDA amplification.

[0036] Figure 13. Detection of SARS gRNA using reverse transcriptase followed by Cap-SDA amplification.

[0037] Fig.14 Detection of SARS gRNA using a ligase reaction followed by Cap-SDA amplification.

[0038] Fig.15 .2fM ssDNA synthetic target containing SARS ORF1 sequence was detected by Cap-SDA.

[0039] Fig.16 Colorimetric detection of indicated concentrations of SARS gRNA using ligase reactions followed by Cap-SDA amplification.

[0040] Fig.17 Detection of dsDNA targets containing native nickase sites in a one-pot SDA reaction.

[0041] Fig.18 Detection of ssDNA synthesis target (Seq 52, - indicates 0 fM, + indicates 20 fM) using lateral flow output from Cap-SDA reactions using capture oligonucleotides.

[0042] Fig.19 Detection of ssDNA synthesis target (2 fM, Seq 52) using Cap-SDA reactions under standard or pH-adjusted conditions.

[0043] Fig. 20The ligation and CAP-SDA reaction of the bridge for detecting the target nucleic acid is shown. The product of SDA is DNA encoding one or more reporters. The reporters can be produced using a cell-free extract (CFE) and detected by lateral flow (LF). An exemplary assay procedure includes 30 min ligation, 90 min SDA, 120 min CFE, 20 min LF, and an approximate limit of detection (LOD) of about 1 fM.

[0044] Figures 21A-21D Shown are bridged linkages for detecting target nucleic acids, CAP-SDA reactions, and CRISPR / Cas-based detection (e.g., SHERLOCK TM ). The product of SDA is DNA containing a T7 promoter. T7 RNA polymerase transcribes RNA. RNA is recognized by a Cas enzyme (e.g., as described in PCT / US2017 / 065477).

[0045] Figures 22A-22F Reverse transcription, CAP-SDA reaction and CRISPR / Cas based detection (e.g., SHERLOCK TM ). The product of SDA is DNA containing a T7 promoter. T7 RNA polymerase transcribes RNA. RNA is recognized by CRISPR / Cas enzymes (e.g., as described in PCT / US2017 / 065477).

[0046] Fig.23 Reverse transcription, CAP-SDA reaction, and capture lateral biosensor for detecting target nucleic acid are shown. The product of SDA is DNA containing a T7 promoter. T7 RNA polymerase transcribes RNA. RNA is recognized by binding to capture probes and conjugate capture probes (e.g., on lateral flow biosensors).

[0047] Figures 24A-24D The use of CAP-SDA reaction and CRISPR / Cas based detection (e.g., SHERLOCK TM ). T7 RNA polymerase transcribes RNA. RNA is recognized by CRISPR / Cas enzyme (e.g., as described in PCT / US2017 / 065477).

[0048] Figures 25A-25C Shown is the detection of dsDNA using the CAP-SDA reaction when the dsDNA contains an endogenous nickase sequence.

[0049] Fig.26An exemplary workflow for viral lysis at ambient temperature (e.g., at 22° C.) is shown, using, for example, 3-dodecylamido-N,N'-dimethylpropylamine oxide 3-laurylamido-N,N'-dimethylpropylamine oxide (LAPAO) and hydrochloric acid (HCl), or using N,N-dimethyl-1-dodecylamine-N-oxide (LDAO), sodium decanoate (NaClO) and HCl. The workflow includes an incubation step of the sample with a lysis reagent, followed by a lysis reaction and a neutralization step. The workflow also depicts an optional nucleic acid ligation step.

[0050] Fig. 27 Shown is one or more effects of pH on viral lysis efficiency at ambient temperature (22°C) when using a detergent composition as provided herein.

[0051] Fig.28 Detection of dsDNA genomic targets (Ct extracted genomes) using the Nb.BbvCI endogenous nicking site using Cap-SDA reactions without bump primers.

[0052] Fig.29 Detection of dsDNA genomic targets (Ng-extracted genomes) using Cap-SDA reactions with nickases Nt.CviPII and LwCas13a.

[0053] Fig.30 Detection of dsDNA genomic targets (Ng-extracted genomes) using Cap-SDA reactions with nickase Nt.CviPII and LbCas12a.

[0054] Fig.31 . Detection of dsDNA genomic targets (Ng-extracted genomes) using Cap-SDA reactions with the nicking enzyme Nt.CviPII.

[0055] Fig.32 Multiplexed detection of two dsDNA genomic targets (Ct or Ng extracted genomes) using Cap-SDA reactions with the nicking enzyme Nt.CviPII.

[0056] Fig.33 . Detection of dsDNA genomic targets (Ng-extracted genomes) using Cap-SDA reactions with the nicking enzyme Nt.CviPII.

[0057] Figures 34A-34B Detection of synthetic ssDNA targets (Seq A) using Cap-SDA reactions with primer stabilizers as single-stranded or double-stranded hairpins.

[0058] Fig.35 Detection of dsDNA genomic targets (Ng extracted genomes) using Cap-SDA reactions with primer stabilizers as single-stranded or double-stranded hairpins.

[0059] Fig.36 Detection of synthetic ssDNA targets (Seq X) using Cap-SDA reactions with the nickase Nt.CviPII.

[0060] Fig.37 Detection of synthetic ssDNA targets (Seq X, Y, Z, and W) using Cap-SDA reactions with the nickase Nt.CviPII.

[0061] Fig.38A -D shows reverse transcription of target nucleic acid and CAP-SDA reaction.

[0062] Figure 39-AB shows exemplary SDA primers. Bold indicates restriction enzyme recognition sequences, such as nickase recognition sequences. A. * represents nickase sequences blocked with PTO bonds. B. Shows exemplary SDA primers with hairpin stabilization sequences. * represents PTO bonds. BLCK: 3' blocking molecule.

[0063] Fig.40 Detection of amplicon capture probes (SEQ ID NO: 14, 15, 39) on lateral flow is shown without and with blocking molecules (10% skim milk or 1 uM sponge oligonucleotide).

[0064] Figures 41A-41B Lysis of respiratory viruses is shown. A) Influenza A (FLUA) and B) SARS-CoV-2 (SCV2) compared with no treatment using 95°C thermal lysis or 20mM NaOH in a single nasal swab matrix. Virus lysis efficiency was determined by first performing a room temperature reverse transcriptase reaction, then inactivating the reverse transcriptase and performing standard taqman qPCR on the resulting cDNA. Lower Cq values ​​correspond to greater viral RNA release.

[0065] Fig.42 RNase inhibition achieved in nasal swab matrix using RNase inhibitors or sodium hydroxide (NaOH) is shown. RNase activity was measured using IDT's RNase Alert reagent.

[0066] Fig.43The lysis of respiratory viruses (FluA and SCV2) in the presence of high pH solutions is shown. Various concentrations of KOH and NaOH are used to lyse viral particles. The viral lysis efficiency is determined by first performing a room temperature reverse transcriptase reaction, then inactivating the reverse transcriptase and performing standard taqman qPCR on the generated cDNA. Lower Cq values ​​correspond to larger viral RNA release, and therefore to better lysis of viral particles.

[0067] Fig.44 Hydroxide-based chemical lysis of non-enveloped viruses is shown. Human adenovirus stocks were treated with the indicated concentrations of NaOH at room temperature prior to qPCR detection of released viral DNA. Faster Cq values ​​indicate higher concentrations of released viral DNA and, therefore, better viral particle lysis.

[0068] Figures 45A-45B Shown are the room temperature lysis of bacteria A) Neisseria gonorrhoea (N.gonorrhoea), and B) Chlamydia trachomatis (C.trachomatis).Bacterial cells are treated with KOH of indicated concentration or subjected to bead milling.After lysis, cell suspension is centrifuged to precipitate intact cells, and a portion of remaining supernatant is measured by qPCR.Results are presented as the Cq value difference between treated cells and untreated controls, wherein Δ (delta) is greater indicating that lysis is more effective.

[0069] Fig.46 The lysis of the bacterium Neisseria gonorrhoeae with 50 mM KOH with the addition of detergent is shown. The bacterial cells were treated with the indicated concentration of detergent in the presence of 50 mM KOH or subjected to bead milling. After lysis, the cell suspension was centrifuged to precipitate the intact cells, and a portion of the remaining supernatant was determined by qPCR. The results are presented as the difference in Cq values ​​between the treated cells and the untreated control, where the larger the Δ (delta), the more effective the lysis.

[0070] Fig.47 The lysis efficiency of Neisseria gonorrhoeae treated with 50mM KOH, 13.5mM HCL + / - 0.5% Pluronic 64 detergent at various incubation temperatures is shown. The bacterial cells were treated with KOH, HCl and / or detergent at the indicated concentrations for 5 minutes at the indicated temperatures, or subjected to thermal lysis at 95C for 5 minutes. After lysis, a portion of the remaining supernatant was determined by qPCR, and the concentration of gDNA in the sample was quantified by a standard curve of extracted gDNA. The results are presented as a percentage of lysis efficiency, assuming that the thermal lysis control is 100% lysis. The signal from the untreated control cells ("no lysis") was subtracted from all samples.

[0071] Fig.48 The lysis efficiency test of Neisseria gonorrhoeae treated with 50mM KOH or HCL+ESH9 at various incubation temperatures is shown. The bacterial cells are treated with KOH, HCl and / or detergents of indicated concentrations at indicated temperatures for 5 minutes, or the bacterial cells are subjected to 95C thermal lysis for 5 minutes. After lysis, a portion of the remaining supernatant is determined by qPCR, and the concentration of gDNA in the sample is quantified by the standard curve through the extraction of gDNA. The results are presented as lysis efficiency percentages, assuming that the thermal lysis control is 100% lysis. The signal from untreated control cells ("no lysis") is subtracted from all samples.

[0072] Fig.49 The lysis efficiency test of Neisseria gonorrhoeae treated with 50mM KOH+NP40 at various incubation temperatures is shown. The bacterial cells were treated with KOH, HCl and / or detergent at the indicated concentrations for 5 minutes at the indicated temperatures, or the bacterial cells were subjected to thermal lysis at 95C for 5 minutes. After lysis, the cell suspension was centrifuged to precipitate the intact cells, and a portion of the remaining supernatant was determined by qPCR. The results are presented as percentage lysis efficiency, assuming that the thermal lysis control is 100% lysis.

[0073] Fig.50 The lysis efficiency test of Neisseria gonorrhoeae treated with various KOH concentrations + / - 3% NP40 at various incubation temperatures is shown. The bacterial cells were treated with KOH and / or detergent at the indicated concentrations for 5 minutes at the indicated temperature, or the bacterial cells were subjected to 95C thermal lysis for 5 minutes. After lysis, a portion of the remaining supernatant was determined by qPCR, and the concentration of gDNA in the sample was quantified by the standard curve of the extracted gDNA. The results are presented as a percentage of lysis efficiency, assuming that the thermal lysis control is 100% lysis. The signal from the untreated control cells ("no lysis") was subtracted from all samples.

[0074] Figure 51 shows a comparison of the lysis technique as described herein with a thermal lysis method (95°C) upstream of a LAMP-Cas assay. N. gonorrhoeae was diluted in TE, treated as indicated, and a portion of the lysate was used as template for the LAMP-Cas reaction.

[0075] Fig.52 KOH lysis of N. gonorrhoeae in vaginal stroma using LAMP-Cas is shown. N. gonorrhoeae was diluted in TE, treated as indicated, and a portion of the lysate was used as template for the LAMP-Cas reaction.

[0076] Figure 53 shows the nickase-based CapSDA workflow. Bold nucleotides represent nickase recognition sequences. SDA primers 1 and 2 are shown as hairpin primers, but can also be single-stranded sequences.

[0077] Figures 54A-54B Nickase-based CapSDA workflow combined with lateral flow direct capture is shown. * represents PTO bond. Bold nucleotides represent nickase recognition sequences.

[0078] definition

[0079] Ambient temperature: As used herein, the term "ambient temperature" is the temperature of the surrounding environment. In general, the term ambient temperature is understood to be the temperature of any object or environment around the article. Measuring ambient temperature can be accomplished by using a thermometer or sensor. The ambient temperature of an article depends on the temperature of the surrounding environment of the article. The surrounding environment can have any temperature, such as below 95°C, such as below 90°C, such as below 85°C, such as below 80°C, such as below 75°C, such as below 70°C, such as below 65°C, such as below 60°C, such as below 55°C, such as below 50°C, such as below 45°C, such as below 40°C, such as below 35°C, such as below 30°C, such as below 25°C, such as below 24°C, such as below 23°C, such as below 22°C, such as below 21°C, such as below 20°C. Exemplary ambient temperature ranges include 5°C to 50°C, such as 10°C to 40°C, such as 15°C to 35°C, such as 20°C to 30°C, such as 20°C to 25°C, such as 20°C to 22°C.

[0080] About: When used in this article to refer to a value, the term "about" refers to a value similar to the value mentioned in the context. Generally speaking, those skilled in the art who are familiar with the context should understand the relevant degree of difference covered by "about" in this context. For example, in some embodiments, the term "about" can cover a range of values ​​within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less of the value mentioned.

[0081] Approximately: As used herein, the term "approximately" or "about" as applied to one or more target values ​​refers to a value similar to the stated reference value. In certain embodiments, unless otherwise stated or otherwise apparent from this article (except for the case where such numerals will exceed 100% of the possible value), the term "approximately" or "about" refers to a range of values ​​that are 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less in either direction (greater than or less than) of the stated reference value.

[0082] Binding: It should be understood that as used herein, the term "binding" generally refers to a non-covalent association between or among two or more entities. "Direct" binding involves physical contact between the entities or moieties; indirect binding involves physical interaction through physical contact with one or more intermediate entities. Binding between two or more entities can generally be assessed in any of a variety of environments, including studying the interacting entities or moieties alone or in the context of a more complex system (e.g., when covalently or otherwise associated with a carrier entity and / or in a biological system or cell).

[0083] Biological sample: As used herein, the term "biological sample" generally refers to a sample obtained or derived from a target biological source (e.g., a tissue or organism or cell culture) as described herein. In some embodiments, the target source is or comprises an organism (such as an animal or a human). In some embodiments, the biological sample is or comprises a biological tissue or fluid. In some embodiments, the biological sample can be or include bone marrow; blood; blood cells; ascites; tissue or fine needle biopsy samples; cell-containing body fluids; free nucleic acids; sputum; saliva; urine; cerebrospinal fluid, peritoneal fluid; pleural fluid; feces; lymph fluid; gynecological fluid; skin swab; vaginal swab; oral swab; nasal swab; washing fluid or lavage fluid, such as catheter lavage fluid or bronchoalveolar lavage fluid; aspirate; scraping; bone marrow specimen; tissue biopsy specimen; surgical specimen; feces, other body fluids, secretions and / or excretions; and / or cells therefrom, etc. In some embodiments, the biological sample is or includes cells obtained from an individual. In some embodiments, the cell obtained is or includes a cell from an individual obtaining a sample. In some embodiments, a sample is a "primary sample" obtained directly from a target source by any appropriate means. For example, in some embodiments, a primary biological sample is obtained by a method selected from the group consisting of: biopsy (e.g., fine needle aspiration or tissue biopsy), surgery, body fluid (e.g., blood, lymph, feces, etc.) collection, etc. In some embodiments, as will be clear from the context, the term "sample" refers to a preparation obtained by processing a primary sample (e.g., by removing one or more components of a primary sample and / or by adding one or more agents to a primary sample). For example, a semipermeable membrane is used for filtration. Such a "processed sample" may include, for example, nucleic acids or proteins extracted from a sample, or nucleic acids or proteins obtained by subjecting a primary sample to a technique (such as amplification or reverse transcription of mRNA, separation and / or purification of certain components, etc.).

[0084] Cell lysate: As used herein, the term "cell lysate (cellular lysate / cell lysate)" refers to a fluid containing the contents of one or more ruptured cells (i.e., cells whose membranes have been ruptured). In some embodiments, the cell lysate includes both hydrophilic and hydrophobic cell components. In some embodiments, the cell lysate mainly includes hydrophilic components; in some embodiments, the cell lysate mainly includes hydrophobic components. In some embodiments, the cell lysate is a lysate of one or more cells selected from the group consisting of: plant cells, microbial (e.g., bacterial or fungal) cells, animal cells (e.g., mammalian cells), human cells, and combinations thereof. In some embodiments, the cell lysate is a lysate of one or more abnormal cells (such as cancer cells). In some embodiments, the cell lysate is a crude lysate because little or no purification is performed after cell rupture; in some embodiments, such a lysate is referred to as a "primary" lysate. In some embodiments, one or more separation or purification steps are performed on the primary lysate; however, the term "lysate" refers to a preparation containing a variety of cellular components, rather than a pure preparation of any single component.

[0085] Composition: Those skilled in the art will appreciate that, as used herein, the term "composition" may be used to refer to a discrete physical entity comprising one or more specified components. Generally, unless otherwise specified, a composition may be in any form - for example, a gas, gel, liquid, solid, etc.

[0086] Comprising: The compositions or methods described herein as "comprising" one or more specified elements or steps are open-ended, meaning that the specified elements or steps are essential, but other elements or steps can be added within the scope of the composition or method. To avoid redundancy, it should also be understood that any composition or method described as "comprising" (or "including") one or more specified elements or steps also describes a corresponding, more limited "substantially consisting of the same specified elements or steps" (or "substantially consisting of the same specified elements or steps") composition or method, which means that the composition or method includes the specified basic elements or steps, and may also include additional elements or steps that do not substantially affect one or more basic and new features of the composition or method. It should also be understood that any composition or method described herein as "comprising" one or more specified elements or steps or "substantially consisting of one or more specified elements or steps" also describes a corresponding, more limited and closed "consisting of the specified elements or steps" (or "consisting of the specified elements or steps") composition or method to exclude any other unspecified elements or steps. In any composition or method disclosed herein, any known or disclosed equivalent of any specified basic element or step can replace the element or step.

[0087] Determine: Many methods described herein include a "determine" step. Those of ordinary skill in the art who read this specification will understand that such "determine" can be achieved using any of a variety of techniques available to those skilled in the art (including, for example, specific techniques explicitly mentioned herein) or by using any of these techniques. In some embodiments, determine the manipulation of a physical sample. In some embodiments, determine the manipulation of data or information, such as using a computer or other processing unit suitable for performing relevant analysis ...

[0088] Expression: As used herein, "expression" of a nucleic acid sequence refers to one or more of the following events: (1) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of the RNA transcript (e.g., by splicing, editing, 5' cap formation and / or 3' end formation); (3) translation of the RNA into a polypeptide or protein; and / or (4) post-translational modification of the polypeptide or protein.

[0089] Native nickase site: as used herein, refers to a nickase site that occurs naturally in a nucleic acid sequence (e.g., a nickase site is not introduced by manipulation and / or amplification of the nucleic acid sequence)

[0090] Nucleic acid: As used herein, in its broadest sense, refers to any compound and / or substance that is or can be incorporated into an oligonucleotide chain. In some embodiments, nucleic acids are compounds and / or substances that are or can be incorporated into an oligonucleotide chain via phosphodiester linkages. It will be clear from the context that in some embodiments, "nucleic acid" refers to a single nucleic acid residue (e.g., nucleotide and / or nucleoside); in some embodiments, "nucleic acid" refers to an oligonucleotide chain comprising a single nucleic acid residue. In some embodiments, "nucleic acid" is or includes RNA; in some embodiments, "nucleic acid" is or includes DNA. In some embodiments, nucleic acid is one or more natural nucleic acid residues, includes the residues, or consists of the residues. In some embodiments, nucleic acid is one or more nucleic acid analogs, includes the analogs, or consists of the analogs. In some embodiments, nucleic acid analogs differ from nucleic acids in that nucleic acid analogs do not utilize a phosphodiester backbone. For example, in some embodiments, nucleic acid is one or more "peptide nucleic acids", includes the peptide nucleic acids, or consists of the peptide nucleic acids, which are known in the art and have peptide bonds in the backbone instead of phosphodiester bonds, and the nucleic acids are considered to be within the scope of the present disclosure. Alternatively or additionally, in some embodiments, the nucleic acid has one or more phosphorothioate and / or 5'-N-phosphoramidite linkages, rather than phosphodiester bonds. In some embodiments, the nucleic acid is one or more natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine), comprises, or consists of. In some embodiments, the nucleic acid is one or more nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolopyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynylcytidine, C-5 propynyluridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyluridine, C5-propynylcytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, 2-thiocytidine, methylated bases, intercalated bases, and combinations thereof), comprises one or more nucleoside analogs, or consists of one or more nucleoside analogs. In some embodiments, the nucleic acid comprises one or more sugars that are modified compared to sugars in natural nucleic acids (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose). In some embodiments, nucleic acid has a nucleotide sequence encoding a functional gene product such as RNA or protein. In some embodiments, nucleic acid comprises one or more introns. In some embodiments, nucleic acid can be prepared by one or more of the following methods: separation from natural sources, enzymatic synthesis (in vivo or in vitro) by polymerization based on complementary templates, replication and chemical synthesis in recombinant cells or systems.In some embodiments, the nucleic acid is at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 20, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, or more residues in length. In some embodiments, the nucleic acid is partially or completely single-stranded; in some embodiments, the nucleic acid is partially or completely double-stranded. In some embodiments, the nucleic acid has a nucleotide sequence comprising at least one element that encodes a polypeptide or is the complement of a sequence that encodes a polypeptide. In some embodiments, the nucleic acid has enzymatic activity.

[0091] Polypeptide: As used herein, refers to any polymerized amino acid chain. In some embodiments, the polypeptide has an amino acid sequence that exists in nature. In some embodiments, the polypeptide has an amino acid sequence that does not exist in nature. In some embodiments, the polypeptide has an engineered amino acid sequence because it is designed and / or produced by artificial action. In some embodiments, the polypeptide may contain natural amino acids, non-natural amino acids, or both, or consist of these amino acids. In some embodiments, the polypeptide may contain only natural amino acids or only non-natural amino acids, or consist of only natural amino acids or only non-natural amino acids. In some embodiments, the polypeptide may contain D-amino acids, L-amino acids, or both. In some embodiments, the polypeptide may contain only D-amino acids. In some embodiments, the polypeptide may contain only L-amino acids. In some embodiments, the polypeptide may contain one or more side groups or other modifications, such as at the N-terminus of the polypeptide, at the C-terminus of the polypeptide, or connected to one or more amino acid side chains, or any combination thereof. In some embodiments, such side groups or modifications may be selected from the group consisting of: acetylation, amidation, lipidation, methylation, pegylation, etc., including combinations thereof. In some embodiments, the polypeptide may be cyclic, and / or may include a cyclic portion. In some embodiments, the polypeptide is not cyclic, and / or does not include any cyclic portion. In some embodiments, the polypeptide is linear. In some embodiments, the polypeptide may be or include a stapled polypeptide. In some embodiments, the term "polypeptide" may be appended to the name of a reference polypeptide, activity, or structure; in this case, it is used herein to refer to a polypeptide that shares a related activity or structure and is therefore considered to be a member of the same class or family of polypeptides. For each such category, this specification provides and / or those skilled in the art will know exemplary polypeptides within the category, whose amino acid sequences and / or functions are known; in some embodiments, such exemplary polypeptides are reference polypeptides of a polypeptide class or family. In some embodiments, members of a polypeptide class or family show significant sequence homology or identity with a reference polypeptide of the class (in some embodiments, with all polypeptides within the class), share common sequence motifs (e.g., characteristic sequence elements) with a reference polypeptide of the class (in some embodiments, with all polypeptides within the class), and / or share common activities (in some embodiments, at comparable levels or within a specified range).For example, in some embodiments, a member polypeptide exhibits an overall sequence homology or identity degree of at least about 30-40% and typically greater than about 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more with a reference polypeptide, and / or includes at least one region (e.g., a conserved region that may be or include characteristic sequence elements in some embodiments) that exhibits very high sequence identity (typically greater than 90% or even 95%, 96%, 97%, 98% or 99%). Such conserved regions typically encompass at least 3-4 and typically up to 20 or more amino acids; in some embodiments, conserved regions encompass at least a stretch of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more amino acids. In some embodiments, the polypeptide of interest may comprise or consist of fragments of a parent polypeptide. In some embodiments, a useful polypeptide may comprise or consist of multiple fragments, each fragment being found in the same parent polypeptide in a different spatial arrangement relative to another found in the target polypeptide (e.g., fragments that are directly linked in the parent may be spatially separated in the target polypeptide, vice versa, and / or the fragments may be present in a different order in the target polypeptide than in the parent), such that the target polypeptide is a derivative of its parent polypeptide.

[0092] Protein: As used herein, the term "protein / protein" refers to a polypeptide (i.e., a string of at least two amino acids connected to each other by peptide bonds). Proteins may contain parts other than amino acids (e.g., may be glycoproteins, proteoglycans, etc.) and / or may be processed or modified in other ways. It will be understood by those of ordinary skill in the art that a "protein" may be a complete polypeptide chain (with or without a signal sequence) such as produced by a cell, or may be a characteristic part thereof. It will be understood by those of ordinary skill that a protein may sometimes contain more than one polypeptide chain, for example, linked by one or more disulfide bonds or associated by other means. A polypeptide may contain L-amino acids, D amino acids, or both, and may contain any of various amino acid modifications or analogs known in the art. Useful modifications include, for example, terminal acetylation, amidation, methylation, and the like. In some embodiments, a protein may contain natural amino acids, non-natural amino acids, synthetic amino acids, and combinations thereof. The term "peptide" is generally used to refer to polypeptides having a length of less than about 100 amino acids, less than about 50 amino acids, less than 20 amino acids, or less than 10 amino acids. In some embodiments, the protein is an antibody, antibody fragment, biologically active portion thereof, and / or characteristic portion thereof.

[0093] Reference: As used herein, describes a standard or control relative to which comparison is made. For example, in some embodiments, a target agent, animal, individual, colony, sample, sequence, or value is compared to a reference or control agent, animal, individual, colony, sample, sequence, or value. In some embodiments, a reference or control is tested and / or determined substantially simultaneously with the target test or determination. In some embodiments, a reference or control is a historical reference or control, optionally embodied in a tangible medium. Typically, as will be understood by those skilled in the art, a reference or control is determined or characterized under conditions or circumstances comparable to the conditions or circumstances of the assessment. Those skilled in the art will understand when there is sufficient similarity to justify reliance on a particular possible reference or control and / or comparison with a particular possible reference or control.

[0094] Sample: As used herein, the term "sample" generally refers to an aliquot of a material obtained or derived from a target source as described herein. In some embodiments, the target source is a biological or environmental source. In some embodiments, the target source can be or include a cell or organism, such as a microorganism, a plant, or an animal (e.g., a human). In some embodiments, the target source is or includes a biological tissue or fluid. In some embodiments, the biological tissue or fluid can be or include amniotic fluid, aqueous humor, ascites, bile, bone marrow, blood, breast milk, cerebrospinal fluid, cerumen, chyle, chyme (chime), ejaculatory fluid, endolymph, exudate, feces, gastric acid, gastric juice, lymph, mucus, pericardial fluid, perilymph, peritoneal fluid, pleural effusion, pus, inflammatory secretions, saliva, sebum, semen, serum, smegma, sputum, synovial fluid, sweat, tears, urine, vaginal secretions, vitreous fluid, vomitus, and / or combinations thereof or one or more components. In some embodiments, biological fluid can be or include intracellular fluid, extracellular fluid, intravascular fluid (plasma), interstitial fluid, lymphatic fluid and / or transcellular fluid.In some embodiments, biological fluid can be or include plant exudate.In some embodiments, biological tissue or sample can be obtained by, for example, suction, biopsy (for example, fine needle or tissue biopsy), swab (for example, oral, nose, skin or vaginal swab), scraping, surgery, washing or lavage (for example, bronchoalveolar, duct, nose, eye, oral cavity, uterus, vagina or other washing or lavage).In some embodiments, biological sample is or includes the cell obtained from individual.In some embodiments, sample is " primary sample " obtained directly from target source by any appropriate means.In some embodiments, as will be clear from context, term " sample " refers to the preparation obtained by processing primary sample (for example, by removing one or more components therein and / or by adding one or more agents therein).For example, using semipermeable membrane filtration. Such a "processed sample" may include, for example, nucleic acids or proteins extracted from a sample, or nucleic acids or proteins obtained by subjecting a primary sample to one or more techniques, such as amplification or reverse transcription of nucleic acids, separation and / or purification of certain components, etc. In some embodiments, a sample may be a "crude" sample in that it has been subjected to relatively little processing, and / or the sample is complex in that it contains components of relatively diverse chemical classes.

[0095] Subject: As used herein, the term "subject" refers to an organism, such as a mammal (e.g., a human, a non-human mammal, a non-human primate, a primate, a laboratory animal, a mouse, a rat, a hamster, a gerbil, a cat, a dog). In some embodiments, the human subject is an adult, a teenager, or a pediatric subject. In some embodiments, the subject suffers from a disease, a disorder, or a condition, such as a disease, a disorder, or a condition that can be treated as provided herein, such as a cancer or a tumor listed herein. In some embodiments, the subject is susceptible to a disease, a disorder, or a condition; in some embodiments, the susceptible subject is susceptible to a disease, a disorder, or a condition and / or shows an increased risk of suffering from a disease, a disorder, or a condition (compared to the average risk observed in a reference subject or population). In some embodiments, the subject exhibits one or more symptoms of a disease, a disorder, or a condition. In some embodiments, the subject does not exhibit specific symptoms (e.g., clinical manifestations of the disease) or features of a disease, disorder, or condition. In some embodiments, the subject does not display any symptoms or features of a disease, disorder, or condition. In some embodiments, the subject is a patient. In some embodiments, a subject is an individual to whom a diagnostic and / or therapy is administered and / or has been administered.

[0096] DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS

[0097] In some aspects, the present disclosure provides compositions and methods for environmental amplification of target nucleic acids. In some embodiments, the target nucleic acid amplicons (ie, DNA cassettes) are detected after amplification.

[0098] In some aspects, the present disclosure provides systems that utilize nucleic acid sensor technologies that initially hybridize (and in some embodiments, in a target sequence-dependent manner) to a target nucleic acid of interest, and use these systems to generate a detectable output.

[0099] Composition

[0100] The present disclosure provides compositions that can be used for amplification of target nucleic acids. In some embodiments, the present disclosure provides compositions that can be used for amplification and detection of target nucleic acids.

[0101] In some embodiments, the present disclosure provides compositions that can be used to generate target amplicon (e.g., DNA cassette), prepare multiple copies of nucleic acid identical to target amplicon (e.g., DNA cassette), and detect at least one copy of nucleic acid identical or complementary to target amplicon (e.g., DNA cassette). In some embodiments, the compositions of the present disclosure can be used to generate multiple copies of single-stranded DNA cassettes (ssDNA) or nucleic acids identical or complementary to ssDNA cassettes, for example, at ambient temperature. In some embodiments, such compositions are used to generate multiple copies of single-stranded DNA cassettes (ssDNA) or nucleic acids identical or complementary to ssDNA cassettes, for example, under isothermal conditions (e.g., without temperature cycling). In some embodiments, compositions provided herein detect ssDNA cassettes, for example, at ambient temperature. In some embodiments, compositions provided herein detect ssDNA cassettes, for example, under isothermal conditions (e.g., without temperature cycling).

[0102] In some embodiments, the compositions provided herein comprise a target nucleic acid.

[0103] In some embodiments, compositions provided herein include oligonucleotide binders (e.g., primers and / or probes). In some embodiments, compositions provided herein include one or more oligonucleotide binders (e.g., primers and / or probes). In some embodiments, oligonucleotide binders of the present disclosure are designed to specifically bind to a target nucleic acid.

[0104] In some embodiments, the composition comprises a ligase.

[0105] In some embodiments, the composition comprises a reverse transcriptase.

[0106] In some embodiments, the composition comprises a shearing enzyme. In some embodiments, the composition comprises a restriction enzyme. In some embodiments, the composition comprises a nicking enzyme.

[0107] In some embodiments, the composition comprises a single-chain binding protein.

[0108] In some embodiments, the composition comprises a strand-displacing polymerase.

[0109] In some embodiments, the composition comprises dNTPs. In some embodiments, the composition comprises one or more modified dNTPs.

[0110] In some embodiments, components and compositions for detecting multiple copies of ssDNA boxes or nucleic acids identical or complementary to ssDNA boxes are also included in the compositions of the present disclosure. In some embodiments, the compositions according to the present disclosure include a detectably labeled nucleic acid probe, a guide nucleic acid, and a Cas enzyme (e.g., a Cas enzyme with incidental cleavage activity).

[0111] sample

[0112] In some embodiments, the sample comprises a target nucleic acid. In some embodiments, the sample is an environmental sample. In some embodiments, the sample is a biological sample. In some embodiments, the sample is from a subject. In some embodiments, the sample is from a human subject. In some embodiments, the sample is blood, saliva, sputum, mucus, urine, or feces. In some embodiments, the sample is a swab of a surface in or on a human body. In some embodiments, the sample is a swab of a mucosal surface or membrane. In some embodiments, the sample is a nasal swab, a cheek swab, a cervical swab, a vulvovaginal swab, or a throat swab.

[0113] In some embodiments, the sample is processed. In some embodiments, the sample is processed to separate the components of the sample. In some embodiments, the sample is processed to separate nucleic acids (e.g., RNA and / or DNA). In some embodiments, the sample is processed to separate RNA. In some embodiments, the sample is processed to separate DNA. In some embodiments, the sample is processed to separate double-stranded nucleic acids into single-stranded nucleic acids.

[0114] In some embodiments, the sample is prepared or processed to provide a nucleic acid preparation. In some embodiments, the sample is prepared or processed using a lysis buffer. In some embodiments, such as Fig.26 In some embodiments, the sample is prepared as in the lysis buffer. In some embodiments, the lysis buffer comprises a detergent. In some embodiments, a zwitterionic detergent (e.g., as in Example 1) is used to lyse (e.g., process) a sample (e.g., a virion and / or a cell). In some embodiments, a zwitterionic detergent as described in 63 / 358,044, which is mentioned together with the present application and incorporated herein by reference, is used to lyse (e.g., process) a sample (e.g., a virion and / or a cell). In some embodiments, such a zwitterionic detergent is selected from the group consisting of LAPAO, LDAO and DDAO. Certain detergents show surprising effectiveness (e.g., certain zwitterionic detergents, such as LAPAO, LDAO and DDAO) for use in lysing virions and / or releasing nucleic acids from virions, thereby obtaining nucleic acid preparations. Among other things, the advantages of certain embodiments of the provided lysis technology may include providing useful nucleic acid preparations without the need to use one or more traditional processing steps, such as purification, separation or extraction steps that are usually required or utilized to remove detergents.

[0115] In some embodiments, the concentration of the zwitterionic detergent is in the range of 0.01% to 10%. In some embodiments, the lysis buffer comprises a zwitterionic detergent and HCl. In some embodiments, the concentration of HCl is in the range of 4mM to 4M. In some embodiments, the pH of the lysis buffer is in the range of 0 to 6. In some embodiments, the zwitterionic detergent is selected from the group consisting of LAPAO, LDAO and DDAO. In some embodiments, the concentration of LAPAO is in the range of 0.01% to 10%. In some embodiments, the concentration of LDAO is in the range of 0.02% to 4%. In some embodiments, the lysis buffer further comprises sodium decanoate.

[0116] Fig. 27 Exemplary lysis and nucleic acid processing steps at ambient temperature are shown. As depicted, a sample containing pooled human saliva plus inactivated whole virus in a cell lysate matrix is ​​first treated with a lysis buffer (e.g., containing a zwitterionic detergent) and then, with conventional processing or "clean-up" steps, treated with a "ligation solution". A nucleic acid preparation suitable for sensitive detection techniques is produced.

[0117] In some embodiments, sodium hydroxide (NaOH) is used to crack (e.g., process) a sample (e.g., a virion and / or a cell). In some embodiments, NaOH is used to crack a sample at ambient temperature (e.g., room temperature). In some embodiments, the concentration of NaOH is about 1mM NaOH to about 200mM NaOH. In some embodiments, the concentration of NaOH is about 10mM NaOH to about 100mM. In some embodiments, NaOH is used to crack a sample for about 1 second to about 10 minutes, such as about 10 seconds to about 8 minutes, such as about 1 minute to about 5 minutes, such as about 2 minutes to about 4 minutes. In some embodiments, NaOH is used to treat a sample to inhibit or reduce RNA enzyme activity. In some embodiments, NaOH releases viral nucleic acid from a viral sample. In some embodiments, NaOH denatures double-stranded DNA or RNA (e.g., separates strands).

[0118] In some embodiments, potassium hydroxide (KOH) is used to lyse (e.g., process) a sample (e.g., a virus particle and / or a cell). In some embodiments, a sample comprising DNA (e.g., dsDNA) is treated with KOH. In some embodiments, the sample is lysed with KOH at ambient temperature (e.g., room temperature). In some embodiments, the concentration of KOH is from about 1mM KOH to about 200mM KOH. In some embodiments, the concentration of KOH is from about 10mM KOH to about 100mM. In some embodiments, the sample is lysed with KOH for about 1 second to about 10 minutes, such as from about 10 seconds to about 8 minutes, such as from about 1 minute to about 5 minutes, such as from about 2 minutes to about 4 minutes. In some embodiments, the sample is treated with KOH to inhibit or reduce RNA enzyme activity. In some embodiments, KOH releases viral nucleic acid from a viral sample. In some embodiments, KOH denatures double-stranded DNA or RNA (e.g., separates strands). In some such embodiments, KOH denatures and separates dsDNA and produces ssDNA.

[0119] In some embodiments, a sample may be a "crude" sample in that it has been subjected to relatively little processing, and / or the sample may be complex in that it contains components of relatively diverse chemical classes.

[0120] In some embodiments, the cell-free extract is a crude extract.In some embodiments, the cell-free extract is produced by a cell-free protein expression system such as, but not limited to, PURExpress.

[0121] Target nucleic acid

[0122] In some embodiments, the technology provided herein (e.g., method or composition) amplifies and / or detects one or more target nucleic acids. In some embodiments, the target nucleic acid is deoxyribonucleic acid (DNA). In some embodiments, the target nucleic acid is ribonucleic acid (RNA). In some embodiments, the target nucleic acid is single-stranded. In some embodiments, the target nucleic acid is double-stranded.

[0123] Those skilled in the art know methods for generating ssDNA from RNA (e.g., reverse transcriptase) or sdDNA (heat denaturation or KOH denaturation). In some embodiments, the target RNA is converted to ssDNA. In some embodiments, the target dsDNA is converted to ssDNA.

[0124] In some embodiments, the target nucleic acid is present in the sample. In some embodiments, the sample comprises one or more target nucleic acids. In some embodiments, the sample comprises one or more target nucleic acids and nucleic acids other than the one or more target nucleic acids. In some embodiments, the target nucleic acid is from a eukaryotic organism. In some embodiments, the target nucleic acid is from a prokaryotic organism. In some embodiments, the target nucleic acid is parasitic (e.g., protozoa), bacteria, virus, or fungi. In some embodiments, the target nucleic acid is a human nucleic acid.

[0125] In some embodiments, the target nucleic acid comprises a target nucleic acid region. In some embodiments, the target nucleic acid region is a nucleotide sequence to be amplified and / or detected by the methods and compositions provided herein.

[0126] In some embodiments, the target nucleic acid comprises one or more restriction enzyme recognition sequences. In some embodiments, the target nucleic acid comprises two or more restriction enzyme recognition sequences. In some embodiments, one or more restriction enzyme recognition sequences are native restriction enzyme recognition sequences, i.e. such restriction enzyme recognition sequences are naturally present in the target nucleic acid and are not added by any manipulation or amplification of the target nucleic acid. In some embodiments, the target nucleic acid comprises a restriction enzyme recognition sequence located upstream or 5' of the target nucleic acid region and a restriction enzyme recognition sequence located downstream or 3' of the target nucleic acid region.

[0127] In some embodiments, the restriction enzyme recognition sequence is a nickase recognition sequence. In some embodiments, the target nucleic acid comprises a nickase recognition sequence (e.g., a native nickase recognition sequence). In some embodiments, the target nucleic acid comprises one or more nickase recognition sequences (e.g., a native nickase recognition sequence). In some embodiments, the target nucleic acid comprises one or more nickase recognition sequences (e.g., a native nickase recognition sequence). In some embodiments, the target nucleic acid comprises a nickase recognition sequence positioned at the target nucleic acid region upstream or 5' and a nickase recognition sequence positioned at the target nucleic acid region downstream or 3'.

[0128] In some embodiments, target nucleic acid does not include restriction enzyme recognition sequence (e.g., nickase recognition sequence) or part thereof. In some embodiments, by complete restriction enzyme recognition sequence (e.g., nickase recognition sequence) or part restriction enzyme recognition sequence (e.g., nickase recognition sequence), or its complement is added into the target nucleic acid sequence as provided below (e.g., by primer and / or probe).

[0129] In some embodiments, the target nucleic acid comprises one or more sequences capable of hybridizing with one or more oligonucleotide binders. In some embodiments, the target nucleic acid comprises at least one oligonucleotide binding sequence (i.e., a sequence capable of hybridizing with an oligonucleotide binder). In some embodiments, the target nucleic acid comprises two oligonucleotide binding sequences. In some embodiments, the target nucleic acid comprises a first oligonucleotide binding sequence and a second oligonucleotide binding sequence. For example, the target nucleic acid may comprise a first oligonucleotide binding sequence and a reverse complement of a second oligonucleotide binding sequence, wherein the first oligonucleotide binding sequence and the reverse complement of the second oligonucleotide binding sequence are located on both sides of the target nucleic acid region. The target nucleic acid region refers to a sequence that is specifically amplified in the target nucleic acid. In some embodiments, the oligonucleotide binding sequence is a primer binding sequence. In some embodiments, the oligonucleotide binding sequence is a probe binding sequence.

[0130] In some embodiments, the oligonucleotide binding sequence comprises about 10 to about 16 nucleotides. In some embodiments, the nucleotides in the oligonucleotide binding sequence are consecutive nucleotides in the primary sequence of the target nucleic acid (i.e., there are no additional intervening nucleotides or other molecules between consecutive nucleotides). In some embodiments, the oligonucleotide binding sequence comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16 nucleotides. In some embodiments, the oligonucleotide binding sequence comprises at most 16, at most 15, at most 14, at most 13, at most 12, at most 11, at most 10 nucleotides.

[0131] Oligonucleotide binder

[0132] In some embodiments, the compositions and methods of the present disclosure include one or more oligonucleotide binders (e.g., probes or primers). In some embodiments, the compositions and methods of the present disclosure include one or more primers (e.g., forward primers, reverse primers, strand displacement amplification (SDA) primers, or combinations thereof). In some embodiments, the compositions and methods of the present disclosure include one or more probes (e.g., first probes, second probes, or combinations thereof). In some embodiments, the compositions and methods of the present disclosure include one or more probes and one or more primers.

[0133] In some embodiments, the compositions and methods provided herein utilize one or more oligonucleotide binders to generate target amplicons, such as ssDNA cassettes.

[0134] In some embodiments, the compositions and methods provided herein utilize one or more oligonucleotide binders to amplify target nucleic acid sequences and / or ssDNA cassettes.

[0135] In some embodiments, the compositions and methods provided herein utilize one or more oligonucleotide binders to detect a target nucleic acid or a copy thereof.

[0136] In some embodiments, the oligonucleotide binder comprises a sequence complementary to the target nucleic acid. In some embodiments, the oligonucleotide binder comprises a sequence complementary to the SDA primer or a portion thereof (e.g., an SDA primer binding sequence). In some embodiments, the oligonucleotide binder comprises an SDA primer binding sequence. In some embodiments, the oligonucleotide binder comprises a stabilizing sequence. In some embodiments, the oligonucleotide binder comprises a blocking molecule. In some embodiments, the oligonucleotide binder comprises a nickase recognition site or a partial nickase recognition site, or a complement thereof. In some embodiments, the oligonucleotide binder (e.g., a probe) comprises one or more components encoding a reporter element component.

[0137] Target complementary sequence

[0138] In some embodiments, an oligonucleotide binder (eg, a primer or a probe) comprises a sequence that is complementary to a target nucleic acid sequence.

[0139] In some embodiments, the oligonucleotide binder comprises a sequence complementary to a target nucleic acid sequence comprising a native restriction enzyme recognition sequence or a portion thereof. In some embodiments, the oligonucleotide binder comprises a sequence complementary to a native restriction enzyme recognition sequence (e.g., a first native restriction enzyme recognition sequence and / or a second native restriction enzyme recognition sequence) or a portion thereof.

[0140] In some embodiments, the portion of the oligonucleotide binder sequence that is complementary to the target nucleic acid sequence is located at the 3' end of the oligonucleotide binder.

[0141] In some embodiments, the sequence complementary to the target nucleic acid sequence (e.g., oligonucleotide binding subsequence) is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% complementary to the target nucleic acid sequence. In some embodiments, the sequence complementary to the target nucleic acid sequence is 100% complementary to the target nucleic acid.

[0142] In some embodiments, the sequence complementary to the target nucleic acid sequence (e.g., a portion of an oligonucleotide binding subsequence complementary to the target nucleic acid sequence) comprises from about 5 to about 16 nucleotides. In some embodiments, the sequence complementary to the target nucleic acid sequence comprises at least 5 nucleotides, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16 nucleotides. In some embodiments, the nucleic acid sequence complementary to the target nucleic acid comprises at most 16 nucleotides, at most 15, at most 14, at most 13, at most 12, at most 11, at most 10, at most 9, at most 8, at most 7, at most 6, at most 5 nucleotides.

[0143] Restriction enzyme recognition sequence

[0144] In some embodiments, the oligonucleotide binder comprises a complete restriction enzyme recognition sequence or a sequence complementary thereto. In some embodiments, the oligonucleotide binder comprises a partial restriction enzyme recognition sequence or a sequence complementary thereto.

[0145] In some embodiments, the oligonucleotide binder comprises a complete nickase recognition sequence or a sequence complementary thereto. In some embodiments, the oligonucleotide binder comprises a partial nickase recognition sequence or a sequence complementary thereto.

[0146] In some embodiments, the nickase recognition sequence is or comprises a nucleotide sequence listed in Table 1 or a sequence complementary thereto. In some embodiments, the partial nickase recognition sequence comprises a portion of a nickase recognition sequence listed in Table 1 or a sequence complementary thereto. Nickase recognition sequence and nickase recognition site are used interchangeably herein.

[0147] In some embodiments, the nickase recognition sequence is about 3 to about 7 nucleotides. In some embodiments, the nickase recognition sequence is 3 nucleotides. In some embodiments, the nickase recognition sequence is 4 nucleotides. In some embodiments, the nickase recognition sequence is 5 nucleotides. In some embodiments, the nickase recognition sequence is 6 nucleotides. In some embodiments, the nickase recognition sequence is 7 nucleotides.

[0148] In some embodiments, the nickase recognition sequence comprises two cytosine nucleotides followed by a thymine, guanine, or adenine nucleotide.

[0149] SDA primer binding sequence

[0150] In some embodiments, the oligonucleotide binder (e.g., primer or probe) comprises an SDA primer binding sequence. In some embodiments, the SDA primer binding sequence is located at the 5' end of the oligonucleotide binder. In some embodiments, the SDA primer binding sequence comprises or consists of about 8 to about 12 nucleotides. In some embodiments, the SDA primer binding sequence comprises at least 8 nucleotides, at least 9, at least 10, at least 11, at least 12 nucleotides. In some embodiments, the SDA primer binding sequence comprises up to 12 nucleotides, up to 11, up to 10, up to 9, up to 8 nucleotides.

[0151] In some embodiments, the SDA primer binding sequence comprises a complete restriction enzyme recognition sequence (e.g., a nickase recognition sequence) or its complement. In some embodiments, the SDA primer binding sequence comprises a partial restriction enzyme recognition sequence (e.g., a portion of a nickase recognition sequence) or its complement. In some embodiments, the nickase recognition sequence is or comprises a nucleotide sequence listed in Table 1 or its complement. In some embodiments, the partial nickase recognition sequence comprises a portion of a nickase recognition sequence listed in Table 1 or a sequence complementary thereto.

[0152] In some embodiments, the SDA primer binding sequence comprises (i) a complete restriction enzyme recognition sequence (e.g., a nickase recognition sequence), a partial restriction enzyme recognition sequence (e.g., a nickase recognition sequence), or a complement thereof; and (ii) a further SDA primer binding sequence. In some embodiments, the further SDA primer binding sequence comprises about 2 to about 6 nucleotides. In some embodiments, the further SDA primer binding sequence is complementary to a target nucleic acid sequence (e.g., complementary to a nucleotide sequence adjacent to an oligonucleotide binding sequence within a target nucleic acid).

[0153] Stabilization sequence

[0154] In some embodiments, the oligonucleotide binder comprises a stabilizing sequence. In some embodiments, the stabilizing sequence extends from the 5' end of the oligonucleotide binder. In some embodiments, the stabilizing sequence comprises about 8 to about 20 nucleotides. In some embodiments, the stabilizing sequence comprises at least 8 nucleotides, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20 nucleotides. In some embodiments, the stabilizing sequence comprises up to 20 nucleotides, up to 19, up to 18, up to 17, up to 16, up to 15, up to 14, up to 13, up to 12, up to 11, up to 10, up to 9, up to 8 nucleotides.

[0155] In some embodiments, the stabilizing sequence comprises a partial restriction enzyme recognition sequence (e.g., a nickase recognition sequence). In some embodiments, the stabilizing sequence comprises a partial restriction enzyme recognition sequence (e.g., a nickase recognition sequence) and an additional nucleotide sequence. In some embodiments, the length of such an additional sequence is about 2 to about 20 nucleotides. In some embodiments, the nucleotides of the additional sequence may be any nucleotides that do not form a complete restriction enzyme recognition sequence (e.g., a nickase recognition sequence) alone or together with a restriction enzyme recognition sequence (e.g., a partial nickase recognition sequence). In some embodiments, the stabilizing sequence does not comprise a restriction enzyme recognition sequence (e.g., a partial nickase recognition sequence) or a complete restriction enzyme recognition sequence (e.g., a nickase recognition sequence).

[0156] In some embodiments, the stabilizing sequence includes an RNA polymerase binding sequence. In some embodiments, the stabilizing sequence is or comprises a T7 RNA polymerase promoter. In some embodiments, the RNA polymerase binding sequence is a eukaryotic RNA polymerase binding sequence. In some embodiments, the RNA polymerase binding sequence is a bacteriophage RNA polymerase binding sequence. In some embodiments, the RNA polymerase binding sequence is an RNA polymerase I, RNA polymerase II, RNA polymerase III, RNA polymerase IV, RNA polymerase V, Nr virus particle RNA polymerase, or T7 RNA polymerase binding sequence. In some embodiments, the RNA polymerase binding sequence is a T7 RNA polymerase binding sequence. In some embodiments, the RNA polymerase binding sequence is a bacterial RNA polymerase binding sequence. In some embodiments, the T7 RNA polymerase promoter is or comprises TAATACGACTC ACTATAGG (SEQ ID NO: 70).

[0157] In some embodiments, the stabilizing sequence is a linear single-stranded sequence.

[0158] In some embodiments, the stabilizing sequence is a hairpin stabilizer. In some embodiments, the hairpin stabilizer comprises a hairpin-loop structure, i.e., the stabilizing sequence adopts a folded form, wherein the 5' end of the stabilizing sequence or a portion thereof hybridizes with the 3' end of the hybridization sequence or a portion thereof (e.g., a stem stabilizer). In some embodiments, the folded form includes a stabilizer stem portion and a stabilizer loop portion. In some embodiments, the stabilizer loop is single-stranded. In some embodiments, the stabilizer stem is double-stranded. Exemplary hairpin stabilizing sequences are shown in Figure 39.

[0159] Blocking molecules

[0160] In some embodiments, an oligonucleotide binder (eg, a primer, such as an SDA primer) comprises a 3' blocking molecule.

[0161] In some embodiments, the blocking molecule blocks extension of the SDA primer in the 3' direction (e.g., prevents the extension of the nucleotide sequence from continuing) by chemically modifying the 3'OH group of the 3' terminal nucleotide of the SDA primer. In some embodiments, the 3'OH chemical modification blocks the strand displacement polymerase from adding additional nucleotides to the 3' terminal nucleotide of the primer.

[0162] In some embodiments, 3' blocking molecules can also inhibit exponential amplification of primer dimers.

[0163] In some embodiments, the 3' blocking molecule blocks extension of the SDA primer in the 3' direction when bound to the 3' end of the primer. In some embodiments, the blocking molecule binds to the 3' OH group of the 3' terminal nucleotide of the primer.

[0164] In some embodiments, the blocking molecule is selected from the group consisting of 3' ddNTP, 3' inverted dT, 3' carbon chain spacer, 3' hexanediol, 3' amino spacer, and 3' phosphorylation.

[0165] In some embodiments, the 3' ddNTP is a dideoxynucleotide triphosphate that does not have a 3' OH group required for elongation. In some embodiments, the deoxynucleotide triphosphate is selected from the group consisting of ddTTP, ddATP, ddGTP, and ddCTP.

[0166] In some embodiments, the 3' inverted dT has a 3'-3' linkage that inhibits extension.

[0167] In some embodiments, the 3' carbon chain spacer is a carbon chain that blocks the extension from binding to the 3' OH group. In some embodiments, the length of the carbon chain spacer can be 3C, 4C, 5C, 6C, 7C, 8C, 9C, 10C, 11C, 12C or longer.

[0168] In some embodiments, 3' hexanediol is a C6 diol chain that blocks the extension and is bound to the 3' OH group.

[0169] In some embodiments, the 3' amino spacer is bound to the 3' OH group required for extension of the oligonucleotide binder. In some embodiments, the 3' amino spacer is a 4C, 5C, 6C, 7C, 8C, 9C, 10C, 11C, 12C or more carbon chain with a methoxy group located on C1 and an NH2 group bound to the last carbon of the spacer.

[0170] In some embodiments, the 3' phosphorylation is a phosphate group attached to the 3' OH required for elongation.

[0171] In some embodiments, the blocking molecule is hexanediol (3C6). In some embodiments, the blocking molecule is 3SpC3.

[0172] Sensor components

[0173] In some embodiments, the oligonucleotide binder (e.g., probe) comprises a first and / or second nucleic acid sensor component. In some embodiments, the first probe comprises a first sensing component. In some embodiments, the second probe comprises a second sensing component. The probe pair used herein may include a nucleic acid sensor group. The nucleic acid sensor group includes at least a first nucleic acid sensor component and a second nucleic acid sensor component.

[0174] In some embodiments, the first nucleic acid sensor component comprises a sequence that serves as, encodes, or templates at least one reporter element. In some embodiments, the second nucleic acid sensor component comprises a sequence that serves as, encodes, or templates at least one reporter element. The first and second nucleic acid sensor components are related to each other because when the system is contacted with a sample comprising a target nucleic acid, hybridization of the target nucleic acid with both the first and second nucleic acid sensor components juxtaposes the first and second nucleic acid sensor components to each other, making the juxtaposed components susceptible to linkage by one or more of the following: (i) linkage for producing a linked product and / or (ii) templated responses for producing a linked template product (e.g., they form a "nicked arrangement").

[0175] In some embodiments, one or both nucleic acid sensor components may include a templating element that directs the synthesis of a single complete strand complementary to the nicked arrangement. For example, where the templating element is or includes a promoter and / or one or more transcriptional regulatory elements, the system may be or include an RNA polymerase; where the templating element is or includes an origin of replication and / or a binding site for an extendable primer, the system may be or include a DNA polymerase (which in some embodiments may be a thermostable DNA polymerase, particularly if the juxtaposed strands include a sequence element corresponding to a second extendable primer, and the system includes an appropriate primer pair to amplify a duplex of the juxtaposed strands and their complements).

[0176] In some embodiments, the linkage of the first and second nucleic acid sensor components produces a nucleic acid chain (i.e., a linked chain) that includes both the first reporter element and the second reporter element (or their complements) that is a reporter because it or its complement (e.g., produced by transcription or elongation [e.g., initiated elongation]), or the expression product of either (e.g., produced by transcription and / or translation) is detectable or otherwise produces or participates in the production of a detectable signal indicating the presence and / or amount of the target nucleic acid in the sample.

[0177] In some embodiments, the linked strands can be transcribed and / or translated (eg, via cell-free components, such as a cell-free protein synthesis expression system (CFPS)).

[0178] In some embodiments, a linkage as provided herein produces a detectable output. In some embodiments, such a detectable output is or is produced by a polypeptide. In some embodiments, the detectable output may be or include a catalytic output; in some embodiments, the detectable output may be or include a non-catalytic output.

[0179] In some embodiments, the catalytic output is or is produced by an enzyme that catalyzes a reaction (e.g., converts one or more substrates into one or more detectable substances). In some embodiments, the non-catalytic output is or produces a detectable nucleic acid or polypeptide (e.g., a detectable nucleic acid or polypeptide that acts as an antigen or other specific binding partner).

[0180] Among other things, the present disclosure provides a technology format that can detect outputs suitable for lateral flow analysis (e.g., for, containing, or producing a product that can be detected by lateral flow). In some embodiments, the present disclosure provides the following insights: combining linkage-mediated detection techniques with lateral flow assessment techniques can particularly facilitate multiplexed analysis (e.g., simultaneously detecting multiple products suitable for lateral flow). In addition, the present disclosure teaches that such a combination can have specific advantages that allow for effective multiplexed analysis of products of different chemical classes (e.g., two or more of nucleic acids, metals, polypeptides, small molecules, antibodies, or fragments thereof, etc.).

[0181] In some embodiments, the sensing element is positioned adjacent to the binder hybridization sequence.

[0182] In some embodiments, the technology provided herein may include one or more bridging oligonucleotides (e.g., which may be referred to as "gap filling oligonucleotides ("GFO")) that hybridize to a target site between other (e.g., first and second) nucleic acid sensor components. In some embodiments, a probe set, such as a first probe and a second probe, comprises a nucleic acid sensor that comprises only two (i.e., first and second) nucleic acid sensor components. In some embodiments, the technology provided herein may include one or more bridging oligonucleotides that hybridize to a target site between a first and a second nucleic acid sensor.

[0183] In some embodiments, the GFO can reduce background or off-target signals. In some embodiments, in the absence of the GFO, the connection of the first nucleic acid sensor component and the second nucleic acid sensor component does not produce a detectable output. In some embodiments, the output generated by the connection of the first nucleic acid sensor component and the second nucleic acid sensor component in the absence of the GFO is not a reporter element. In some embodiments, the output generated by the connection of the first nucleic acid sensor component and the GFO or the second nucleic acid sensor component and the GFO is not a reporter element.

[0184] In some embodiments, the GFO comprises a primer element. In some embodiments, the linkage of the first nucleic acid sensor component, the second nucleic acid sensor component, and the GFO produces a nucleic acid chain (i.e., a linked chain) that includes both the first reporter element and the second reporter element (or their complements), which is a reporter because it or its complement (e.g., produced by transcription or extension [e.g., primed extension]), or the expression product of either (e.g., produced by transcription and / or translation) is detectable or otherwise produces or participates in the production of a detectable signal indicating the presence and / or amount of the target nucleic acid in the sample. In some embodiments, the linked chain is amplified (e.g., by polymerase chain reaction, such as isothermal rolling circle amplification). In some embodiments, the amplification utilizes at least the primer element in the GFO.

[0185] In some embodiments, the GFO comprises one or more nucleic acid sensor components comprising one or more sequences that act as, encode or template at least one reporter element. In some embodiments, the GFO comprises one or more sequences that act as, encode or template at least one reporter element.

[0186] Modification

[0187] In some embodiments, the oligonucleotide binders provided herein comprise one or more modified nucleotides (eg, modified ribonucleotides, modified deoxyribonucleotides, or a combination thereof).

[0188] In some embodiments, the oligonucleotide binder is modified so that a nuclease resistance modification is used to protect the phosphodiester bond of the restriction enzyme recognition sequence on one of the chains. In some embodiments, the nuclease resistance modification comprises a phosphorothioate (PTO), a boranophosphate, a methyl phosphoester, or a peptide internucleotide linkage. In some embodiments, a modified internucleotide linkage, such as a PTO linkage, can be chemically synthesized within an oligonucleotide probe and a primer, or incorporated into a double-stranded nucleic acid by a polymerase, such as by using one or more alpha thiol-modified deoxynucleotides. In some embodiments, the oligonucleotide is a modified oligonucleotide in which the internucleotide linkage is a PTO linkage.

[0189] In some embodiments, the dNTPs provided herein comprise one or more modified nucleotides.

[0190] In some embodiments, the modified nucleotide is selected from the group consisting of alpha thiol nucleotides, borano derivatives, 2'-O-methyl (2'OMe) modified bases and 2'-fluoro bases. In some embodiments, the oligonucleotide binder comprises one or more alpha nucleotide binders. The technician will understand that restriction enzymes can cut both chains in a double-stranded DNA. In some embodiments, incorporating modified nucleotides into one chain of double-stranded DNA can prevent restriction enzymes from cutting both chains. In some embodiments, incorporating modified nucleotides into one chain of double-stranded DNA can allow restriction enzymes to only cut the unmodified chain while keeping the modified chain intact.

[0191] In some embodiments, the modified nucleotide is a peptide nucleic acid (PNA). In some embodiments, the modified nucleotide is a locked nucleic acid (LNA). Peptide nucleic acid, locked nucleic acid or a combination thereof can be used to change the primer Tm and / or specificity. Primers comprising peptide nucleotides, locked nucleotides or a combination are particularly useful in detecting a target nucleotide sequence with one or more SNP sites to increase specificity.

[0192] In some embodiments, the modified nucleotide is a 2'-fluoro nucleic acid or a 2'-O-methyl nucleic acid. Primers comprising a 2'-fluoro-nucleic acid modification, a 2'-O-methyl-nucleic acid modification, or a combination thereof have increased nuclease resistance compared to unmodified primers, as well as increased Tm of the domains of the 2'-fluoro-nucleic acid modification and / or one or more 2'-O-methyl-nucleotide modification.

[0193] In some embodiments, the modified deoxyribonucleotide is a thiophosphate deoxyribonucleotide. In some embodiments, the modified deoxyribonucleotide is a phosphodiester deoxyribonucleotide. In some embodiments, the modified deoxyribonucleotide as provided herein destabilizes the helix. In some embodiments, relative to a control without modified deoxyribonucleotides, a nucleic acid comprising modified deoxyribonucleotides melts at a lower temperature. In some embodiments, relative to a control without modified deoxyribonucleotides, a nucleic acid comprising modified deoxyribonucleotides can be amplified at a lower temperature.

[0194] In some embodiments, the primer comprises a modified nucleotide replacing at least one guanine or adenine. In some embodiments, the modified nucleotide is a 2-aminopurine (e.g., a purine analog of guanine and adenine). In some embodiments, a primer comprising a 2-aminopurine can be used for fluorescence readout.

[0195] In some embodiments, one or more of the modifications listed herein provide a primer that is more resistant to nucleases and / or proteases than a primer or other nucleotide without any modification.

[0196] Exemplary Oligonucleotides

[0197] Reverse primer

[0198] In some embodiments, the compositions and methods of the present disclosure include one or more reverse primers. In some embodiments, the oligonucleotide binder is a reverse primer. In some embodiments, the reverse primer includes a nucleic acid sequence complementary to a target nucleic acid (e.g., an RNA target polynucleotide). In some embodiments, the reverse primer includes a sequence complementary to the target nucleic acid at the 3' end of the reverse primer. In some embodiments, the reverse primer includes an SDA primer binding sequence. In some embodiments, the reverse primer includes a stabilization sequence.

[0199] In some embodiments, the reverse primer comprises a stabilizing sequence, an SDA primer binding sequence, and a sequence complementary to the target nucleic acid from the 5' end to the 3' end. In some embodiments, the stabilizing sequence and the SDA primer binding sequence are separated by one or more nucleotides. In some embodiments, the SDA primer binding sequence and the nucleic acid sequence complementary to the target nucleic acid are separated by one or more nucleotides. In some embodiments, the stabilizing sequence comprises a partial nickase recognition sequence or its complement. In some embodiments, the stabilizing sequence and the SDA primer binding sequence together form a complete restriction enzyme recognition sequence (e.g., a nickase recognition sequence). In some embodiments, the stabilizing sequence comprises a restriction enzyme recognition sequence (e.g., a complete nickase recognition sequence).

[0200] In some embodiments, the reverse primer comprises a complete restriction enzyme recognition sequence (e.g., a complete nickase recognition sequence) or its complement. In some embodiments, the reverse primer comprises a partial restriction enzyme recognition sequence (e.g., a nickase recognition sequence) or its complement.

[0201] Forward Primer

[0202] In some embodiments, the compositions and methods of the present disclosure include one or more forward primers. In some embodiments, the oligonucleotide binder is a forward primer. In some embodiments, the forward primer includes a nucleic acid sequence complementary to a target nucleic acid (e.g., an RNA and / or DNA target polynucleotide). In some embodiments, the sequence complementary to the target nucleic acid is at the 3' end of the forward primer. In some embodiments, the forward primer includes an SDA primer binding sequence.

[0203] In some embodiments, the forward primer comprises an SDA primer binding sequence and a nucleic acid sequence complementary to the target nucleic acid from the 5' end to the 3' end. In some embodiments, the SDA primer binding sequence and the nucleic acid sequence complementary to the target nucleic acid are separated by one or more nucleotides. In some embodiments, the SDA primer binding sequence comprises a partial restriction enzyme recognition sequence (e.g., a partial nickase recognition sequence).

[0204] In some embodiments, the forward primer comprises a portion of a restriction enzyme recognition sequence (eg, a portion of a nickase recognition sequence).

[0205] Bump Primer

[0206] In some embodiments, the compositions and methods of the present disclosure include one or more bump primers. In some embodiments, the bump primer is complementary to the target nucleic acid sequence and binds upstream of the primer (i.e., at the 5' end of the target nucleic acid relative to the binding to the primer). In some embodiments, the bump primer is useful when separating the newly synthesized DNA strand from its template. In some embodiments, the bump primer binds to the DNA template upstream of the forward primer, and thereby separates the synthetic strand ssDNA produced by the forward primer.

[0207] In some embodiments, when the sample is lysed using KOH, one or more bump primers are not used.

[0208] Probe

[0209] In some embodiments, the compositions and methods of the present disclosure comprise one or more probes. In some embodiments, an oligonucleotide is a probe. In some embodiments, the probe comprises a nucleic acid sequence complementary to a target nucleic acid. In some embodiments, the probe comprises an SDA primer binding sequence. In some embodiments, the probe comprises a first and / or second nucleic acid sensor component, as described above. In some embodiments, when the first and second nucleic acid sensor components are linked together, they produce an ssDNA box encoding at least one reporter and comprising one or more SDA primer binding sequences.

[0210] The probe is a probe as described in the following: PCT Publication WO 2020 / 037038, entitled “In vitro detection of nucleic acid” and published on February 20, 2020; PCT Publication WO 2020 / 191376, entitled “System” and published on September 24, 2020; PCT Publication WO2021 / 050560, entitled “System” and published on March 18, 2021, the contents of each of which are incorporated herein by reference in their entirety.

[0211] In some embodiments, the probe comprises a restriction enzyme recognition sequence (eg, a nickase recognition sequence). In some embodiments, the probe comprises a portion of a restriction enzyme recognition sequence (eg, a portion of a nickase recognition sequence).

[0212] In some embodiments, the capture probe is a biotinylated capture probe. In some embodiments, the capture probe has a 5' biotin modification. In some embodiments, the capture probe is about 10 to about 20 nucleotides. In some embodiments, the capture probe comprises a 3' blocking molecule. In some embodiments, the capture probe comprises a stabilization sequence (e.g., a linear single-stranded sequence, a hairpin stabilizer, or a combination thereof). In some embodiments, the capture probe comprises a restriction enzyme recognition sequence, such as a nickase recognition sequence. In some embodiments, the restriction enzyme recognition sequence and / or the nickase recognition sequence comprises one or more modifications (e.g., a PTO bond). In some embodiments, the capture probe comprises a target nucleic acid sequence or its complement. In some embodiments, the capture probe comprises a repeat bar pull-down sequence. In some embodiments, the bar pull-down sequence is the nucleotide sequence of SEQ ID NO:71 (TGTATGTATGTATGA).

[0213] In some embodiments, the probe is a conjugate probe. In some embodiments, the conjugate capture probe is about 10 to about 20 nucleotides. In some embodiments, the conjugate capture probe comprises a target nucleic acid sequence or its complement. In some embodiments, the conjugate capture probe comprises a repeating bar pull-down sequence. In some embodiments, the bar pull-down sequence is the nucleotide sequence of SEQ ID NO: 71.

[0214] Strand displacement amplification (SDA) primers

[0215] In some embodiments, the compositions and methods provided herein comprise one or more strand displacement amplification (SDA) primers. In some embodiments, the use of one or more short capped SDA primers during SDA amplification can prevent nonspecific dimerization at low temperatures where DNA hybridization specificity is low.

[0216] In some embodiments, the oligonucleotide binder is an SDA primer. In some embodiments, the SDA primer comprises a nucleotide sequence complementary to the target nucleic acid sequence. In some embodiments, the SDA primer comprises a sequence complementary to a native restriction enzyme recognition sequence (e.g., a native nickase recognition sequence). In some embodiments, the SDA primer comprises a nucleotide sequence complementary to the SDA primer binding sequence. In some embodiments, the SDA primer comprises a complete restriction enzyme recognition sequence (e.g., a nickase recognition sequence) or its complement. In some embodiments, the SDA primer comprises a blocking molecule. In some embodiments, the SDA primer comprises a 3' blocking molecule. In some embodiments, the blocking molecule blocks the extension of the SDA primer along the 3' direction (e.g., preventing the extension of the nucleotide sequence from continuing). In some embodiments, the SDA primer comprises a stabilizing sequence.

[0217] In some embodiments, the SDA primer hybridizes to a target nucleic acid sequence or its complement. In some embodiments, the SDA primer binds to an SDA primer binding sequence introduced into a ssDNA cassette by an oligonucleotide binder (e.g., primer and / or probe) or its complement.

[0218] In some embodiments, following binding of an SDA primer to a complementary target nucleic acid sequence comprising a native restriction enzyme recognition sequence (e.g., a native nickase recognition sequence) or to an SDA primer binding sequence in an ssDNA cassette and subsequent polymerase-based extension, a double-stranded restriction enzyme recognition sequence (e.g., a nickase recognition sequence) is generated (e.g., the amplicon generated comprises a double-stranded restriction enzyme recognition sequence (e.g., a nickase recognition sequence)). When nicked and subsequently extended based on a polymerase, a reverse complement of the target nucleic acid sequence or ssDNA is generated. Nicking can occur by using a nicking enzyme or restriction enzyme in combination with incorporating one or more modified dNTPs into one strand of the double-stranded restriction enzyme recognition sequence, thereby ensuring that only one strand is sheared (e.g., polymerase extension or within an SDA primer).

[0219] In some embodiments, the compositions and methods of the present disclosure comprise SDA primers that can be used to amplify a target nucleic acid sequence (e.g., comprising a native restriction enzyme recognition sequence, such as a native nickase recognition sequence). In some embodiments, the compositions and methods of the present disclosure comprise SDA primers that can be used to amplify a ssDNA cassette. In some embodiments, the compositions and methods provided herein produce multiple copies of a nucleic acid identical to a ssDNA cassette and / or a target nucleic acid sequence having one or more native restriction enzyme recognition sequences (e.g., a native nickase recognition sequence). In some embodiments, a ssDNA cassette is amplified using an SDA primer as provided herein to produce multiple amplified ssDNA cassettes.

[0220] In some embodiments, the SDA primer comprises a 3' blocking molecule. In some embodiments, the SDA primer with a 3' blocking molecule prevents nonspecific dimerization at low temperatures (eg, ambient temperature) where DNA hybridization specificity is low.

[0221] In some embodiments, the SDA primer is about 16 to about 33 nucleotides. In some embodiments, the SDA primer is up to 33 nucleotides, such as up to 32, such as up to 31, such as up to 30, such as up to 29, such as up to 28, such as up to 27, such as up to 26, such as up to 25, such as up to 24, such as up to 23, such as up to 22, such as up to 21, such as up to 20, such as up to 19, such as up to 18, such as up to 17, such as up to 16 nucleotides.

[0222] In some embodiments, the SDA primer comprises an RNA polymerase binding sequence.

[0223] In some embodiments, an SDA primer comprises a hairpin stabilizer (eg, wherein the stabilizing sequence forms a double-stranded hairpin) and a sequence complementary to a target nucleic acid sequence comprising an entire nickase recognition sequence.

[0224] Enzymes

[0225] Shear enzyme

[0226] In some embodiments, compositions and methods provided herein utilize a shearing enzyme that contributes to the amplification of a target nucleic acid sequence. In some embodiments, a shearing enzyme can shear a strand of a double-stranded target nucleic acid (such as a double-stranded DNA), thereby allowing a polymerase (e.g., a DNA polymerase with a strand displacement activity) to extend the target nucleic acid sequence.

[0227] In some embodiments, the cleavage enzyme is a restriction enzyme. Those skilled in the art are aware of restriction enzymes that can be used in the methods and compositions described herein. For example, those skilled in the art are aware of enzymes provided by commercial sources, such as those listed at www.neb.com / products / restriction-endonucleases.

[0228] Restriction enzymes are proteins isolated from bacteria that can shear DNA sequences at sequence-specific sites, thereby producing DNA fragments with known sequences at each end. Restriction enzymes are generally divided into five types, which differ in their structure and whether they cut their DNA substrates at their recognition sites, or whether the recognition site and the shearing site are separate from each other. Some restriction enzymes cut DNA by forming two cuts in each sugar-phosphate backbone (i.e., each chain) through the DNA double helix at one time.

[0229] In some embodiments, restriction enzymes are used in combination with one or more modified dNTPs. In some embodiments, after oligonucleotide binders are hybridized with target nucleic acid sequences, chain displacement DNA polymerase uses dNTPs and one or more modified dNTPs to extend the 3' end of oligonucleotide binders. In some embodiments, the restriction enzyme recognition sequence of restriction enzymes is formed by one or more modified dNTP bases incorporated into the reverse complementary chain, and the modified dNTP bases play a role in blocking the shearing of the chain by the restriction enzyme. In some embodiments, when the restriction enzyme recognizes its recognition sequence, it only shears the primer strand that does not include modified dNTPs at the shearing site, thereby keeping another modified strand intact (i.e., nick). In some embodiments, nicks can be extended by chain displacement DNA polymerase using dNTPs and the one or more modified dNTPs and displacing the first primer strand.

[0230] There are many advantages to using restriction enzymes over using, for example, nicking enzymes. One example of these advantages is the much greater number of available restriction enzymes that are not nicking enzymes than those that are nicking enzymes, which means that one or more restriction enzymes for use in the methods or compositions of the present disclosure can be selected from a large number of potential enzymes to identify enzymes with superior properties (e.g., reaction temperature, buffer compatibility, stability, and reaction rate (sensitivity)) for a given application.

[0231] In some embodiments, the cleavage enzyme is a nickase. Nickases (or nicking endonucleases) are a subgroup of restriction enzymes that cleave only on dsDNA strands.

[0232] When restriction enzymes are bound to their recognition sequences in DNA sequences, they hydrolyze both chains (i.e. duplexes) of double-stranded target nucleic acids simultaneously. Two independent hydrolysis reactions are carried out in parallel, and the most common is driven by the presence of two catalytic sites in the restriction enzyme, one of which is used to hydrolyze each chain, thereby shearing the DNA chain. However, nickases are modified restriction enzymes that only hydrolyze one chain of the duplex, thereby producing "through nick" (e.g., one chain is cut) rather than a DNA molecule that is sheared. There are three naturally occurring nickases Nt.BstNBI, Nb.BtsI, and Nb.BsrDI. They are composed of the large subunit of heterodimeric restriction endonucleases. Therefore, the catalytic site for the shearing of another chain present in the small subunit is completely missing. In some embodiments, nickases do not show double-stranded shearing activity. In some embodiments, nickases recognize specific nickase recognition sequences in nucleic acid sequences (e.g., target polynucleotides).

[0233] In some embodiments, the compositions and methods of the present disclosure include nickase. In some embodiments, the compositions and methods provided herein use nickase to introduce nicks in a double-stranded DNA complex comprising a primer (e.g., capped SDA primer) to allow removal of 3' blocking groups during primer extension. In some embodiments, the compositions and methods provided herein use nickase to introduce nicks in a double-stranded nucleic acid to allow strand displacement to occur during extension. Nick, nicking, and nicked all refer to a chain of a dsDNA molecule (e.g., a target polynucleotide) sheared by a nickase. Nickase used herein can nick a specific nickase recognition sequence. The term homologous nickase is used to describe a pairing nickase and its corresponding nickase recognition sequence. Homologous pairs are exemplified in Table 1.

[0234] In some embodiments, the nickase is homologous to a nickase recognition sequence on an oligonucleotide binder (e.g., a primer or probe). In some embodiments, the nickase is homologous to a nickase recognition sequence within a target nucleic acid and is therefore homologous to a nickase recognition sequence within a target amplicon.

[0235] In some embodiments, a nickase binds to a newly formed ssDNA cassette or a target nucleic acid comprising one or more intact nickase recognition sites and nicks one strand (eg, an SDA primer), which enables a strand-displacing polymerase to remove the 3' blocking molecule and extend the SDA primer.

[0236] In some embodiments, the nicking enzyme binds to a newly formed or already existing double-stranded target amplicon and nicks the strand extending from the SDA primer. In some embodiments, the nicking enzyme nicks the double-stranded target amplicon, which facilitates the ambient temperature displacement of the strand by a polymerase (e.g., DNA polymerase).

[0237] In some embodiments, the compositions and methods of the present disclosure comprise a nickase. In some embodiments, the nickase is selected from the group consisting of Nt.CviPII, Nb.BbvCI, Nb.BpulOI, Nb.Bsal, Nb.BsmI, Nb.BsrDI, Nb.BstNBIP, Nb.BstSEIP, Nb.BtsI, Nb.SapI, Nt.AlwI, Nt.BbvCI, Nt.BhaIIIP, Nt.BpulOI, Nt.Bp ulOIB, Nt.Bsal, Nt.BsmAI, Nt.BsmBI, Nt.BspD6I, Nt.BspQI, Nt.Bst9I, Nt.BstSEI, Nt.CviARORFMP, Nt.CviFRORFAP, Nt.BstNBI, Nt.CviQII, Nt.CviQXI, Nt.EsaSS1198P, Nt.MlyI and Nt.SapI. Nickase is associated with one or more nickase recognition sequences, see Table 1 below. A complete nickase recognition sequence is a sequence that will be recognized and nicked by a nickase. A partial nickase recognition site or a portion of a nickase recognition site is a sequence that has a portion of a complete recognition sequence.

[0238] Table 1

[0239]

[0240]

[0241] Those of ordinary skill in the art will appreciate that various nickases other than those listed in this disclosure may also be used in the compositions and / or methods of the present invention. In some embodiments, the nickase is Nt.CviPII. In some embodiments, the nickase is Nb.BbvCI.

[0242] In some embodiments, oligonucleotide binders and / or target nucleic acid sequences according to the present disclosure comprise complete or partial nickase recognition sites. In some embodiments, oligonucleotide binders comprise partial nickase recognition sequences. In some embodiments, partial nickase recognition sequences from SDA primers and partial nickase recognition sequences from primer binding sequences form complete nickase recognition sequences.

[0243] For example, a nickase as provided herein can be active at ambient temperature. In some embodiments, the nickase is stable and / or active in a temperature range of about 14°C to about 45°C, such as about 15°C to about 35°C.

[0244] Polymerase

[0245] In some embodiments, the compositions and methods provided herein utilize a polymerase with strand displacement activity to amplify a target nucleic acid sequence and / or an ssDNA box. In some embodiments, the compositions and methods of the present disclosure comprise a polymerase. In some embodiments, the polymerase is a polymerase comprising a strand displacement activity. A polymerase comprising a strand displacement activity is capable of displacing downstream DNA during extension. In some embodiments, the polymerase is a DNA polymerase. In some embodiments, the strand displacement polymerase comprises an extension activity at ambient temperature. In some embodiments, the strand displacement polymerase comprises an extension activity at a temperature in the range of about 14°C to about 45°C, such as about 15°C to about 35°C. In some embodiments, the strand displacement polymerase has an extension activity at room temperature.

[0246] In some embodiments, the DNA polymerase with strand displacement activity is selected from the group consisting of: Bsu DNA polymerase I (Bsu DNAP), phi29, Bst 20 DNA polymerase (Bst DNAP), Klenow large fragment (LF), Klenow Exo-, Bsu large fragment, Isopol and Isopol SD+, or variants thereof. In some embodiments, the DNA polymerase with strand displacement activity is Bsu or a variant thereof. In some embodiments, the DNA polymerase with strand displacement activity is selected from the group consisting of Bsu DNAP, Klenow LF, Klenow Exo- and Isopol and Bst DNAP. In some embodiments, the DNA polymerase with strand displacement activity is Klenow or a variant thereof.

[0247] In some embodiments, the DNA polymerase having strand displacement activity is active at low temperatures. In some embodiments, the DNA polymerase having strand displacement activity is active at 15° C., 14° C., 13° C., 12° C. In some embodiments, the DNA polymerase having strand displacement activity is active at 14° C. to about 45° C., such as about 15° C. to about 35° C.

[0248] In some embodiments, a DNA polymerase having strand displacement activity extends the SDA primer from the nick after cleavage and displaces the 3' blocking molecule.

[0249] Single-chain binding protein

[0250] In some embodiments, the compositions and methods provided herein utilize single-stranded binding protein (SSBP). SSBP can stabilize the displaced chain during the extension of the chain displacement polymerase. In some embodiments, the compositions or methods provided herein include SSBP. In some embodiments, SSBP binds to the DNA chain displaced by the chain displacement polymerase. In some embodiments, SSBP binds to oligonucleotide binders (e.g., primers and / or probes). In some embodiments, the binding of SSBP to oligonucleotide binders prevents or reduces non-specific binding. In some embodiments, SSB protein promotes polymerase (e.g., DNA polymerase) nick extension. In some embodiments, SSBP is selected from the group consisting of RpA, T7 gp2.5, T4 Gene 32Protein (T4gp32), EcoSSB, TaqSSB and TthSSB. In some embodiments, SSBP is T4gp32.

[0251] In some embodiments, the concentration of the single-chain binding protein in the composition according to the present disclosure is at least 100 ng / μl, at least 200 ng / μl, at least 300 ng / μl, at least 400 ng / μl.

[0252] In some embodiments, T4gp32 is present in the composition in the range of 100 ng / μl to 500 ng / μl, such as 200 ng / μl to 500 ng / μl, such as 300 ng / μl to 400 ng / μl.

[0253] Reverse transcriptase

[0254] In some embodiments, the technology provided herein includes a reverse transcriptase. In some embodiments, the reverse transcriptase has RNASEh activity. In some embodiments, the reverse transcriptase is selected from the group consisting of MMLV, AMV, Protoscript II, Superscript I and II and II and IV, RTx, GOScript, Sensiscript, Primescript and Maxima.

[0255] Ligase

[0256] In some embodiments, the compositions and methods of the present disclosure include a ligase. In some embodiments, the ligase is selected from the group consisting of SplintR, T4 ligase, T3 ligase, and T7 ligase. In some embodiments, the ligase is a SplintR ligase. In some embodiments, the ligase is a T4 DNA ligase. In some embodiments, the concentration of the ligase is in the range of 10 nM to 5 μM (e.g., 500 nM).

[0257] Cas enzymes

[0258] Cas enzymes were originally identified as part of the CRISPR (standing for "cluster of regularly interspaced short palindromic repeats")-Cas (standing for "CRISPR associated") system, which provides microorganisms with adaptive immunity to infectious nucleic acids. Those skilled in the art are aware of a large number of Cas enzymes, as well as their sequence elements and functional characteristics that divide them into different classes. Class 1 CRISPR-Cas systems have multi-subunit effector complexes; Class 2 systems have single-subunit effectors.

[0259] At least six different "types" of Cas proteins have been described; Type I, Type II, and Type IV are Class 1 enzymes, while Type II (including Cas9), Type V (including Cas12 and Cas14), and Type VI (including Cas 13) are Class 2 enzymes. Techniques for identifying Cas enzymes and classifying them (e.g., based on the presence, organization, and / or sequence of the RuvC domain and / or one or more other sequence elements) are currently well known in the art. In addition, many Cas variants have been prepared, and those skilled in the art have a good understanding of the structural (e.g., sequence) elements that participate in (e.g., are necessary and / or sufficient for) Cas enzyme activity.

[0260] Those skilled in the art who read this application will understand that in various embodiments, the technology provided can utilize any Cas enzyme (or variant thereof, such as an engineered variant) having cleavage activity suitable for reading out the activation to be utilized and guided by nucleic acid binding. In addition, those skilled in the art who read this disclosure will be very familiar with design options suitable for matching, such as a specific type of Cas with a specific Cas activation nucleic acid and / or cleavage substrate (e.g., a nucleic acid reporter probe).

[0261] Certain Cas enzymes, specifically including certain type V and type VI Cas enzymes, such as Cas12, Cas13, and Cas14 (e.g., Cpf1 / Cas12a, C2c2 / Cas13a, Cas13b, Cas13c, Cas14a, etc.) have been shown to have non-specific nuclease activity that is activated when their guide nucleic acid binds to its target. This non-specific cleavage activity is often referred to as "incidental cleavage".

[0262] Recently developed nucleic acid detection systems utilize the incidental cleavage activity of Cas proteins to detect the presence of a target nucleic acid of interest (or more accurately, a nucleic acid whose nucleotide sequence comprises a target site). In many embodiments, the compositions and methods of the present invention utilize a Cas enzyme with incidental activity and detect activation of this activity / cleavage of a nucleic acid reporter probe that is sensitive to the incidental cleavage activity of the Cas enzyme.

[0263] In some embodiments, the Cas enzyme is a Cas12 enzyme. In some embodiments, the Cas12 enzyme is a LbaCas12 enzyme. In some embodiments, the Cas enzyme is a Cas13 enzyme. In some embodiments, the Cas13 enzyme is a Cas13a enzyme.

[0264] In some embodiments, the Cas enzyme is a thermostable Cas enzyme. In some embodiments; the Cas enzyme is thermostable in the range of about 4°C to about 65°C.

[0265] When an appropriate Cas for the type of nucleic acid present in the Cas activating nucleic acid (i.e., RNA, ssDNA, or dsDNA) contacts the Cas target nucleic acid, its cleavage (e.g., incidental cleavage) activity is activated and the appropriate nucleic acid reporter probe is cleaved, thereby generating a detectable signal.

[0266] Guide polynucleotide

[0267] In some embodiments, the guide nucleic acid hybridizes to a target nucleic acid region within the target nucleic acid. In some embodiments, the guide nucleic acid is complementary to a target nucleic acid region within the target nucleic acid.

[0268] When the guide nucleic acid of the Cas enzyme hybridizes with a complementary sequence (target nucleic acid region or part thereof), the Cas enzyme is activated to shear (whether specific or non-specific) nucleic acid. It has been established that the guide nucleic acid can be engineered by researchers to hybridize with any target nucleic acid region. In addition, it has been established that the guide nucleic acid may include natural nucleotides, nucleotide analogs and / or combinations thereof. All established knowledge is relevant to the present disclosure and can be adopted in the practice of the present disclosure.

[0269] For example, one skilled in the art will appreciate that in some embodiments, the guide nucleic acid can have a length (and / or a portion that hybridizes to a Cas recognition element) in the range of about 16-28 nucleotides (e.g., about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, or about 28 nucleotides).

[0270] Those skilled in the art will also understand that in certain embodiments, the guide nucleic acid may have less than 100% perfect complementarity with the associated Cas recognition element (e.g., may be about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% complementary).

[0271] Buffer

[0272] The methods and compositions provided herein include a buffer providing reaction conditions suitable for amplification and / or detection of target nucleic acids. In some embodiments, the buffer includes components that technicians will understand as being present in a buffer for DNA amplification. In some embodiments, the composition further includes a buffer in which environmental amplification of the target nucleic acid can occur. In some embodiments, the buffer includes deoxynucleotides (dNTPs). In some embodiments, the buffer includes ribonucleotides (rNTPs). In some embodiments, the buffer includes Tris or acetate. In some embodiments, the buffer includes potassium ions (K+). In some embodiments, the buffer includes potassium acetate or potassium chloride. In some embodiments, the buffer includes magnesium ions (Mg2+). In some embodiments, the buffer includes magnesium chloride. In some embodiments, the buffer includes a polymerase chain reaction enhancer (e.g., dimethyl sulfoxide (DMSO), glycerol, formamide, bovine serum albumin, ammonium sulfate, polyethylene glycol, gelatin, tween 20, triton X-100, or N, N, N-trimethylglycine (betaine)). In some embodiments, T7 RNA polymerase is active in the buffer. In some embodiments, Cas13 polymerase is active in buffer.In some embodiments, Cas12 is active in buffer.

[0273] In some embodiments, the buffer is selected from the group consisting of Tris, phosphate, HEPES, DIPSO, MOBS, HEPPSO, TAPSO, EPPS, Tricine, Gly-Gly, Bicine, HEPBS, TEA, TAPS, AMPD, TABS, AMPSO, CHES and CAPSO.

[0274] In some embodiments, the buffer has a buffering capacity in the range of about pH 7 to about pH 8.

[0275] In some embodiments, the compositions and methods of the present disclosure include PEG. In some embodiments, the composition or method includes 1%-20% PEG, such as 5%-15% PEG. In some embodiments, the composition includes 10% PEG. In some embodiments, the PEG is a PEG with a molecular weight ranging from 200 to PEG 3350; 200 to 1000. In some embodiments, the PEG is PEG 3350.

[0276] Uses and methods

[0277] Those skilled in the art who read this disclosure will appreciate that the compositions and methods provided can be used in a variety of different contexts, including but not limited to target nucleic acid synthesis (e.g., generating ssDNA cassettes), amplification, detection, or a combination thereof. In some embodiments, the compositions and methods provided can be used to determine or confirm the presence or absence of a target nucleic acid. In some embodiments, the compositions and methods provided can be used to amplify a target nucleic acid. In some embodiments, the compositions and methods provided can be used to detect or quantify the amount of a target nucleic acid present in a particular sample.

[0278] In some embodiments, the SDA reactions of the present disclosure are performed via amplification of ssDNA input (eg, ssDNA cassette or ssDNA target nucleic acid) into large quantities of dsDNA amplicons at ambient temperature (eg, 16-25°C).

[0279] In some embodiments, ssDNA input (eg, ssDNA cassette or ssDNA target nucleic acid) is generated using ligation, reverse transcriptase, or cleavage (eg, buffer and / or heat), or the like.

[0280] In some embodiments, the present disclosure provides compositions and methods that can be used to generate ssDNA cassettes.

[0281] In some embodiments, the present disclosure provides compositions and methods that can be used to amplify a target nucleic acid.

[0282] In some embodiments, the present disclosure provides compositions and methods that can be used to detect a target nucleic acid.

[0283] DNA Cassette

[0284] The present disclosure provides various methods for generating ssDNA cassettes, such as using native nickase recognition sequences as shown in FIG. 25 , reverse transcription as shown in FIG. 22 and / or FIG. 38 , and / or Fig. 20 and / or the connection shown in FIG. 21 .

[0285] In some embodiments, a ssDNA cassette can be used in an amplification method as described herein.

[0286] In some embodiments, a ssDNA box is generated from a target nucleic acid sequence (e.g., RNA or double-stranded DNA) using one or more oligonucleotide binders provided herein. In some embodiments, a ssDNA box having an SDA primer binding sequence at both ends is generated. In some embodiments, the ssDNA box is about 30 to about 300 nucleotides. In some embodiments, the SDA primer hybridized to the ssDNA box is extended by a DNA polymerase (e.g., Bsu DNA polymerase). In some embodiments, a nicking enzyme can cut the SDA primer (e.g., Nb.BbvCl), and the DNA polymerase can then extend the nick, thereby discarding the 3' blocking molecule of the SDA primer.

[0287] In some embodiments, the ssDNA cassette is generated by utilizing two native nickase sequences in the target nucleic acid. In some embodiments, an SDA primer as provided herein hybridizes to a target nucleic acid sequence comprising a native nickase recognition sequence, the SDA primer is subsequently nicked, and a DNA polymerase extends the nick.

[0288] In some embodiments, the ssDNA cassette is generated by utilizing a reverse transcriptase. In some embodiments, a unique ssDNA cassette is generated using an oligonucleotide binder (e.g., a forward primer and a reverse primer) as provided herein. In some embodiments, the ssDNA cassette can then be amplified using one or more SDA primers.

[0289] In some embodiments, the ssDNA cassette comprises an SDA primer binding sequence as provided herein. In some embodiments, the ssDNA cassette comprises one or more SDA primer binding sequences. In some embodiments, the ssDNA cassette comprises two or more SDA primer binding sequences.

[0290] In some embodiments, the ssDNA cassette comprises a target nucleic acid sequence or its complement and one or more SDA primer binding sequences. In some embodiments, the SDA primer binding sequences are located at the 3' end and the 5' end of the target amplicon.

[0291] In some embodiments, a ssDNA box is produced by utilizing a ligation technique (e.g., utilizing one or more probes hybridized to a target nucleic acid as provided herein, followed by ligation using a gap filling oligonucleotide (GFO). In some embodiments, the present disclosure utilizes a ligation technique to hybridize with a target nucleic acid. Therefore, the ligation step is sequence-specific for the target nucleic acid. In some embodiments, a set of ligation oligonucleotides is designed that hybridize together across target nucleic acid regions adjacent to each other so that the activity of the ligase ligates the hybridized oligonucleotides together to form a ssDNA box. This ssDNA box comprises a complement of the selected entire target site and two SDA primer binding sequences. In some embodiments, the ssDNA box also includes a Cas recognition element, and is typically a template element that is not part of the same oligonucleotide before ligation.

[0292] Those skilled in the art will appreciate that there are a variety of systems that utilize sets of ligating oligonucleotides to bring together functional elements located on different oligonucleotides of the set only when the sets of ligating oligonucleotides are linked together by ligation, as occurs in the presence of a target nucleic acid of interest, with each oligonucleotide in the set hybridizing at a contiguous portion of the target site (see, e.g., transcriptional amplification of promoter-ligation-activation-nucleic acid sequences, as described in U.S. Pat. No. 5,194,370; multiplex ligatable probe amplification [MLPA], as described in U.S. Pat. No. 6,955,901, and Nucleic Acids Research 30:e27, 2002; RNA splint nucleic acid ligase activity, as described, e.g., Nucleic Acids Research 42:1831, 2013, U.S. Patent Application US2014 / 0179539, and Nucleic Acids Research 33:e116, 2016). Thus, those of ordinary skill in the art are familiar with the design parameters associated with the construction of oligonucleotides within a set of oligonucleotides as provided herein (see also US patent application US2008 / 0090238).

[0293] Amplification

[0294] In some embodiments, the present disclosure provides methods for amplifying a target nucleic acid in a sample, such as a double-stranded DNA target nucleic acid comprising a first native restriction enzyme recognition sequence and a second native restriction enzyme recognition sequence located on opposite strands separated by a target nucleic acid region, a double-stranded DNA target nucleic acid comprising at least one native restriction enzyme sequence, or an RNA target nucleic acid.

[0295] Amplification can be performed over a wide temperature range. The optimal temperature for amplification can be determined by the optimal temperatures of the relevant polymerases and restriction enzymes and the melting temperatures of the hybridization regions of the oligonucleotide primers.

[0296] In some embodiments, the method provided herein does not use temperature cycling. In addition, the amplification step does not require any controlled temperature oscillations, nor does it require any hot start or warm start, preheating or controlled temperature reduction. In some embodiments, the method according to the present disclosure allows amplification in a wide temperature range of, for example, 15°C to 60°C, such as 20°C to 60°C, such as 15°C to 45°C or 15°C to 35°C.

[0297] In some embodiments, the amplification is performed at ambient temperature. In some embodiments, the amplification is performed without temperature cycling. In some embodiments, the amplification is performed under isothermal conditions. In some embodiments, the amplification is performed at up to 50°C, up to 45°C, up to 40°C, up to 35°C, up to 30°C, up to 25°C, up to 20°C, up to 15°C.

[0298] In some embodiments, the present disclosure provides a method for amplifying a double-stranded DNA target nucleic acid in a sample, the double-stranded DNA target nucleic acid comprising a first native restriction enzyme recognition sequence and a second native restriction enzyme recognition sequence located on opposite strands separated by a target nucleic acid region, wherein the method comprises:

[0299] (A) contacting the sample with a composition comprising:

[0300] (a) a first SDA primer, the first SDA primer comprising:

[0301] (i) a sequence complementary to the first native restriction enzyme recognition sequence;

[0302] (ii) a 3' blocking molecule; and

[0303] (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides;

[0304] (b) a second SDA primer, the second SDA primer comprising:

[0305] (i) a sequence complementary to the second native restriction enzyme recognition sequence;

[0306] (ii) a 3' blocking molecule; and

[0307] (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides;

[0308] (c) a shearing enzyme;

[0309] (d) a DNA polymerase having strand displacement activity;

[0310] (e) single-chain binding protein;

[0311] (f) dNTPs; and

[0312] thereby producing a reaction mixture;

[0313] (B) incubating the reaction mixture under conditions conducive to:

[0314] (i) hybridizing the first and second SDA primers to a double-stranded DNA target nucleic acid in a sample; and

[0315] (ii) amplification of the target nucleic acid,

[0316] Multiple copies of the amplified target nucleic acid are thereby produced.

[0317] In some embodiments, the present disclosure provides a method for amplifying a double-stranded DNA target nucleic acid sequence in a sample comprising at least one native restriction enzyme sequence, wherein the method comprises

[0318] (A) contacting the sample with a composition comprising:

[0319] (a) a forward primer comprising a 3' nucleic acid sequence complementary to a target nucleic acid sequence located downstream or 5' of a native nickase recognition sequence and a 5' SDA primer binding sequence comprising a portion of the nickase recognition sequence;

[0320] (b) shearing enzyme;

[0321] (c) a DNA polymerase having strand displacement activity;

[0322] (d) single-chain binding protein;

[0323] (e) dNTPs;

[0324] Thereby generating a single-stranded DNA (ssDNA) cassette;

[0325] (B) contacting the ssDNA cassette of step (A) with a composition comprising:

[0326] (f) a first SDA primer, the first SDA primer comprising:

[0327] (i) a sequence complementary to the at least one native restriction enzyme sequence in the target nucleic acid sequence;

[0328] (ii) a 3' blocking molecule; and

[0329] (iii) a stabilizing sequence comprising about 8 to about 20 nucleotides; and

[0330] (g) a second SDA primer, the second SDA primer comprising:

[0331] (i) a sequence complementary to the 5' SDA primer binding sequence of the forward primer comprising a portion of the restriction enzyme recognition sequence;

[0332] (ii) a 3' blocking molecule; and

[0333] (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides, the 5' stabilizing sequence comprising a partial nicking enzyme recognition sequence that together with the partial nicking enzyme recognition sequence in the 5' SDA primer binding sequence forms a complete restriction enzyme recognition sequence,

[0334] thereby producing a reaction mixture;

[0335] (C) incubating the reaction mixture under conditions that favor the production of multiple copies of a nucleic acid that is identical to or complementary to the ssDNA cassette.

[0336] In some embodiments, the present disclosure provides a method for amplifying an RNA target nucleic acid sequence in a sample, the method comprising:

[0337] (A) contacting the sample with a composition comprising:

[0338] (a) a reverse primer, the reverse primer comprising:

[0339] (i) a 3' sequence that is complementary to the RNA target nucleic acid; and

[0340] (ii) a 5' SDA primer binding sequence, wherein the primer binding sequence comprises a restriction enzyme recognition sequence, a portion of a restriction enzyme recognition sequence, or a complement thereof;

[0341] (b) reverse transcriptase; and

[0342] (c) a forward primer, the forward primer comprising:

[0343] (i) a 3' sequence that is complementary to the RNA target nucleic acid; and

[0344] (ii) a 5'SDA primer binding sequence, wherein the primer binding sequence comprises a restriction enzyme recognition sequence, a portion of a restriction enzyme recognition sequence, or a complement thereof,

[0345] thereby producing a first reaction mixture;

[0346] (B) incubating the first reaction mixture under conditions that favor the production of a single-stranded DNA (ssDNA) cassette;

[0347] (C) contacting the ssDNA cassette of (B) with a composition comprising:

[0348] (d) a first SDA primer, the first SDA primer comprising:

[0349] (i) a sequence complementary to the 5' SDA primer binding sequence of the reverse primer;

[0350] (ii) a 3' blocking molecule; and

[0351] (iii) comprising a 5' stabilizing sequence of about 8 to about 20 nucleotides, and when the reverse primer comprises only a partial restriction enzyme recognition sequence, the first SDA primer comprises a partial restriction enzyme recognition sequence that together with the partial restriction enzyme recognition sequence in the 5' SDA primer binding sequence of the reverse primer forms a complete restriction enzyme recognition sequence;

[0352] (e) a second SDA primer, the second SDA primer comprising:

[0353] (i) a sequence complementary to the 5' SDA primer binding sequence of the forward primer;

[0354] (ii) a 3' blocking molecule; and

[0355] (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides, when the forward primer comprises only a partial restriction enzyme recognition sequence, the first SDA primer comprises a partial restriction enzyme recognition sequence that together with the partial restriction enzyme recognition sequence in the 5' SDA primer binding sequence of the forward primer forms a complete restriction enzyme recognition sequence; and

[0356] (f) at least one cleavage enzyme, a polymerase having strand displacement activity, a single-strand binding protein, and dNTPs; and

[0357] thereby producing a second reaction mixture;

[0358] (D) incubating the second reaction mixture under conditions that favor the production of multiple copies of a nucleic acid that is identical to or complementary to the ssDNA cassette.

[0359] Detection

[0360] The target nucleic acid and / or ssDNA box can be detected by a variety of methods. Those skilled in the art are aware of various techniques that can be used to detect nucleic acids. In some embodiments, the present disclosure provides techniques for detecting target nucleic acids, ssDNA boxes, or both.

[0361] In some embodiments, the present disclosure provides methods for detecting a target nucleic acid sequence in a sample, such as a double-stranded DNA target nucleic acid sequence comprising a first native restriction enzyme recognition sequence and a second native restriction enzyme recognition sequence located on opposite strands separated by a target nucleic acid region, a double-stranded DNA target nucleic acid sequence comprising at least one native restriction enzyme sequence, or an RNA target nucleic acid sequence.

[0362] In some embodiments, detection techniques include, for example, absorbance, CRISPR / Cas detection (e.g., CRISPR-SHERLOCK), FRET, gel electrophoresis, lateral flow, mass spectrometry, PCR, real-time PCR, and / or spectroscopy. In some embodiments, detection techniques include, for example, chemiluminescence, electrochemical techniques, fluorescence, intercalating dye detection, migration, and / or radiation.

[0363] In some embodiments, the detecting step is performed by detecting a change in fluorescence as an indicator of amplification of the target nucleotide sequence.

[0364] In some embodiments, the change in fluorescence is an increase in the fluorescence emission intensity of a detectably labeled nucleic acid probe.

[0365] In some embodiments, detection techniques include, for example, colorimetry, turbidimetry, other types of catalysts, molecular beacons and other oligonucleotide-based probes, aptamers, or lateral flow.

[0366] In some embodiments, the method according to the present disclosure includes non-specific target nucleotide sequence detection. Non-specific nucleotide detection uses non-specific nucleotide reporters, such as non-specific fluorescent DNA reporters to detect nucleotides, regardless of the specific sequence. Exemplary non-specific nucleic acid reporters include ethidium bromide, propionyl iodide, crystal violet, dUTP-conjugated probes, DAIP (4'-, 6-diamidino-2-phenylindole), 7-AAD (7-aminoactinomycin D), Hoechst 33258, Hoechst 33342, Hoechst 34580, PICOGREEN, SYBR dyes, such as SYBR Green I, SYBR GreenII, SYBR Gold. In some embodiments, the method for detecting the target nucleotide sequence utilizes SYBR dyes. In some embodiments, the method for detecting the target nucleotide sequence utilizes SYBR Green.

[0367] In some embodiments, the double-stranded DNA binding dye is a minor groove binding dye. In some embodiments, the minor groove binding dye is SYBR Green I and II, DAPI, PicoGreen, or a combination. In some embodiments, the double-stranded DNA binding dye is an intercalating dye. In some embodiments, the intercalating dye is ethidium bromide, propidium iodide, EvaGreen, or a combination.

[0368] In some embodiments, provided techniques can be multiplexed. As described herein, in some embodiments, provided techniques can be particularly useful for multiplexed (eg, simultaneous) analysis of a plurality of products suitable for lateral flow assessment.

[0369] In some embodiments, provided techniques can be multiplexed, for example utilizing different Cas enzymes (and / or readouts) for different target nucleic acid sequences and / or different ligation oligonucleotides.

[0370] In some embodiments, the detection methods encompassed by the present disclosure include CRISPR-based detection methods. Certain CRISPR / Cas enzymes have been identified that express incidental cleavage activity when activated by binding to a target site recognized by a guide polynucleotide complexed therewith. Cas12, Cas13, and Cas14 are non-limiting examples of CRISPR / Cas enzymes that have been shown to have such incidental cleavage activity. Some CRISPR / Cas enzymes with incidental cleavage activity digest or shear single-stranded nucleic acids (e.g., detectably labeled nucleic acid probes). Incidental activity has been used to develop CRISPR / Cas detection (e.g., diagnosis) technology that enables detection of nucleic acids containing relevant target sites (e.g., Cas target nucleic acids) or their complements in one or more biological and / or environmental samples.

[0371] In some embodiments, the Cas enzyme has incidental activities.

[0372] CRISPR-SHERLOCK is a detection technology that includes the following steps: contacting a CRISPR-Cas complex comprising a Cas enzyme with incidental shearing activity, a guide polynucleotide selected or engineered to be complementary to a target nucleotide sequence (e.g., a Cas target nucleic acid sequence) and a sample that may contain a target nucleotide sequence comprising a Cas target nucleic acid. In some embodiments, the detection based on CRISPR / Cas may be a detection system based on CRISPR-Cas13. In some embodiments, the detection system based on CRISPR / Cas is a detection system based on CRISP R / Cas12. In some embodiments, the detection system based on CRISPR / Cas13 or CR ISPR / Cas12 is a CRISPR-SHERLOCK detection system. In some embodiments, the CRISPR-SHERLOCK detection system is utilized according to the method disclosed herein. In some embodiments, the amplified nucleotides comprising the target nucleotide sequence are incubated with a guide polynucleotide capable of binding to the target nucleotide sequence, a detectably labeled nucleic acid probe, and a Cas enzyme.

[0373] In some embodiments, the Cas enzyme is a thermostable cas enzyme. The thermostable Cas enzyme may be a thermostable Cas enzyme as described in: U.S. Publication US2023 / 0002811, entitled “APPLICATION OF CAS PROTEIN, METHOD FOR DETECTING Targeted Nucleic Acid MolECULE AND KIT” and published on May 1, 2023; PCT Publication WO 2020 / 142754, entitled “PROGRAMMABLE NUCLEASE IMP ROVEMENTS AND COMPOSITIONS AND METHODS FOR NUCLEIC ACID AMPLIFICATION AND DETECTION” and published on September 7, 2021; PCT Publication WO 2021 / 154866, entitled “IMPROVED DE TECTION ASSAYS” and published on May 8, 2021; and PCT Publication WO 2021 / 154866, entitled “IMPROVED CRISPR-CAS TECHNOLOGIES” and published on February 2, 2023. 2023 / 009526, the contents of each of which are incorporated herein by reference in their entirety.

[0374] In some embodiments, the detectably labeled nucleic acid probe comprises a fluorescent group terminal and a quencher group. In some embodiments, the detectably labeled nucleic acid probe comprises a fluorescent group at the 5' end and a quencher group at the 3' end.

[0375] In some embodiments, the technology according to the present disclosure utilizes a guide polynucleotide. When incubated with a target polynucleotide, the guide polynucleotide is capable of binding to the target nucleic acid region and becomes an amplified nucleotide comprising the target nucleic acid region.

[0376] In some embodiments, the guide polynucleotide is complementary to a region of the target nucleic acid having one or more SNP mutations.

[0377] In some embodiments, among other things, the increased production of transcripts can reduce the duration required to detect nucleic acids. In some embodiments, the detection method includes a CRISPR-Cas based detection method (e.g., CRISPR-SHERLOCK). In some embodiments, the disclosed systems for nucleic acid synthesis and / or nucleic acid amplification and / or nucleic acid detection occur in a single reaction vessel ("one pot" embodiment).

[0378] In some embodiments, the present disclosure provides a method for detecting a double-stranded DNA target nucleic acid sequence in a sample, the double-stranded DNA target nucleic acid sequence comprising a first native restriction enzyme recognition sequence and a second native restriction enzyme recognition sequence located on opposite strands separated by a target nucleic acid region, wherein the method comprises:

[0379] (A) contacting at least one copy of an amplified target nucleic acid sequence produced by an amplification method as described herein with a composition comprising:

[0380] (i) a guide nucleic acid comprising a nucleic acid sequence complementary to the DNA cassette; and

[0381] (ii) Cas enzymes with incidental cleavage activity;

[0382] (iii) a nucleic acid reporter probe that is sensitive to the incidental cleavage activity, such that the nucleic acid reporter probe has a first uncleaved state and a second cleaved state that are detectably different; and

[0383] (B) detecting the cleavage of the nucleic acid reporter probe by detecting the difference between the first state and the second state to determine the presence of the target nucleic acid sequence in the sample.

[0384] In some embodiments, the present disclosure provides a method for detecting a double-stranded DNA target nucleic acid sequence in a sample, the double-stranded DNA target nucleic acid sequence comprising a first native restriction enzyme recognition sequence and a second native restriction enzyme recognition sequence located on opposite strands separated by a target nucleic acid region, wherein the method comprises:

[0385] (A) contacting at least one copy of an amplified target nucleic acid sequence produced by an amplification method as described herein with a composition comprising:

[0386] (i) capture probes; and

[0387] (ii) a conjugate capture probe comprising a detectable label and a 3' blocking entity;

[0388] (B) Detecting the presence of a detectable label bound to the solid substrate or moiety allowing attachment to a solid material to determine the presence of the target nucleic acid sequence in the sample.

[0389] In some embodiments, the capture probe is a biotinylated capture probe. In some embodiments, the capture probe has a 5' biotin modification. In some embodiments, the capture probe is about 10 to about 20 nucleotides. In some embodiments, the capture probe comprises a 3' blocking molecule. In some embodiments, the capture probe comprises a stabilization sequence (e.g., a linear single-stranded sequence, a hairpin stabilizer, or a combination thereof). In some embodiments, the capture probe comprises a restriction enzyme recognition sequence, such as a nickase recognition sequence. In some embodiments, the restriction enzyme recognition sequence and / or the nickase recognition sequence comprises one or more modifications (e.g., a PTO bond). In some embodiments, the capture probe comprises a target nucleic acid sequence or its complement. In some embodiments, the capture probe comprises a repeat bar pull-down sequence. In some embodiments, the bar pull-down sequence is the nucleotide sequence of SEQ ID NO:71 (TGTATGTATGTATGA).

[0390] In some embodiments, the conjugate capture probe is about 10 to about 20 nucleotides. In some embodiments, the conjugate capture probe comprises a target nucleic acid sequence or its complement. In some embodiments, the conjugate capture probe comprises a repeating bar pull-down sequence. In some embodiments, the bar pull-down sequence is the nucleotide sequence of SEQ ID NO: 71.

[0391] In some embodiments, the methods and compositions provided herein can distinguish target nucleotides with sequences comprising only one or more single nucleotide polymorphisms (SNPs) to distinguish the target nucleotides. In some embodiments, the technology provided can be used to detect nucleic acids containing SNPs. In some embodiments, the technology provided can be used to detect nucleic acids containing SNPs in one or more samples derived from patients. In some embodiments, the identification of nucleic acids with sequences comprising one or more disease-related SNPs can be used for diagnosis and / or to inform treatment regimens. In some embodiments, the use of multiple guide RNAs according to the disclosed technology can further expand or improve the quantity of target nucleic acids that can be distinguished from other target nucleic acids.

[0392] In some embodiments, the disclosed technology can enable detection of one or more microorganisms or other infectious agents in a sample. In some embodiments, such a sample can be or include, for example, a biological sample that may have been obtained from a subject, and / or an environmental sample that can be or include, for example, soil, water, etc. In some embodiments, for example, the microorganism can be a bacterium, a fungus, a yeast, a protozoa, a parasite, or a virus.

[0393] In some embodiments, the disclosed technology can be used in other methods together with (or in combination with) other technologies that require identification of specific microbial species or other infectious agents in a sample, or monitoring the presence of microorganisms or other infectious agents over time (e.g., by identifying the presence of specific microbial or infectious proteins (antigens), antibodies, antibody genes, detecting certain phenotypes (e.g., bacterial resistance)), monitoring disease progression and / or outbreaks, and antibiotic screening.

[0394] In some embodiments, the provided technology achieves certain benefits and / or advantages, such as relative to alternative technologies, such as technologies that can utilize conventional amplification methods. For example, in some embodiments, the provided technology provides reduced detection time compared to traditional detection methods.

[0395] Alternatively or additionally, in some embodiments, the provided technology may be particularly suitable for use in a point-of-care setting. Thus, in some embodiments, the provided technology may guide treatment regimens (e.g., selection of treatment type and / or dosage and / or duration of treatment).

[0396] In some embodiments, a water sample, such as a freshwater sample, a wastewater sample, or a saltwater sample, may be evaluated for cleanliness and / or safety and / or potability to detect, for example, the presence of microbial contamination.

[0397] In some embodiments, the technology provided can be used to evaluate environmental samples. For example, household / commercial / industrial surfaces made of any material including but not limited to metal, wood, plastic, rubber or the like can be wiped and tested for contaminants. To give a few examples, soil samples can be tested for the presence of virions or their fragments, pathogens or parasites, or other microorganisms for environmental purposes and / or for human, animal or plant disease testing. The cleanliness and safety and / or potability of water samples such as freshwater samples, wastewater samples or saltwater samples can be evaluated, for example, to detect the presence of virions and / or Cryptosporidium parvum, Giardia lamblia and / or other microbial contamination.

[0398] Identification of microorganisms may be useful and / or desirable for any number of applications, and thus any type of sample from any source deemed suitable by one of skill in the art may be used in accordance with the present invention.

[0399] In some embodiments, the technology of the present invention can be used for genotyping.

[0400] The methods provided herein can be performed within a wide temperature range. The optimal temperature for each step is determined by the optimal temperature of the relevant polymerase and restriction enzyme and the melting temperature of the hybridization region of the oligonucleotide primer.

[0401] In some embodiments, the method provided herein does not use temperature cycling. In addition, the amplification step does not require any controlled temperature oscillations, nor does it require any hot start or warm start, preheating or controlled temperature reduction. In some embodiments, the method according to the present disclosure allows amplification in a wide temperature range of, for example, 15°C to 60°C, such as 20°C to 60°C, such as 15°C to 45°C or 15°C to 35°C.

[0402] The method of the present invention is effective in a wide range of target nucleic acid concentrations, including detection of target nucleic acid copies as low as very low. In some embodiments, the compositions and methods disclosed herein cause robust amplification of target nucleic acids. Robust amplification of target nucleic acids refers to compositions and methods by which target nucleic acids are continuously amplified to detectable levels. It will be appreciated by those skilled in the art that robustness depends on the starting concentration of target nucleic acids in the compositions or methods. For example, compositions and methods provided herein are generally expected to robustly amplify and detect attomoles of target nucleic acids, for example, at least 2aM, at least 3aM, at least 4aM, at least 5aM, at least 10aM, at least 20aM, at least 50aM, or at least 100aM of target nucleic acids.

[0403] In some embodiments, the target nucleic acid is present in the sample and is detected at a concentration of at least 2 attomoles (aM). For example, the target nucleic acid can be present in the sample at a concentration of at least 2aM, at least 3aM, at least 4aM, at least 5aM, at least 10aM, at least 20aM, at least 50aM or at least 100aM. In some embodiments, the target nucleic acid is present in the sample at a concentration of 2-5aM, 2-10aM, 2-20aM, 2-40aM, 2-100aM, 5-10aM, 5-20aM, 5-40aM, 5-100aM, 10-20aM, 10-50aM, 20-50aM, 10-100aM, 50-100aM, 1-1000aM, 5-1000aM, or 50-1000aM. In some embodiments, the sample comprises other molecules in addition to the target nucleic acid, such as other non-target nucleic acids.

[0404] In some embodiments, the methods and compositions of the present disclosure can detect a target nucleic acid present at a concentration of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 copies per microliter in a sample. In some embodiments, the methods and compositions of the present disclosure can detect a target nucleic acid present at a concentration of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 copies per reaction.

[0405] In some embodiments, a PolyT oligonucleotide (oligo) is added to the detection step. Without wishing to be bound by a particular theory, the PolyT oligonucleotide can absorb excess SSB, such as T4gp32, to prevent SSB protein from binding to the detection probe (ie, reducing or removing background noise).

[0406] In some embodiments, the present invention provides methods suitable for multiplexing.In some embodiments, a number of different capture probes are utilized to capture a particular ssDNA cassette.

[0407] Reagent test kit

[0408] Provided herein are kits for performing the methods of the invention.The kit of parts may include a composition as described herein or a component thereof.

[0409] In some embodiments, a kit for performing amplification, detection or combined methods of a target nucleic acid sequence from a sample is provided. In some embodiments, a kit of parts includes a composition according to the present disclosure and / or one or more components thereof. In some embodiments, a kit of parts may include a target nucleic acid, an oligonucleotide binder, an amplification reagent and / or instructions for use.

[0410] In some embodiments, a kit for performing a method for detecting a target nucleic acid sequence in a sample is provided. In some embodiments, the kit of parts includes a composition according to the present invention. In some such embodiments, the kit of parts may also include amplification reagents, devices and / or instructions for use. For example, in some specific embodiments, the kit of parts may include a detector system that can be used to detect a target nucleotide sequence.

[0411] In some embodiments, the kit of parts also includes a control nucleic acid, such as a control nucleic acid that can be spiked into a sample as described herein.

[0412] illustration

[0413] Example 1: Ambient temperature virus particle lysis

[0414] This example demonstrates efficient virion lysis achieved at ambient temperature via use of the lysis technology provided herein.

[0415] The sample contained pooled saliva, BEIγ-irradiated SARS-CoV-2 virus (inactivated and intact virus), RNAsin, and EDTA. The initial pH of the pooled saliva was 8.4. The concentration of BEIγ-irradiated virus in the sample was 10,000 cp / ul. The concentration of RNAsin in the sample was 1U / μl (N2511, Promega).

[0416] Two different stock (20x) lysis buffers were prepared, each containing a zwitterionic detergent. Specifically, a LAPAO / HCl stock solution and a LDAO / NaClO / HCl stock solution were prepared as shown in the following table:

[0417] Table 2:

[0418] Reagents LAPOA / HCl stock solution LDAO / NaC10 / HCl stock solution LAPAO 2% (66.5336mM) LDAO 0.5%(21.796mM) HCl 400mM 400mM NaC10 1.2% (65mM) stock solution

[0419] Lysis buffer was added to the mock samples, and the combination was incubated at ambient temperature (22°C in this case) for a short period of time (specifically, at Fig.26 The cleavage reaction was stopped by adding neutralization buffer (20x stock solution was 100 mM Tris, pH 9.0). The cleavage reaction was performed under different pH conditions including pH 2.5, pH 4.5, pH 6, pH 6.5, pH 7.5, pH 8 and pH 10. To achieve the desired pH, the reaction was adjusted with HCl.

[0420] Virion lysis / nucleic acid preparation is assessed by measuring the Ct value of the sample. High Ct values ​​indicate poor or no virion lysis, while lower Ct values ​​indicate optimal virion lysis.

[0421] Positive Control

[0422] As a positive control for lysis, otherwise comparable mock samples containing pooled saliva, BEIγ-irradiated SARS-CoV-2 virus, RNAsin, and EDTA were exposed to elevated temperatures (specifically, incubated at 95°C for 5 minutes) without the addition of lysis buffer (e.g., LAPAO / HCl stock solution, or LDAO / NaClO / HCl solution stock) or other detergents.

[0423] Negative control

[0424] Three different negative controls were prepared:

[0425] (i) “No lysis” included mock samples (pooled saliva, BEIγ-irradiated SARS-CoV-2 virus, RNAsin, and EDTA) to which no lysis buffer (including any detergents and HCl) was added. The samples were kept at ambient temperature. Thus, the “No lysis” control samples were neither exposed to one or more detergents, HCl, nor to heat;

[0426] (ii) "HCl" includes mock samples (pooled saliva, BEIγ-irradiated SARS-CoV-2 virus, RNAsin, and EDTA) to which no cleaning agent was added but which were exposed to HCl. The samples were maintained at ambient temperature. Thus, the "HCl" control samples were neither exposed to one or more cleaning agents nor to heat.

[0427] (iii) "Negative" or no template control (NTC) contains water or buffer only.

[0428] For example, refer to Fig. 27 As can be seen, efficient lysis comparable to that achieved with the positive control under heated conditions, at least at a pH below about 6.0 and particularly below about 4.5, is achieved using a lysis buffer as provided herein. Fig. 27 The results observed when the cleavage reaction was carried out under different pH conditions are shown. In particular, Fig. 27 It is shown that lower Ct values ​​are achieved with lower pH values. Thus, this example demonstrates the particular effectiveness of the provided lysis reaction at low pH (i.e., better viral particle lysis). The highest level of lysis was observed at the lowest pH tested (2.5). However, these studies may not have reached their limits.

[0429] Among other things, the present example surprisingly demonstrates that efficient virion lysis (e.g., efficient virion lysis of enveloped virions) in biological samples (e.g., crude samples, and in particular saliva samples) can be achieved at low pH (e.g., below 6.5, and preferably below 4.5, including specifically below about pH 3.0) using a lysis reagent composition such as a zwitterionic detergent (e.g., LAPAO or LDAO), even at ambient temperature (e.g., about 22° C.). Furthermore, the lysis achieved can be comparable to thermal lysis (e.g., thermal lysis observed when incubated at 95° C. for 5 min).

[0430] Furthermore, this example surprisingly demonstrates that the effective cleavage conditions provided can be rapidly and gently neutralized by the simple addition of Tris to produce a cleaved composition suitable for further nucleic acid processing or manipulation. Among other things, the present disclosure provides the insight that the use of certain zwitterionic detergents (e.g., LAPAO and LDAO) as provided herein can achieve a "Goldilocks" effect of sufficient cleavage without undesired inhibition of downstream processing or reaction steps.

[0431] Thus, in many embodiments, subsequent manipulation and / or analysis of nucleic acids prepared by cleavage as provided herein does not require purification or extraction steps typically required or utilized to remove detergents. Instead, enzymes or other agents (e.g., ligases, alternatively or additionally, one or more cleavage systems such as CRISPR / Cas, TALEN, zinc fingers, restriction enzymes, etc., and / or one or more hybridization reagents such as oligonucleotides, e.g., probes or primers, etc.) can be added directly to the cleavage reaction (e.g., simultaneously or sequentially with any neutralization buffer).

[0432] Thus, the present disclosure provides lysis techniques that are remarkably compatible with nucleic acid processing and, among other things, may allow for so-called "one-pot" evaluations in some embodiments.

[0433] Example 2: Amplification of the bi-epitope cassette (analog trigger) using different SDA primers

[0434] This example demonstrates the amplification of a DNA cassette using different SDA primers.

[0435] The bi-epitope cassette (analog trigger, TGAGGAGGAGTAATACGACTCACTATAGGGCATAAGACAAATACGACTCTGTCAGAGAGAATTAAGTAAGGAGGTTTTTTATGGATTACAAAGACCACGATGGTGACTACAAAGACCATGATATAGATTACAAGGATGATGATGATAAATTTTTAAGTGTGTCACTTAACATTTGTACATGGTCACATCCTCAATTCGAGAAGTAATAATCTCCTCCTCAGCGATCTTCGACCTTC (SEQ ID NO: 17)) was amplified with different SDA primers. Amplification reactions contained 1x Custmart, 100 ng / uL T4gp32 (single-strand binding protein), 0.5 mM dNTPs, and either 0.25 U / uL BsuDNAP and 0.5 U / uL Nb.BbvCI nickase (low), or 0.5 U / uL Bsu DNAP and 1 U / uL Nb.BbvCI nickase (high).

[0436] Add different SDA primers at 1uM:

[0437] Unblocked standard: GAAGGTCGAAGATCGCTGAGGAGGAG (SEQ ID NO: 21),

[0438] Unblocked shorter: GGGATCGCTGAGGAGGAG (SEQ ID NO: 22), and

[0439] • Blocked standard: GAAGGTCGAAGATCGCTGAGGAGGAG (SEQ ID NO: 23) blocked with 3C6.

[0440] The expression cassette was amplified for 2 hours, followed by expression for 2 hours using the NEBExpress kit, and the 3xFLAG-1xStrepII dual epitope expression cassette was detected on the lateral flow. The results showed that short primers without blocking resulted in amplification, while primers with blocking groups gave better performance even with longer primers ( Figure 1 ).

[0441] Example 3: Amplification of bi-epitope cassettes of different lengths

[0442] This example demonstrates the amplification of DNA cassettes of different lengths. The reaction contained 1x Custmart, 100 ng / uLT4gp32, 0.5 mM dNTPs, 0.25 U / uL Bsu DNAP, 0.5 U / uL Nb.BbvCI nickase, and 1 uM short SDA primer (SEQ ID NO: 22). Different expressions were added at indicated concentrations:

[0443] ·TGAGGAGGAGTAATACGACTCACTATAGGGCATAAGACAAATACGACTCTGTCAGAGAGAATTAAGTAAGGAGGTTTTTTATGGATTACAAAGACCACGATGGTGACTACAAAGACCATGATATAGATTACAAGGATGATGATGATAAATTTTTAAGTGTGTCACTTAACATTTGTACATGGTCACATCCTCAATTCGAGAAGTAATAATCTCCTCCTCAGCGATCTTCGACCTTC (SEQ ID NO:17)(386bp),

[0444] ·TGAGGAGGAGTAATACGACTCACTATAGGGCATAAGACAAATACGACTCTGTCAGAGAGAATTAAGTAAGGAGGTTTTTTATGGATTACAAAGACCACGATGGTGACTACAAAGACCATGATATAGATTACAAGGATGATGATGATAAATTTTTAAGTGTGTCACTTAACATTTGTACAAGTGCGTGGTCACATCCTCAATTCGAGAAGGGCGGCGGGAGTGGAGGTGGCTCCGGTGGATCTGCTTGGTCACACCCCCAATTCGAAAAATAATAATCTCCTCCTCAGCGATCTTCGACCTTC(SEQ ID NO:18)(220bp),

[0445] ·TGAGGAGGAGTAATACGACTCACTATAGGGCATAAGACAAATACGACTCTGTCAGAGAGAATTAAGTAAGGAGGTTTTTTATGGATTACAAGGATGATGATGATAAATTTTTAAGTGTGTCACTTAACATTTGTACATGGTCACATCCTCAATTCGAGAAGTAATAATCTCCTCCTCAGCGATCTTCGACCTTC(SEQ ID NO:19)(244bp), and

[0446] ·TGAGGAGGAGTAATACGACTCACTATAGGGCATAAGACAAATACGACTCTGTCAGAGAGAATTAAGTAAGGAGGTTTTTTATGGATTACAAGGATGATGATGATAAATTTTTAAGTGTGTCACTTAACATTTGTACAAGTGCGTGGTCACATCCTCAATTCGAGAAGGGCGGCGGGAGTGGAGGTGGCTCCGGTGGATCTGCTTGGTCACACCCCCAATTCGAAAAATAATAATCTCCTCCTCAGCGATCTTCGACCTTC(SEQ ID NO:20)(178bp).

[0447] The cassette starting material was amplified for 2 hours, followed by gel electrophoresis of the products on 2% E-Gel. Various SDA primer concentrations were used to amplify and detect 3xF 1xS (SEQ ID NO 18) and 1xF 1xS (SEQ ID NO: 20) having nucleotide lengths of 220 bp and 178 bp, respectively ( Figure 2 ).

[0448] Example 4: Amplification of bi-epitope cassettes of different lengths

[0449] This example demonstrates the amplification of bi-epitope cassettes of varying lengths.

[0450] The reaction contained 1x Custmart, 100ng / uL T4gp32, 0.5mM dNTPs, 0.25U / uL Bsu DNAP, 0.5U / uL Nb.BbvCI nickase and 1uM short SDA primer (SEQ ID NO: 22). Different expressions were added at the indicated concentrations:

[0451] SEQ ID NO: 17 (386 bp),

[0452] SEQ ID NO: 18 (220 bp),

[0453] SEQ ID NO: 19 (244 bp), and

[0454] · SEQ ID NO: 20 (178 bp).

[0455] The cassette was amplified for 2 hours, then expressed for 2 hours using the NEBExpress kit, and the bi-epitope peptide was detected on the lateral flow. Shorter cassette length and higher SDA primer concentration resulted in improved amplification compared to longer cassette and lower SDA primer concentration ( Figure 3 ).

[0456] Example 5: Lateral Flow LOD of Cartridge Using Cap-SDA

[0457] This example demonstrates the lateral flow LOD of a cartridge using Cap-SDA.

[0458] The reaction contained 1x Custmart, 100ng / uL T4gp32, 0.5mM dNTPs, 0.25U / uL Bsu DNAP, 0.5U / uL Nb.BbvCI nickase and 1uM blocked SDA primer (SEQ ID NO: 23 blocked with 3C6). 3xFLAG-1xStrepII cassette (SEQ ID NO: 17) was added at the indicated concentrations (2fM, 200aM, 20aM, 2aM and 200zM). The cassette was amplified for 2 hours, then expressed for 2 hours using the NEBExpress kit, and the bi-epitope peptide was detected on the lateral flow.

[0459] The cassette was amplified, expressed, and detected at all cassette concentrations ranging from 2 fM to 200 zM. This example demonstrates the ability to detect the cassette when it is present at very low concentrations in the sample ( Figure 4 ).

[0460] Example 5: Amplification using single-stranded binding protein after ligation reaction

[0461] This example demonstrates the reduction of NTC background signal from ligation reactions amplified by Cap-SDA using extremely thermostable (ET)-SSB.

[0462] Ligation reactions contained 1x T4 ligase buffer, 2 nM probe mix (TGAGGAGGAGTAATACGACTCACTATAGGGGCACAATCACCAA (SEQ ID NO: 24), AAGATCTGAATCGTGGTCACATCCTCAATTCGAGAAGTAATAATCTCCTCCTCA (SEQ ID NO: 25) containing 5PHOS, TCAAAGTTGAATCTGCATAAGGAGGTTTTTTATGGATTACAAAGACCACGATGGTGACTACAAAGACCATGATATAGATTACAAGGATGATGATGATAAATCAGAGACAAAGTCATT (SEQ ID NO: 26) containing 5PHOS), 500 nM SplintR ligase, and (where indicated) 10% PEG-3350 and / or 25 ng / uL ET-SSB. After 30 minutes, the reactions were then amplified by Cap-SDA. Cap-SDA reactions contained 1x Custmart, 100 ng / uL T4gp32, 0.5 mM dNTPs, 0.25 U / uL Bsu DNAP, 0.5 U / uL Nb.BbvCI nickase, and 1 uM blocked SDA primer (SEQ ID NO: 23 blocked with 3C6). Ligation reactions were amplified for 2 hours, then expressed for 2 hours using the NEBExpress kit, and the bi-epitope peptides were detected on lateral flow.

[0463] The use of single-stranded binding protein (ET-SSB) during amplification can reduce the NTC background signal ( Figure 5 ).

[0464] Example 7: Amplification after ligation reaction

[0465] This example demonstrates the reduction of NTC background signal from ligation reactions amplified by Cap-SDA using an A probe (new design) containing a ribosome binding site (RBS).

[0466] The ligation reaction contained 1x T4 ligase buffer, 2 nM probe mix (SEQ ID NO:24 for the old design, SEQ ID NO:25 containing 5PHOS, SEQ ID NO:26 containing 5PHOS10, and TGAGGAGGAGTAATACGACTCACTATAGGGGATTAAGTAAGGAGGTTTTTTATGGCACAATCACCAA (SEQ ID NO:27) for the new design, AAGATCTGAATCGTGGTCACATCCTCAATTCGAGAAGTAATAATCTCCTCCTCA (SEQ ID NO:28) containing 5PHOS, TCAAAGTTGAATCTGCAGATTACAAAGACCACGATGGTGACTACAAAGACCATGATATAGATTACAAGGATGATGATGATAAATCAGAGACAAAGTCATT (SEQ ID NO:29) containing 5PHOS), 500 nM SplintR ligase, and (if indicated) 10% PEG-3350 and / or 25 ng / uL ET-SSB. After 30 minutes, these reactions were then amplified by Cap-SDA. Cap-SDA reactions contained 1x Custmart, 100ng / uL T4gp32, 0.5mM dNTPs, 0.25U / uL Bsu DNAP, 0.5U / uL Nb.BbvCI nickase, and 1uM blocked SDA primer (SEQ ID NO: 23 blocked with 3C6). The ligation reactions were amplified for 2 hours, then expressed for 2 hours using the NEBExpress kit, and the bi-epitope peptides were detected on the lateral flow.

[0467] This example shows that the probe design incorporating the RBS into GFO (old design) produced significant background signal in all PEG and / or SSB combinations tested in the ligation step, while the probe design incorporating the RBS into the A probe (new design) produced low background, especially in the presence of SSB ( Figure 6 ).

[0468] Example 8: Amplification after ligation

[0469] This example demonstrates detection of SARS gRNA targets in ligation reactions by Cap-SDA amplification using different probe designs.

[0470] The ligation reaction contained 1x T4 ligase buffer, 2 nM probe mix (30 bp standard - SEQ ID NO: 27, SEQ ID NO: 28 containing 5PHOS, SEQ ID NO: 29 containing 5PHOS; 40 bp gap - TGAGGAGGAGTAATACGACTCACTATAGGGGATTAAGTAAGGAGGTTTTTTATGTTATTAGCTGTATGT (SEQ ID NO: 30), CAGCGTACCCGTAGGCTGGTCACATCCTCAATTCGAGAAGTAATAATCTCCTCCTCA (SEQ ID NO: 31) containing 5PHOS, ACAGTTGCACAATCAGATTACAAAGACCACGATGGTGACTACAAAGACCATGATATAGATTACAAGGATGATGATGATAAATCTGAATCGACAAG (SEQ ID NO:32); 51bpHybSeqs isolong-TGAGGAGGAGTAATACGACTCACTATAGGGGATTAAGTAAGGAGGTTTTTTATGTTATTAGCTGTATGTACAGTTGCACA (SEQ ID NO:33), ATCGACAAGCAGCGTACCCGTAGGCTGGTCACATCCTCAATTCGAGAAGTAATAATCTCCTCCTCA (SEQ ID NO:33) containing 5PHOS NO: 34), ATCACCAATCAAAGTTGAATCTGCAGATTACAAAGACCACGATGGTGACTACAAAGACCATGATATAGATTACAAGGATGATGATGATAAATCAGAGACAAAGTCATTAAGATCTGA (SEQID NO: 35) containing 5PHOS;51 bp HybSeq - TGAGGAGGAGTAATACGACTCACTATAGGGGATTAAGTAAGGAGGTTTTTTATGTTATTAGCTGTATGTACAGTTGCACAATCACCAA (SEQ ID NO: 36), AAGATCTGAATCGACAAGCAGCGTACCCGTAGGCTGGTCACATCCTCAATTCGAGAAGTAATAATCTCCTCCTCA (SEQ ID NO: 37) containing 5PHOS, TCAAAGTTGAATCTGCAGATTACAAAGACCACGATGGTGACTACAAAGACCATGATATAGATTACAAGGATGATGATGATAAATCAGAGACAAAGTCATT (SEQ ID NO: 38) containing 5PHOS), 500 nM SplintR ligase, 10% PEG-3350, and 25 ng / uL ET-SSB. After 30 minutes, the reactions were then amplified by Cap-SDA. Cap-SDA reactions contained 1x Custmart, 100ng / uL T4gp32, 0.5mM dNTPs, 0.25U / uL Bsu DNAP, 0.5U / uL Nb.BbvCI nickase, and 1uM blocked SDA primer (SEQ ID NO: 23 blocked with 3C6). The ligation reaction was amplified for 2 hours, then expressed for 2 hours using the NEBExpress kit, and the bi-epitope peptide was detected on the lateral flow. ;

[0471] Figure 7 showed that using a longer hybridization length to introduce a gap between the two hybridization regions can improve signal intensity ( Figure 7 ).

[0472] Example 9: Detection of synthetic ssDNA targets

[0473] This example demonstrates the detection of a synthetic ssDNA target (DNA cassette) containing the ORF1 SARS sequence (long trigger -TGAGGAGGAGATGTTCAACAATGGGGTTTTACAGGTAACCTACAAAGCAACCATGATCTGTATTGTCAAGTCCACTCCTCCTCA (SEQ ID NO: 40), short trigger -TGAGGAGGAGATACAGATCATGGTTGCTTTGTAGGTTACCTGTAAAACCTCCTCCTCA (SEQ ID NO: 39)).

[0474] The Cap-SDA reaction contained 1x Custmart, 100 ng / uL T4gp32, 0.5 mM dNTPs, 1 mM rNTPs, 2.5 mM DTT, 5 U / uL T7 RNAP, 200 nM RNAseAlert, 1 uM blocked SDA primer (SEQ ID NO: 23 blocked with 3C6), 100 nM blocked T7-SDA primer (TAATACGACTCACTATAGGGCTGAGGAGGAG (SEQ ID NO: 41) blocked with 3C6), and 10 nM Cas13 / crRNA complex (GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACGAUCAUGGUUGCUUUGUAGGUUACCUGU (SEQ ID NO: 69)). They also contained 0.5U / uL Bsu DNAP and 1U / uL Nb.BbvCI nickase from low concentration (LC) stocks (5U / uL Bsu, 10U / uL Nb.BbvCI), or equal amounts of polymerase and nickase from high concentration (HC) stocks (50U / uL Bsu, 400U / uL Nb.BbvCI), or high concentration IsoPol DNAP stock instead of Bsu (35U / uL Isopol). Detection was performed in real time by measuring fluorescence on a plate reader.

[0475] This example shows that the use of LC enzyme stock (5U / uL Bsu, 10U / uL Nb.BbvCI) in combination with high levels of glycerol does not result in decreased performance compared to HC enzyme stock (50U / uL Bsu, 400U / uL Nb.BbvCI) ( Figure 8 ).

[0476] Example 10: Detection of synthetic ssDNA targets

[0477] This example demonstrates the detection of a synthetic ssDNA target (DNA cassette) containing the ORF1 SARS sequence (Short Trig - SEQ ID NO: 39) with and without treatment with Klenow fragment (KF).

[0478] Cap-SDA reactions contained 1x Custmart, 100ng / uL T4gp32, 0.5mM dNTP, 1mM rNTP, 2.5mM DTT, 5U / uL T7 RNAP, 1uM blocked SDA primer (SEQ ID NO: 23 blocked with 3C6), 100nM blocked T7-SDA primer (SEQ ID NO: 41 blocked with 3C6), 0.5U / uL Bsu DNAP from high concentration stock (50U / uL Bsu, 400U / uL Nb.BbvCI), 1U / uL Nb.BbvCI nickase. 1x EvaGreen dye was added, or 200nM RNAse Alert and 10nM Cas13 / crRNA complex (Seq 53) were added. Detection was performed in real time by measuring fluorescence on a plate reader. Blocked SDA primers were either untreated (suspended in water) or treated with KF (incubated with 0.5 U / uL Klenow fragment in Tris buffer containing 10 mM MgCl2 and without dNTPS at 37°C for 1 hour, followed by heat killing at 85°C for 20 min). The 3' exo-cleavage activity of KF enriches only the blocked primers and cleaves any unblocked primers.

[0479] This example shows that KF treatment of the SDA primer results in a delay in the onset of the NTC curve, but not the onset of the target curve (measured by Evagreen dsDNA dye or Cas13 output) ( Fig. 9 ).

[0480] Example 11: Reverse transcriptase and ligase reaction followed by amplification

[0481] This example demonstrates the detection of SARS irradiated virions using either reverse transcriptase (A) or ligase reactions (B) followed by amplification by Cap-SDA.

[0482] Prior to detection, the enveloped SARS virus was lysed using SARSBEGONE reagent (0.1% LAPAO and 10 mM HCL, neutralized with 100 mM Tris pH 9). The reverse transcriptase reaction contained 1x Protoscript II buffer, 10 mM DTT, 4 U / uL Protoscript II RT Pol, 25 ng / uL ET-SSB, 0.1 U / uL RNAse H, 0.5 mM dNTPs, and 20 nM F and R primers (TGAGGAGGAGATGTTCAACAATGGG (SEQ ID NO: 42) and CCGATCGCTGAGGAGGAGTGGACTTGACAA (SEQ ID NO: 46)). The ligation reaction contained 1x T4 ligase buffer, 2nM probe mix (TGAGGAGGAGGACAATACAGATCA (SEQ ID NO:56), TGGTTGCTTTGT containing 5PHOS (SEQ ID NO:57), AGGTTACCTGTAAACTCCTCCTCA containing 5PHOS (SEQ ID NO:58)), 500nM SplintR ligase, 10% PEG-3350, and 25ng / uL ET-SSB. Cap-SDA reaction contains 1xCustmart, 100ng / uL T4gp32, 0.5mM dNTP, 1mM rNTP, 2.5mM DTT, 5U / uL T7 RNAP, 1uM blocked SDA primer (SEQ ID NO: 23 blocked with 3C6), 100nM blocked T7-SDA primer (SEQ ID NO: 41 blocked with 3C6), 0.5U / uL Bsu DNAP from high concentration stock (50U / uL Bsu, 400U / uL Nb.BbvCI), 1U / uL Nb.BbvCI nickase, 200nM RNAse Alert, and 10nM Cas13 / crRNA complex (SEQ ID NO: 69). Detection is performed in real time by measuring fluorescence on a plate reader.

[0483] The data showed that both RT polymerase- and SplintR-ligation-based workflows were compatible with the SARSBEGONE cleavage reagent ( FIG. 10 ).

[0484] Example 12: Reverse transcriptase reaction followed by amplification

[0485] This example demonstrates detection of SARS gRNA using reverse transcriptase followed by amplification by Cap-SDA.

[0486] The reverse transcriptase reaction contained 1x Protoscript II buffer, 10 mM DTT, 4 U / uL Protoscript II RT Pol, 25 ng / uL ET-SSB, 0.1 U / uL RNAse H, 0.5 mM dNTPs, and the indicated RT primers (paired F and Rv2 designs, SEQ ID NO:42, TGAGGAGGAGATGTTCAACAAT (SEQ ID NO:43), TGAGGAGGAGATGTTCAACA (SEQ ID NO:44), CCGATCGCTGAGGAGGAGTGGACTTGACAATAC (SEQ ID NO:45), SEQ ID NO:46, and CCGATCGCTGAGGAGGAGTGGACTTGAC (SEQ ID NO:47)).

[0487] Cap-SDA reaction contains 1x Custmart, 100ng / uL T4gp32, 0.5mM dNTP, 1mM rNTP, 2.5mM DTT, 5U / uL T7 RNAP, 1uM blocked SDA primer (SEQ ID NO: 23 blocked with 3C6), 100nM blocked T7-SDA primer (SEQ ID NO: 41 blocked with 3C6), 0.5U / uL Bsu DNAP from high concentration stock (50U / uL Bsu, 400U / uL Nb.BbvCI), 1U / uL Nb.BbvCI nickase, 200nM RNAse Alert, and 10nM Cas13 / crRNA complex (SEQ ID NO: 69). Real-time detection is performed by measuring fluorescence on a plate reader and displays the endpoint signal at 120 or 150 minutes.

[0488] The results showed that a range of hybridization lengths (10nt-15nt primers) and primer concentrations (20aM to 1M) of reverse transcriptase primers can facilitate signal detection ( Fig.11 ).

[0489] Example 13: Amplification after reverse transcriptase reaction involving bump primers

[0490] This example demonstrates detection of SARS gRNA using reverse transcriptase followed by amplification by Cap-SDA.

[0491] The reverse transcriptase reaction contained 1x Protoscript II buffer, 10 mM DTT, 4 U / uL Protoscript II RT Pol, 25 ng / uL ET-SSB, 0.1 U / uL RNAse H, 0.5 mM dNTPs, and the indicated RT primers including the bump primer (SEQ ID NO: 42, TGAGGAGGAGTGGACTTGACAATAC (SEQ ID NO: 48), and ATTACGTCTATAATC (SEQ ID NO: 49)). Cap-SDA reaction contains 1xCustmart, 100ng / uL T4gp32, 0.5mM dNTP, 1mMrNTP, 2.5mM DTT, 5U / uL T7 RNAP, 1uM blocked SDA primer (SEQ ID NO: 23 blocked with 3C6), 100nM blocked T7-SDA primer (SEQ ID NO: 41 blocked with 3C6), 0.5U / uL Bsu DNAP from high concentration stock (50U / uL Bsu, 400U / uL Nb.BbvCI), 1U / uL Nb.BbvCI nickase, 200nM RNAse Alert, and 10nM Cas13 / crRNA complex (SEQ ID NO: 69). Detection is performed in real time by measuring fluorescence on a plate reader.

[0492] The results showed that the RT-SDA workflow can also be used with the addition of bump primers ( Fig.12 ).

[0493] Example 14: Reverse transcriptase reaction followed by amplification

[0494] This example demonstrates detection of SARS gRNA using reverse transcriptase followed by amplification by Cap-SDA.

[0495] The reverse transcriptase reaction contained 1x Protoscript II buffer, 10 mM DTT, 4 U / uL Protoscript II RT Pol, 25 ng / uL ET-SSB, 0.1 U / uL RNAse H, 0.5 mM dNTPs, and the indicated RT primers (SEQ ID NO:42 and SEQ ID NO:46). Cap-SDA reaction contains 1x Custmart, 100ng / uL T4gp32, 0.5mM dNTP, 1mMrNTP, 2.5mM DTT, 5U / uL T7 RNAP, 1uM blocked SDA primer (SEQ ID NO: 23 blocked with 3C6), 100nM blocked T7-SDA primer (SEQ ID NO: 41 blocked with 3C6), 0.5U / uL Bsu DNAP from high concentration stock solution (50U / uL Bsu, 400U / uL Nb.BbvCI), 1U / uL Nb.BbvCI nickase, 200nM RNAse Alert, and 10nM Cas13 / crRNA complex (SEQ ID NO: 69). In addition, Cap-SDA reaction does not contain Klenow LF or contains 0.0125U / uL Klenow LF. Detection was performed in real time by measuring fluorescence on a plate reader.

[0496] FIG13 shows that the sensitivity of the RT-SDA workflow is enhanced when a low concentration of Klenow Large Fragment DNA Polymerase is added to the SDA reaction ( FIG13 ).

[0497] Example 15: Amplification after ligase reaction

[0498] This example demonstrates the use of a ligase reaction followed by amplification by Cap-SDA (using Fig.14 Detection of SARS gRNA using probes with different hybridization lengths as indicated.

[0499] The ligation reaction contained 1x T4 ligase buffer, 2 nM probe mix (probe mix 1 - TGAGGAGGAGATACAGATCATGGT (SEQ ID NO:50), TGCTTTGTAG (SEQ ID NO:51) containing 5PHOS, GTTACCTGTAAAACCTCCTCCTCA (SEQ ID NO:52) containing 5PHOS 34, 35, 36; probe mix 2 - TGAGGAGGAGATACAGATCATGGT (SEQ ID NO:53), TGCTTTGTAGGT (SEQ ID NO:54) containing 5PHOS, TACCTTGTAAAACCCCTCCTCCTCA (SEQ ID NO:55) containing 5PHOS 37, 38, 39; probe mix 3 - SEQ ID NO:56, SEQ ID NO:57 containing 5PHOS, SEQ ID NO:58 containing 5PHOS; probe mix 4 - TGAGGAGGAGCCATGGACTTGACAATACAGATCA (SEQ ID NO:57) containing 5PHOS. NO:59), TGGTTGCTTTGT containing 5PHOS (SEQ ID NO:60), AGGTTACCTGTAAAACCCCATTGTCTCCTCCTCA containing 5PHOS (SEQ ID NO:61)), 500 nM SplintR ligase, 10% PEG-3350 and 25 ng / uL ET-SSB. Cap-SDA reaction contains 1x Custmart, 100ng / uLT4gp32, 0.5mM dNTP, 1mM rNTP, 2.5mM DTT, 5U / uL T7 RNAP, 1uM blocked SDA primer (SEQ ID NO: 23 blocked with 3C6), 100nM blocked T7-SDA primer (SEQ ID NO: 41 blocked with 3C6), 0.5U / uL Bsu DNAP from high concentration stock solution (50U / uLBsu, 400U / uL Nb.BbvCI), 1U / uL Nb.BbvCI nickase, 200nM RNAse Alert, and 10nM Cas13 / crRNA complex (SEQ ID NO: 69). Real-time detection is performed by measuring fluorescence on a plate reader, and the signal at the 120 minute time point is displayed.

[0500] The results showed that probe mixture 1 using short probes (14 nt) and short GFOs and probe mixture 4 using long probes (24 nt) resulted in a loss of sensitivity (i.e., the ability to detect the target nucleic acid sequence) ( Fig.14 ).

[0501] Example 16: Detection of ssDNA synthesis targets

[0502] This example demonstrates the detection of a 2fM ssDNA synthetic target containing the SARS ORF1 sequence by Cap-SDA (TGAGGAGGAGGACAATACAGATCATGGTTGCTTTGTAGGTTACCTGTAAACTCCTCCTCA (SEQ ID NO: 68)).

[0503] The Cap-SDA reaction contained 1x Custmart, 100ng / uL T4gp32, 0.5mM dNTPs, 1mM rNTPs, 2.5mM DTT, 5U / uL T7 RNAP, 1uM blocked SDA primer (SEQ ID NO:23 blocked with 3C6), 100nM blocked T7-SDA primer (SEQ ID NO:41 blocked with 3C6), 0.5U / uL Bsu DNAP from a high concentration stock solution (50U / uLBsu, 400U / uLNb.BbvCI), 1U / uL Nb.BbvCI nickase, and 10nM Cas13 / crRNA complex (SEQ ID NO:69). In addition, 200 nM or 8 uM of fluorophore quencher reporter (RURURURURURURURURURURURURU (SEQ ID NO: 62) containing 56FAM and 3BQH1, RURURURURU (SEQ ID NO: 63) containing 56FAM and 3BQH1, ATRURUGC (SEQ ID NO: 64) containing 5HEX and 3IWBK) were also included. Detection was performed in real time by measuring fluorescence on a plate reader.

[0504] The results show that both FAM and HEX can be used for Cas13 cleavage reporters, and shorter sequences in cleavage reporters allow faster results. ( Fig.15 ).

[0505] Example 17: Amplification after ligation reaction

[0506] This example demonstrates colorimetric detection of indicated concentrations of SARS gRNA using a ligase reaction followed by amplification by Cap-SDA.

[0507] The ligation reaction contained 1x T4 ligase buffer, 2 nM probe mix, 500 nM SplintR ligase, 10% PEG-3350, and 25 ng / uL ET-SSB. Cap-SDA reaction contains 1x Custmart, 100ng / uL T4gp32, 0.5mM dNTP, 1mM rNTP, 2.5mMDTT, 5U / uL T7 RNAP, 1uM blocked SDA primer (SEQ ID NO: 23 blocked with 3C6), 100nM blocked T7-SDA primer (SEQ ID NO: 41 blocked with 3C6), 0.5U / uL Bsu DNAP from high concentration stock solution (50U / uL Bsu, 400U / uL Nb.BbvCI), 1U / uL Nb.BbvCI nickase, 20uM FQ reporter (SEQ ID NO: 63 containing 56FAM and 3BQH1), and 10nM Cas13 / crRNA complex (SEQ ID NO: 69). Real-time detection is performed by observing color changes and taking pictures at 90 minutes.

[0508] The results showed that activation of the reporter by cleavage of the reporter with a fluorescence quencher concentration of 20aM–1fM resulted in a visible color change that was not observed in the control samples ( Fig.16 ).

[0509] Example 18: Amplification of dsDNA containing native nickase sites

[0510] This example demonstrates the detection of a dsDNA target containing a native nickase site (CCGATCGCTGAGGAGGAGTGGACTTGACAATACAGATCATGGTTGCTTTGTAGGTTACCTGTAAAACCCCATTGTTGAACATCAATCATAAACGGATTATAGACGTAATCAAATCCAATAGA (SEQ ID NO:65)) in a one-pot SDA reaction.

[0511] The Cap-SDA reaction contained 1x Custmart, 100ng / uL T4gp32, 0.5mM dNTPs, 1mM rNTPs, 2.5mM DTT, 5U / uL T7 RNAP, 1uM blocked SDA primer (SEQ ID NO:23 blocked with 3C6), 100nM blocked T7-SDA primer (SEQ ID NO:41 blocked with 3C6), 0.5U / uL Bsu DNAP from high concentration stock solution (50U / uL Bsu, 400U / uL Nb.BbvCI), 1U / uL Nb.BbvCI nickase, 200nM FQ reporter (SEQ ID NO:63 comprising 5'6FAM and 3'BQH1), and 10nM Cas13 / crRNA complex (SEQ ID NO:69). In addition, F primer and F bump primer (SEQ ID NO: 42 and SEQ ID NO: 49) were added. Detection was performed in real time by measuring fluorescence on a plate reader.

[0512] The results showed that one-pot detection of dsDNA targets ( Fig.17 ). The bump primer is used to make the DNA strand generated by the opposite primer single-stranded after priming and extension.

[0513] Example 19: Lateral flow detection of ssDNA

[0514] This example demonstrates the detection of a ssDNA synthesis target (SEQ ID NO: 68, - indicates 0 fM, + indicates 20 fM) using the lateral flow output from a Cap-SDA reaction using a capture oligonucleotide.

[0515] The Cap-SDA reaction contained 1x Custmart, 100ng / uL T4gp32, 0.5mM dNTPs, 1mM rNTPs, 2.5mM DTT, 5U / uL T7 RNAP, 1uM blocked SDA primer (SEQ ID NO:23 blocked with 3C6), 100nM blocked T7-SDA primer (SEQ ID NO:41 blocked with 3C6), 0.5U / uL Bsu DNAP, 1U / uL Nb.BbvCI nickase from high concentration stock solution (50U / uL Bsu, 400U / uL Nb.BbvCI). In addition, indicated concentrations of biotin probe and FAM probe (TACCTGTAAACTCCTCCTCA (SEQ ID NO: 66) containing 3'BIOTEG and ATCATGGTTGCTTTGTAGGT (SEQ ID NO: 67) containing 5'6-FAM and 3C6) were added. Two hours later, detection was performed using a biotin-FAM lateral flow strip.

[0516] The results showed that the SDA amplification cassette ( Fig.18 ).

[0517] Example 20: Detection of ssDNA

[0518] This example demonstrates the detection of a ssDNA synthesis target (2 fM, SEQ ID NO: 68) using Cap-SDA reactions under standard or pH-adjusted conditions.

[0519] The Cap-SDA reaction contained 1x Custmart, 100ng / uL T4gp32, 0.5mM dNTPs, 1mM rNTPs, 2.5mM DTT, 5U / uL T7 RNAP, 1uM blocked SDA primer (SEQ ID NO:23 blocked with 3C6), 100nM blocked T7-SDA primer (SEQ ID NO:41 blocked with 3C6), 0.5U / uL Bsu DNAP from high concentration stock solution (50U / uL Bsu, 400U / uL Nb.BbvCI), 1U / uL Nb.BbvCI nickase, 200nM FQ reporter (SEQ ID NO:63 comprising 5'6FAM and 3'BQH1), and 10nM Cas13 / crRNA complex (SEQ ID NO:69). Additionally 8.3 mM NaOH and 3.33 mM Tris pH 7.5 were added, or nothing was added. Detection was performed in real time by measuring fluorescence on a plate reader.

[0520] The results showed that using a higher pH value than the standard for the Cap-SDA reaction resulted in faster detection of the ssDNA target ( Fig.19 ).

[0521] Example 21: Amplification using Nb.BbvCI endogenous nicking

[0522] This example demonstrates the detection of dsDNA genomic targets (Ct extracted genomes) using the Nb.BbvCI endogenous nicking site using Cap-SDA reactions without bump primers (only relative primers).

[0523] The Cap-SDA reaction contained 100 mM Tris pH 7, 10 mM KOAc, 100 ng / uL T4gp32, 0.5 mM dNTPs, 1 mM rNTPs, 2.5 mM DTT, 5 U / uL T7 RNAP, 1 uM blocked SDA primer (with a length of 25 nucleotides and blocked with 3C6), 100 nM blocked T7-SDA primer (with a length of 30 nucleotides and blocked with 3C6), 100 nM 22 nucleotide relative oligonucleotide, 0.5 U / uL Bsu DNAP from a high concentration stock (50 U / uL Bsu, 400 U / uL Nb.BbvCI), 1 U / uL Nb.BbvCI nickase, 200 nM FQ reporter (rUrUrUrUrUrU containing a 5'6FAM fluorophore and a 3'BQH1 quencher (SEQ ID NO:2)), and 10nM Cas13 / crRNA complex (GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACUUAGU UCCUAGGUACUAUACGUUAUGUC (SEQ ID NO:1)). The target dsDNA was denatured in a mixture of 80mM KOH and 30mM MgOAc and then added to the reaction to initiate the reaction (final KOH was 40mM and final MgOAc was 15mM). The reaction was run at room temperature.

[0524] This example shows dsDNA amplification using a single endogenous nicking site with Nb.BbvCI nickase without the use of bump primers ( Fig.28 This example demonstrates a method that eliminates the need to design additional primers ( Fig.28 ) and was shown to be similar to the workflow using bump primers ( Fig.17 ) compared to the detection method that improves the speed and sensitivity of the measurement.

[0525] Example 22: Amplification using nickase Nt.CviPII and LwCas13a

[0526] This example demonstrates the detection of dsDNA genomic targets (Ng extracted genomes) using a short endogenous CCD nickase recognition site using Cap-SDA reactions with nickases Nt.CviPII and LwCas13a.

[0527] Cap-SDA reactions contained 50 mM Tris pH 8.75, 50 mM KOAc, 200 ng / uL T4gp32, 0.5 mM dNTPs, 0.5 mM rNTPs, 2.5 mM DTT, 2 U / uL T7 RNAP, 250 nM of each blocked SDA primer (all 29 nucleotides in length and blocked with 3C6), 200 nM blocked T7-SDA primer (28 nucleotides in length and blocked with 3C6), 0.5 U / uL Bsu DNAP from a high concentration stock (165 U / uL Bsu, 20 U / uL Nt.CviPII), 0.05 U / uL Nt.CviPII nickase, 200 nM FQ reporter (rUrUrUrUrUrU containing a 5' 6FAM fluorophore and a 3' BQH1 quencher (SEQ ID NO:2)), and 10nM Cas13 / crRNA complex. The target dsDNA was diluted in 30mM MgOAc and then added to the reaction to initiate the reaction (final MgOAc was 15mM). The reaction was run at room temperature.

[0528] This data demonstrates detection and Cas13 signal output using an Nt.CviPII-based workflow targeting two opposing endogenous nicking sites. Fig.29 Target sensitivity was shown to be high and detected within 10-15 minutes. Sensitivity and time to results were improved compared to Nb.BbvCI-based workflows (compared to Fig.28 Compared to ELISA, the time to results is reduced from 25-90 minutes to 10-15 minutes).

[0529] Example 23: Amplification using nickase Nt.CviPII and LbCas12a

[0530] This example demonstrates the detection of dsDNA genomic targets (Ng extracted genomes) using a short endogenous CCD nickase recognition site using Cap-SDA reactions with nickase Nt.CviPII and LbCas12a.

[0531] The Cap-SDA reaction contained 50 mM Tris pH 8.75, 50 mM KOAc, 150 ng / uL T4gp32, 0.5 mM dNTPs, 2.5 mM DTT, 1 uM of each of the blocked SDA primers (TGCTGCAGCTAGAAGTCCGAGAAGT (SEQ ID NO: 3) blocked with 3C6 and TGCTGCAGCTAGAAGTCCGTAGACA (SEQ ID NO: 4) blocked with 3C6), 0.5 U / uL BsuDNAP from a high concentration stock (165 U / uL Bsu, 20 U / uL Nt.CviPII), 0.1 U / uL Nt.CviPII nickase, 200 nM FQ reporter (TTATTTTATT (SEQ ID NO: 5) containing a 56FAM fluorophore and a 3BQH1 quencher), and 10 nM Cas12 / gRNA complex (UAAUUUCUACUAAGUGUAGAUGAAGTGATGACGAGTGTCTA (SEQ ID NO: 6)). The target dsDNA was diluted in 30mM MgOAc and then added to the reaction to initiate the reaction (final MgOAc was 15mM). The reaction was run at room temperature.

[0532] This data demonstrates detection using an Nt.CviPII-based workflow targeting two opposing endogenous nicking sites and Cas12 signal output. Fig.30 It was shown that the target nucleic acid was detected within 8 minutes using this Nt.CviPII-based workflow.

[0533] Example 24: Amplification using the nicking enzyme Nt.CviPII

[0534] This example demonstrates the detection of dsDNA genomic targets (Ng extracted genomes) using a short endogenous CCD nickase recognition site using Cap-SDA reactions with the nickase Nt.CviPII by direct oligonucleotide pull-down assay on lateral flow strips.

[0535] Amplified material (capture sequence 4xTGTA) is detected by direct capture on the lateral flow strip. Cap-SDA reactants contain 50mM Tris pH 8.75, 50mM KOAc, 200ng / uL T4gp32, 0.5mM dNTP, 2.5mM DTT, each of the blocked SDA primers of 250nM (all with a length of 29 nucleotides and blocked with 3C6), 0.5U / uL Bsu DNAP, 0.05U / uL Nt.CviPII nickase from high concentration stock solution (165U / uL Bsu, 20U / uL Nt.CviPII), 250nM amplicon capture probe. Target dsDNA is diluted in 30mM MgOAc, then added to the reaction to initiate the reaction (final MgOAc is 15mM). The reaction is run at room temperature for 30 minutes, then run on the lateral flow strip. The running buffer for lateral flow contained 50 mM Tris pH 8.75, 50 mM KOAc, 2% Ecosurf and 2 uM Poly-T oligonucleotide to reduce background.

[0536] This data shows detection using cSDA amplification reactions by direct oligonucleotide pull-down assay on lateral flow strips. All reaction bands (200, 200, 100, 100, 20, 20, 20, 20) were visible on the lateral flow strips ( Fig.31 ).

[0537] Example 25: Multiplex detection after amplification using the nicking enzyme Nt.CviPII

[0538] This example demonstrates multiplexed detection of two dsDNA genomic targets (Ct or Ng extracted genomes) using a short endogenous CCD nickase recognition site using Cap-SDA reactions with the nickase Nt.CviPII.

[0539] Amplified material was detected by direct capture on the lateral flow strip (the capture sequence of Ng was 4xTGTA, and the capture sequence of Ct was 4xTTGA). Cap-SDA reactions contained 50mM Tris pH 8.75, 50mM KOAc, 200ng / uLT4gp32, 0.5mM dNTP, 2.5mM DTT, 250nM of each of the blocked SDA primers (having a length of 29 nucleotides or 32 nucleotides and blocked with 3C6), 0.5U / uL Bsu DNAP from a high concentration stock solution (165U / uL Bsu, 20U / uL Nt.CviPII), 0.05U / uL Nt.CviPII nickase, 250nM amplicon capture probe. Target dsDNA was diluted in 30mM MgOAc and then added to the reaction to initiate the reaction (final MgOAc was 15mM). The reaction was run for 30 minutes at room temperature and then run on lateral flow strips. The running buffer for lateral flow contained 50 mM Tris pH 8.75, 50 mM KOAc, 2% Ecosurf and 2 uM Poly-T oligonucleotide to reduce background.

[0540] The Nt.CviPII workflow using lateral flow readouts has multiple functions ( Fig.32 Specifically, two primer pairs are amplified independently in the presence of each other, and their products are detected independently on the lateral flow strip using different pull-down capture sequences ( Fig.32 ).

[0541] Example 26: Amplification using the nicking enzyme Nt.CviPII

[0542] This example demonstrates the detection of dsDNA genomic targets (Ng extracted genomes) using a short endogenous CCD nickase recognition site using Cap-SDA reactions with the nickase Nt.CviPII.

[0543] Amplified material (capture sequence 4xTGTA) is detected by direct capture on lateral flow strips. The "Biophos" capture probe used is single-stranded or contains a hairpin. Cap-SDA reactants contain 50mM Tris pH 8.75, 50mM KOAc, 500ng / uL T4gp32, 0.5mM dNTP, 2.5mM DTT, each of the blocked SDA primers of 250nM (all having a length of 29 nucleotides and blocked with 3C6), 0.5U / uL Bsu DNAP, 0.05U / uL Nt.CviPII nickase, 250nM amplicon capture probe from high concentration stock solution (165U / uL Bsu, 20U / uL Nt.CviPII). The target dsDNA was diluted in 30 mM MgOAc and in the presence of 10 ng / uL background hgDNA and then added to the reaction to initiate the reaction (final MgOAc was 15 mM). The reaction was run for 30 minutes at room temperature and then run on the lateral flow strip. The running buffer for the lateral flow contained 50 mM Tris pH 8.75, 50 mM KOAc, 2% Ecosurf and 2 uM Poly-T oligonucleotides to reduce background.

[0544] Background DNA is known to be a major inhibitory compound found in clinical sample matrices. This example shows that the performance of the cSDA assay is enhanced when using the hairpin stabilizer-Biophos SDA primers in the presence of human genomic DNA ( Fig.33 ).

[0545] Example 27: Amplification using single-stranded or double-stranded hairpin SDA primers

[0546] This example demonstrates the detection of a synthetic ssDNA target (TGAGGAGGAGGAAGTGATGACGAGTGTCTACTCCTCCTCA (SEQ ID NO: 7)) using a Cap-SDA reaction using a primer stabilizer as a single-stranded or double-stranded hairpin.

[0547] Cap-SDA reactions contained 50 mM Tris pH 8.75, 50 mM KOAc, 100 ng / uL or 200 ng / uL T4gp32 (as indicated), 0.5 mM dNTPs, 0.2x Evagreen DNA dye, 2.5 mM DTT, 1 uM blocked SDA primer (GAAGGTCGAAGATCGCTGAGGAGGAG (SEQ ID NO: 8) blocked with 3SpC3, and SDA primer with a length of 38 nucleotides and blocked with 3SpC3), 0.5 U / uL Bsu DNAP, 1 U / uL Nb.BbvCI nickase from a high concentration stock (165 U / uL Bsu, 400 U / uL Nb.BbvCI). Target ssDNA was diluted in 75 mM MgOAc and then added to the reaction to initiate the reaction (final MgOAc was 15 mM). The reaction was run at room temperature. The mean of two replicates is shown.

[0548] The results show that amplification using SDA primers with hairpin stabilizers results in faster amplification compared to SDA primers with single-stranded stabilizers, i.e., the detection time is reduced when SDA primers with hairpin stabilizers are used (Figure 34). In addition, the performance of the hairpin stabilizer is independent of the T4gp32 concentration, while the single-stranded stabilizer is significantly affected at high T4gp32 concentrations (Figure 34). The use of hairpin stabilizers allows for higher T4gp32 concentrations, which is very beneficial in the presence of clinical sample matrices containing large amounts of background DNA.

[0549] Example 28: Amplification using single-stranded or double-stranded hairpin SDA primers

[0550] This example demonstrates the detection of dsDNA genomic targets (Ng extracted genomes) using Cap-SDA reactions using primer stabilizers as single-stranded or double-stranded hairpins. The reactions were performed in the presence or absence of 20ng human genomic DNA background.

[0551] The Cap-SDA reaction contained 50 mM Tris pH 8.75, 50 mM KOAc, 200 ng / uL T4gp32, 0.5 mM dNTPs, 1 mM rNTPs, 2.5 mM DTT, 5 U / uL T7 RNAP, 250 nM of each blocked SDA primer (SEQ ID NO: 3 blocked with 3C6, SEQ ID NO: 4 blocked with 3C6, or an SDA primer having a length of 36 nucleotides and blocked with 3C6), 200 nM blocked T7-SDA primer (TAATACGACTCACTATAGGGCCGAGAAGTG (SEQ ID NO: 9) blocked with 3SpC3), 0.5 U / uL Bsu DNAP from a high concentration stock (165 U / uL Bsu, 20 U / uL Nt.CviPII), 0.05 U / uL Nt.CviPII nickase, 200nM FQ reporter (SEQ ID NO: 2 containing 56FAM fluorophore and 3BQH1 quencher) and 10nM Cas13 / crRNA complex (GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACAGACACUCGUCAUCACUUCU (SEQ ID NO: 10)). The target ssDNA was diluted in 75mM MgOAc and then added to the reaction to initiate the reaction (final MgOAc was 15mM). The reaction was run at room temperature. The average of two replicates is shown.

[0552] Fig.35 It was shown that amplification using Cap-SDA primers with single-stranded stabilizers could not stably detect target nucleic acids in the presence of human genomic DNA, while Cap-SDA primers with hairpin stabilizers showed stable detection of target nucleic acids in the presence of human genomic DNA compared to amplification and detection in the absence of human genomic DNA ( Fig.35 ). The hairpin stabilizer helps to restore signal loss when amplifying in the presence of human background DNA. Using a Cap-SDA primer with a hairpin stabilizer instead of a Cap-SDA primer with a single-strand stabilizer allows for tolerance of high T4gp32 concentrations.

[0553] Example 29: SDA using Nt.CviPII nickase

[0554] This example demonstrates detection of a synthetic ssDNA target (CCATGCACGTGCGAAGAAGCTATAAGACATGTACGTGCATGGACTTCTAGCTGCAGCA (SEQ ID NO: 11)) using a short CCD nickase recognition site using the Cap-SDA reaction with Nt.CviPII nickase.

[0555] Cap-SDA reaction contained 50mM Tris pH 8.75, 50mM KOAc, 400ng / uL T4gp32, 0.5mM dNTP, 2.5mM DTT, 500nM blocked SDA primer (TGCTGCAGCTAGAAGTCCATGCACGT (SEQID NO: 12) blocked with 3C6), 0.2xEvagreen DNA dye, 0.5U / uL Bsu DNAP from high concentration stock solution (165U / uL Bsu, 20U / uL Nt.CviPII), 0.05U / uL Nt.CviPII nickase. Target ssDNA was diluted in 30mM MgOAc and then added to the reaction to initiate the reaction (final MgOAc was 15mM). The reaction was run at room temperature. The SDA primers were pretreated or not pretreated with Klenow Large Fragment (KF) by incubation in 50 mM Tris pH 8.75, 50 mM KOAc, 10 mM MgOAc and 1 U / uL (or no) Klenow Large Fragment at 37C for 1 hour followed by inactivation at 85C for 20 minutes.

[0556] Klenow fragment DNAP with specific 3' exonuclease activity was used to improve the purity of the Cap-SDA primer pool and enrich SDA primers with blocked 3' ends. Cap-SDA primers with free 3' ends can be extended by DNA polymerase.

[0557] This data suggests that removing uncapped primers with free 3' ends can reduce the rate of primer-dimer formation and thus improve assay performance ( Fig.36 ).

[0558] Example 30: Amplification using the nicking enzyme Nt.CviPII

[0559] This example demonstrates the detection of synthetic ssDNA targets (SEQ ID NOs: 31, 32, 33, 34 shown in Table 3) using a short CCD nickase recognition site using Cap-SDA reactions with the nickase Nt.CviPII.

[0560] Table 3:

[0561]

[0562] Cap-SDA reaction contains 50mM Tris pH 8.75, 50mM KOAc, 400ng / uL T4gp32, 0.5mMdNTP, 2.5mM DTT, 500nM blocked SDA primer (blocked with 3C6), 0.2xEvagreen DNA dye, 0.5U / uL Bsu DNAP, 0.05U / uL Nt.CviPII nickase from high concentration stock solution (165U / uL Bsu, 20U / uL Nt.CviPII). Target ssDNA is diluted in 30mM MgOAc and then added to the reaction to initiate the reaction (final MgOAc is 15mM). The reaction is run at room temperature. The ssDNA target does not contain an internal nicking sequence in the amplicon region, or contains an internal nicking sequence in the amplicon region.

[0563] This data demonstrates that when using the Nt.CviPII workflow targeting two opposing native nicking sites, the target region can be amplified even when additional endogenous nicking sites are present within the amplicon (i.e., between the two opposing nicking sites targeted by the primers). Fig.37 ). This allows a wider range of sequences to be targeted, providing greater flexibility when designing around conserved sequences and unnecessary similarities to cross-reactive species.

[0564] Example 31: Sponge oligonucleotides neutralize T4gp32-related background

[0565] This example shows that adding sponge oligonucleotides to the running buffer can remove the background test line signal.

[0566] The capped SDA reaction contained 50 mM Tris pH 8.75, 50 mM KOAc, 200 ng / uL T4gp32, 0.5 mM dNTPs, 2.5 mM DTT, and 250 nM amplicon capture probe, diluted 1:1 with running buffer containing 50 mM Tris pH 8.75 and 50 mM KOAc, 50 mM Tris pH 8.75 and 50 mM KOAc with 10% skim milk, or 2 uM of 50 mM Tris pH 8.75 and 50 mM KOAc with "sponge oligonucleotides." The mixture was then run on a lateral flow strip designed to pull down the positive control oligonucleotide by either hapten pull-down or oligonucleotide pull-down.

[0567] When reactions containing both T4gp32 and capture probes are run on lateral flow strips (such as hapten pull-downs or oligonucleotide pull-downs), significant background test line signals are observed using only Tris running buffer (see Fig.40 ). Background noise is induced by the presence of T4gp32 in combination with the detection probe. Addition of milk protein to the running buffer as a blocking method reduced some of the background test line signal ( Fig.40 Adding sponge oligonucleotides to the running buffer is an effective way to neutralize background ( Fig.40 ). The sponge oligonucleotides may bind to excess T4gp32 and neutralize its background induction behavior.

[0568] Example 32: Ambient temperature virus particle lysis

[0569] This example demonstrates efficient virion lysis and effective inhibition of RNases at ambient temperature via use of the lysis technology provided herein.

[0570] Virus lysis

[0571] Frozen titrated viral stocks of FluA and SARS-CoV-2 were added to 10 mM Tris-HCl, 1 mM EDTA (pH 8.0) buffer (TE buffer) or one of three nasal swab matrices (generated by eluting an anterior nasal swab in 1 mL TE buffer). These artificial specimens were treated with 20 mM sodium hydroxide (NaOH) or a 95°C / 3 minute thermal lysis step in the presence of 5 mM TCEP (reducing agent) was used as a positive control. A portion of the lysed material was added to a room temperature (22°C) reverse transcriptase (RT) reaction to convert the released viral RNA into cDNA at a 1:1 ratio. The RT reaction was terminated by heat inactivation of the RT reaction. A portion of the RT reaction was added to a standard qPCR reaction with primers and taqman probes specific for the appropriate virus.

[0572] Virion lysis preparations were assessed by measuring the Cq values ​​of the samples. High Cq values ​​indicated poor or no virion lysis, while lower Cp values ​​indicated optimal virion lysis.

[0573] The results showed that FluA( Fig.41A ) and SARS-CoV-2 (SCV2) ( Fig.41B ) Viruses can be effectively lysed and detected in nasal swab matrix using 20 mM NaOH at room temperature, comparable to or better than thermal lysis control conditions.

[0574] RNase inhibition

[0575] Nasal swab matrix was generated by eluting one anterior nasal swab in 1 mL TE buffer. The nasal swab matrix was subsequently treated with a commercial RNase inhibitor or 15 mM NaOH. Residual RNase activity was analyzed using a standard RNase Alert protocol.

[0576] The results showed that NaOH treatment effectively reduced the amount of RNase activity in the samples ( Fig.42 ). NaOH has the added benefit of inhibiting RNases present in clinical matrices, protecting the released viral genome from pre-split viral particles as well as viral particles that are lysed by this treatment.

[0577] pH Solution

[0578] Samples were generated by diluting SARS-CoV-2 (SCV2) virus stock with TE buffer. The samples were treated with KOH at a concentration of 10mM, 25mM, 50mM, 75mM or 100mM or NaOH at a concentration of 10mM, 25mM, 50mM, 75mM or 100mM. A 95°C / 3 minute thermal lysis step was used as a positive lysis control. A portion of the lysed material was added to a room temperature (22°C in this case) reverse transcriptase (RT) reaction to convert the released viral RNA into cDNA at a 1:1 ratio. The RT reaction was terminated by thermal inactivation of RT. A portion of the RT reactants were then added to a standard qPCR reaction with primers and taqman probes specific for the appropriate virus.

[0579] Virion lysis preparations were assessed by measuring the Cq values ​​of the samples. High Cq values ​​indicated poor or no virion lysis, while lower Cp values ​​indicated optimal virion lysis.

[0580] The results showed that NaOH and KOH could effectively release viral nucleic acid within a certain concentration range ( Fig.43 ).

[0581] Hydroxide-based chemical cleavage of non-enveloped viruses

[0582] Samples were prepared by diluting human adenovirus stock in TE buffer. Samples were kept at room temperature (22°C), heated to 95°C (thermolysis), or treated with increasing concentrations (20mM, 40mM, 60mM, 80mM, 100mM, or 200mM) of NaOH for 5 minutes.

[0583] After treatment, the solution was analyzed by qPCR using human adenovirus-specific PCR primers and taqman probes to determine viral nucleic acid release.

[0584] The results showed that NaOH lysis at room temperature released more DNA than heat lysis of non-enveloped human adenovirus ( Fig.44 ).

[0585] Example 33: Ambient Temperature Bacterial Lysis

[0586] This example demonstrates efficient bacterial lysis at ambient temperature via use of the lysis techniques provided herein.

[0587] Bacterial lysis

[0588] Samples were generated by diluting freshly grown N.gonorrhoeae or C.trachomatis (from frozen stock solution) with TE buffer. Samples were then treated with 10mM, 25mM, 50mM, 75mM or 100mM KOH concentrations. Pearl milling (pearl lysis) was used as a positive control. A portion of the lysate was then added to a standard qPCR reaction with primers and taqman probes specific for the appropriate bacteria.

[0589] Bacterial lysis preparations were assessed by measuring the Cq values ​​of the samples. High Cq values ​​indicated poor or no bacterial lysis, while lower Cq values ​​indicated optimal viral particle lysis.

[0590] The results showed that KOH lysis at high KOH concentrations (specifically above 25 mM) was effective in releasing bacterial nucleic acids within a certain concentration range ( Fig.45A -B). In particular, concentrations of 100 mM and 200 mM showed similar or better lysis than bead lysis ( Fig.45A -B).

[0591] Add detergent

[0592] The samples were prepared by diluting Neisseria gonorrhoeae in TE buffer. Fig.46 Samples were treated with additional detergents as indicated in. Bead beating (bead lysis) was used as a positive control.

[0593] The addition of detergent enables higher lysis efficiency to be obtained at lower KOH concentrations.

[0594] Example 34: Lysis at different incubation temperatures

[0595] This example demonstrates efficient bacterial lysis at different temperatures via use of the lysis techniques provided herein.

[0596] Samples were prepared by diluting Neisseria gonorrhoeae in TE buffer. Samples were treated with KOH or additives as indicated below and incubated for 3-5 minutes at the indicated temperature. 95°C thermal lysis was used as a positive control. A portion of the lysate was added to the PCR reaction and the nucleic acid concentration reflecting nucleic acid release was measured for each sample. Results were normalized for 100% thermal lysis (95°C).

[0597] PI64 9

[0598] The samples were treated with KOH or HCl or PI64 9 0.5% and incubated at room temperature (22°C), 50°C or 65°C, see table below.

[0599] Table 4:

[0600] Chemical Temperature and incubation time Cleaners and Concentrators KOH 50mM Room temperature (22℃) 13.5mM HCL 50℃,3min Pl64 9(0.5％) TE(pH 8) 75℃,3min 95℃,5min

[0601] The results showed that P164 alone was ineffective and that 50 mM KOH achieved efficient bacterial lysis regardless of temperature or the addition of additional detergent ( Fig.47 ). Treatment with 13.5 mM HCl showed better lysis at higher temperatures and with the addition of additional detergent, but was inferior to KOH ( Fig.47 ).

[0602] ESH9

[0603] Samples were treated with KOH or HCl and 3% ESH9 and incubated at room temperature (22°C), 50°C, or 70°C for 3-5 minutes.

[0604] Table 5:

[0605] Chemical Temperature and incubation time Cleaners and Concentrators KOH 50mM Room temperature (22℃) 13.5mM HCL 50℃,3min ESH9 (3%) TE(pH 8) 70℃,3min 95℃,5min

[0606] The results showed that 50 mM KOH was effective in lysing N. gonorrhoeae regardless of the lysis temperature. The HCl+Ecosurf treatment showed better lysis at higher temperatures (specifically at 50°C and 65°C lysis), but was not as good as KOH ( Fig.48 In addition, no lysis was observed when incubated at 50°C or 70°C alone without any detergents or additives ( Fig.48 ).

[0607] NP40 – Constant KOH concentration

[0608] Samples were treated with 50 mM KOH or HCl and 1%-3% NP40 and incubated at room temperature (22°C) or 50°C for 3-5 minutes.

[0609] Table 6:

[0610] Chemical Temperature and incubation time Cleaners and Concentrators KOH 50mM Room temperature (22℃) 13.5mM HCL 50℃,3min NP40 (1%-3%) TE(pH 8) 95℃,5min

[0611] The results showed that NP40 alone was ineffective for gDNA release and that 50 mM KOH achieved efficient bacterial lysis regardless of temperature or the addition of additional detergent ( Fig.49 ). Treatment with 13.5 mM HCl showed better lysis at higher temperatures and with the addition of additional detergent, but was inferior to KOH ( Fig.49 ).

[0612] NP40 – Various KOH concentrations

[0613] Samples were treated with 0 mM to 50 mM KOH or HCl and 3% NP40 and incubated at room temperature (22°C) or 50°C for 3-5 minutes.

[0614] Table 7:

[0615] Chemical Temperature and incubation time Cleaners and Concentrators KOH 0mM-50mM Room temperature (22℃) 50℃,3min NP40 (3%) TE(pH 8) 95℃,5min

[0616] The results showed that in the presence of 3% NP40, lower concentrations of KOH could be used to achieve the same lysis as 50 mM KOH alone ( Fig.50 ).

[0617] Improved LAMP-Cas assay

[0618] The samples were treated with 50 mM KOH and incubated at room temperature (22° C.) for 3-10 minutes. The lysed samples containing the released nucleic acids were amplified by LAMP and detected by the Cas detection system.

[0619] The results showed that the LoD increased when samples were lysed with KOH or thermal lysis compared to the no lysis control (Figure 51).

[0620] Example 35: KOH lysis of Neisseria gonorrhoeae in vaginal stroma in LAMP-Cas

[0621] This example demonstrates efficient bacterial lysis in the vaginal stroma via use of the lysis technology provided herein.

[0622] Samples were prepared by diluting N. gonorrhoeae in vaginal swab matrix (1 swab eluted in 3 mL buffer). Samples were treated with 0 mM, 15 mM, 25 mM, 50 mM or 85 mM KOH and DNA was detected by LAMP-Cas reaction (run at 60C in ABIQS5).

[0623] The results showed that low KOH concentrations (specifically 15 mM KOH) did not increase the sensitivity of the LAMP Cas reaction compared to no KOH treatment. When bacterial cells in the vaginal matrix were treated with higher concentrations of KOH (specifically 25 mM or higher), the sensitivity of the LAMP Cas reaction was improved ( Fig.52 ). Treatment of bacterial cells with >25 mM KOH results in the release of more genomic DNA for downstream amplification.

[0624] Equivalent

[0625] Those skilled in the art will recognize or be able to ascertain using only routine experimentation many equivalents to the specific embodiments of the invention provided herein. The scope of the present invention is not intended to be limited to the above description, but rather as set forth in the following claims:

Claims

1. A composition comprising: (a) a double-stranded DNA target nucleic acid sequence comprising a first native restriction enzyme recognition sequence and a second native restriction enzyme recognition sequence located on opposite strands separated by a target nucleic acid region; (b) a first SDA primer, the first SDA primer comprising: (i) a sequence complementary to the first native restriction enzyme recognition sequence; (ii) a 3' blocking molecule; and (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides; (c) a second SDA primer, the second SDA primer comprising: (i) a sequence complementary to the recognition sequence of the second restriction enzyme nickase; (ii) a 3' blocking molecule; and (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides; (d) shearing enzyme; (e) a DNA polymerase having strand displacement activity; (f) single-chain binding protein; and (g) dNTPs.

2. The composition of claim 1, wherein the 3' blocking molecule of the first SDA primer and / or the second SDA primer is selected from the group consisting of 3' ddNTP, 3' reverse dT, 3' carbon chain spacer, 3' hexanediol, 3' amino spacer and 3' phosphorylation.

3. The composition of any one of the preceding claims, wherein at least one of the stabilizing sequences is a hairpin stabilizing sequence.

4. The composition according to any one of the preceding claims, wherein both stabilizing sequences are hairpin stabilizing sequences.

5. The composition of any of the preceding claims, wherein at least one of the stabilizing sequences comprises a T7 promoter sequence.

6. The composition according to any one of the preceding claims, wherein the DNA polymerase is selected from the group consisting of Bsu DNAP, Klenow LF, Klenow Exo- and Isopol and Bst DNAP.

7. The composition of any one of the preceding claims, wherein the single-chain binding protein is T4gp32.

8. The composition of any one of the preceding claims, wherein the concentration of the single-chain binding protein is at least 200 ng / μl.

9. The composition of any one of the preceding claims, wherein the composition further comprises KOAc or PEG.

10. The composition according to any one of the preceding claims, wherein the first nickase recognition sequence and the second nickase recognition sequence are separated by a maximum of 100 nucleotides.

11. The composition of any of the preceding claims, wherein the first native restriction enzyme recognition sequence and the second native restriction enzyme recognition sequence are about 3 to about 7 nucleotides.

12. The composition of any one of the preceding claims, wherein the first native restriction enzyme recognition sequence and the second native restriction enzyme recognition sequence are native nickase recognition sequences.

13. The composition of claim 12, wherein the first nickase recognition sequence and the second nickase recognition sequence are both 3 nucleotides.

14. The composition according to any one of claims 12-13, wherein the first nickase recognition sequence and the second nickase recognition sequence are CCD nickase recognition sequences.

15. The composition of any one of claims 12-14, wherein the nickase is Nt.CviPII nickase.

16. The composition of any one of claims 1-11, wherein at least one of the dNTPs is a modified dNTP.

17. The composition of any one of claims 1-11 and 16, wherein the first SDA primer sequence complementary to the first native restriction enzyme recognition sequence comprises one or more modified nucleotides.

18. The composition of any one of claims 1-11 and 16-17, wherein the first SDA primer sequence complementary to the first native restriction enzyme recognition sequence comprises a PTO linkage.

19. The composition of any one of claims 1-11 and 16-18, wherein the second SDA primer sequence complementary to the second native restriction enzyme recognition sequence comprises one or more modified nucleotides.

20. The composition of any one of claims 1-11 and 16-19, wherein the second SDA primer sequence complementary to the first native restriction enzyme recognition sequence comprises a PTO linkage.

21. The composition according to claim 2, wherein the 3' carbon chain spacer is a carbon chain that blocks the extension from binding to the 3' OH group.

22. The composition of claim 21, wherein the length of the carbon chain spacer can be 3C, 4C, 5C, 6C, 7C, 8C, 9C, 10C, 11C, 12C or longer.

23. A composition according to any one of the preceding claims, wherein the composition further comprises: (h) a detection system, the detection system comprising: (i) a guide nucleic acid comprising a nucleic acid sequence complementary to the target nucleic acid region or a portion thereof; and (ii) Cas enzymes with incidental cleavage activity; (iii) a nucleic acid reporter probe that is sensitive to the incidental cleavage activity, such that the nucleic acid reporter probe has a first uncleaved state and a second cleaved state that are detectably different.

24. A composition as described in claim 23, wherein the Cas enzyme is a Cas13 enzyme or a Cas12 enzyme.

25. The composition of claim 24, wherein the Cas13 enzyme is a Cas13a enzyme.

26. The composition of any one of claims 23-25, wherein the nucleic acid reporter probe comprises a fluorophore and a quencher.

27. The composition of any one of claims 1-22, wherein the composition further comprises: (h) a detection system, the detection system comprising: (i) capture probes; and (ii) A conjugate capture probe comprising a detectable label and a 3' blocking entity.

28. The composition of claim 26, wherein the capture probe is a biotinylated capture probe.

29. The composition of any one of claims 27-28, wherein the capture probe is about 10 to about 20 nucleotides.

30. The composition of any one of claims 27-29, wherein the conjugate capture probe is about 10 to about 20 nucleotides.

31. A method for amplifying a double-stranded DNA target nucleic acid sequence in a sample, the double-stranded DNA target nucleic acid sequence comprising a first native restriction enzyme recognition sequence and a second native restriction enzyme recognition sequence located on opposite strands separated by a target nucleic acid region, wherein the method comprises: (A) contacting the sample with a composition comprising: (a) a first SDA primer, the first SDA primer comprising: (i) a sequence complementary to the first native restriction enzyme recognition sequence; (ii) a 3' blocking molecule; and (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides; (b) a second SDA primer, the second SDA primer comprising: (i) a sequence complementary to the second native restriction enzyme recognition sequence; (ii) a 3' blocking molecule; and (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides; (c) a shearing enzyme; (d) a DNA polymerase having strand displacement activity; (e) single-chain binding protein; (f) dNTPs; and thereby producing a reaction mixture; (B) incubating the reaction mixture under conditions conducive to: (i) the first SDA primer and the second SDA primer hybridize to the double-stranded DNA target nucleic acid sequence in the sample; and (ii) amplification of the target nucleic acid, Multiple copies of the amplified target nucleic acid are thereby produced.

32. The method of claim 31, wherein steps (A) to (B) are performed at ambient temperature.

33. The method of claim 31, wherein steps (A) to (B) are performed without temperature cycling.

34. The method of claim 31, wherein steps (A) to (B) are performed at a temperature of at most 50°C.

35. The method of claim 31, wherein said (A) to (B) is performed at a temperature of at most 40°C.

36. The method according to any one of claims 31-35, wherein the 3' blocking molecule of the first SDA primer and / or the second SDA primer is selected from the group consisting of 3' ddNTP, 3' reverse dT, 3' carbon chain spacer, 3' hexanediol, 3' amino spacer and 3' phosphorylation.

37. The method of any one of claims 31-36, wherein at least one of the stabilizing sequences is a hairpin stabilizing sequence.

38. The method of any one of claims 31 to 37, wherein both stabilizing sequences are hairpin stabilizing sequences.

39. The method of any one of claims 31-38, wherein at least one of the stabilizing sequences comprises a T7 promoter sequence.

40. The method of any one of claims 31-39, wherein the DNA polymerase is selected from the group consisting of Bsu DNAP, Klenow LF, Klenow Exo- and Isopol, and Bst DNAP.

41. The method of any one of claims 31-40, wherein the single-stranded binding protein is T4gp32.

42. The method of any one of claims 31-41, wherein the concentration of the single-stranded binding protein is at least 200 ng / μl.

43. The method of any one of claims 31-42, wherein the composition further comprises KOAc or PEG.

44. The method of any one of claims 31-43, wherein the first nickase recognition sequence and the second nickase recognition sequence are separated by a maximum of 100 nucleotides.

45. The method of any one of claims 31-44, wherein the first native restriction enzyme recognition sequence and the second native restriction enzyme recognition sequence are about 3 to about 7 nucleotides.

46. ​​The method of any one of claims 31-45, wherein the first native restriction enzyme recognition sequence and the second native restriction enzyme recognition sequence are native nickase recognition sequences.

47. The method of claim 46, wherein the first nickase recognition sequence and the second nickase recognition sequence are both 3 nucleotides.

48. The method according to any one of claims 46-47, wherein the first nickase recognition sequence and the second nickase recognition sequence are CCD nickase recognition sequences.

49. The method of any one of claims 46-48, wherein the nickase is Nt.CviPII nickase.

50. The method of any one of claims 46-49, wherein at least one of the dNTPs is a modified dNTP.

51. The method of any one of claims 31-45 and 50, wherein the first SDA primer sequence complementary to the first native restriction enzyme recognition sequence comprises one or more modified nucleotides.

52. The method of any one of claims 31-45 and 50-51, wherein the first SDA primer sequence complementary to the first native restriction enzyme recognition sequence comprises a PTO linkage.

53. The method of any one of claims 31-45 and 50-52, wherein the second SDA primer sequence complementary to the second native restriction enzyme recognition sequence comprises one or more modified nucleotides.

54. The method of any one of claims 31-45 and 50-53, wherein the second SDA primer sequence complementary to the first native restriction enzyme recognition sequence comprises a PTO linkage.

55. The method according to claim 36, wherein the 3' carbon chain spacer is a carbon chain that blocks the extension from binding to the 3' OH group.

56. The method of claim 55, wherein the carbon chain spacer can be 3C, 4C, 5C, 6C, 7C, 8C, 9C, 10C, 11C, 12C or longer in length.

57. A method for detecting a double-stranded DNA target nucleic acid sequence in a sample, the double-stranded DNA target nucleic acid sequence comprising a first native restriction enzyme recognition sequence and a second native restriction enzyme recognition sequence located on opposite strands separated by a target nucleic acid region, wherein the method comprises: (A) contacting at least one copy of the amplified target nucleic acid sequence according to any one of claims 31 to 56 with a composition comprising: (i) a guide nucleic acid comprising a nucleic acid sequence complementary to the DNA cassette; and (ii) Cas enzymes with incidental cleavage activity; (iii) a nucleic acid reporter probe that is sensitive to the incidental cleavage activity, such that the nucleic acid reporter probe has a first uncleaved state and a second cleaved state that are detectably different; and (B) detecting the cleavage of the nucleic acid reporter probe by detecting the difference between the first state and the second state to determine the presence of the target nucleic acid sequence in the sample.

58. The method of claim 57, wherein the Cas enzyme is a Cas13 enzyme or a Cas12 enzyme.

59. The method of claim 58, wherein the Cas13 enzyme is a Cas13a enzyme.

60. The method of any one of claims 57-59, wherein the nucleic acid reporter probe comprises a fluorophore and a quencher.

61. A method for detecting a double-stranded DNA target nucleic acid sequence in a sample, the double-stranded DNA target nucleic acid sequence comprising a first native restriction enzyme recognition sequence and a second native restriction enzyme recognition sequence located on opposite strands separated by a target nucleic acid region, wherein the method comprises: (A) contacting at least one copy of the amplified target nucleic acid sequence according to any one of claims 31 to 56 with a composition comprising: (i) capture probes; and (ii) a conjugate capture probe comprising a detectable label and a 3' blocking entity; (B) detecting the presence of the detectable label bound to the solid substrate to determine the presence of the target nucleic acid sequence in the sample.

62. The method of claim 61, wherein the capture probe is a biotinylated capture probe.

63. The method of any one of claims 61-62, wherein the capture probe is about 10 to about 20 nucleotides.

64. The method of any one of claims 61-63, wherein the conjugate capture probe is about 10 to about 20 nucleotides.

65. The method of any one of claims 57-64, wherein amplification and detection are performed at ambient temperature.

66. The method of any one of claims 57-64, wherein amplification and detection are performed without temperature cycling.

67. The method of any one of claims 57-64, wherein amplification and detection are performed at a temperature of at most 50°C.

68. The method of any one of claims 57-64, wherein amplification and detection are performed at a maximum of 40°C.

69. A composition comprising: (a) a double-stranded DNA target nucleic acid sequence comprising at least one native restriction enzyme recognition sequence; (b) a forward primer, the forward primer comprising: (i) a 3' nucleic acid sequence complementary to the target nucleic acid sequence located downstream or 5' of the native restriction enzyme recognition sequence; and (ii) a 5' SDA primer binding sequence comprising a portion of the restriction enzyme recognition sequence; (c) a first SDA primer, the first SDA primer comprising: (i) a sequence complementary to the at least one native restriction enzyme recognition sequence; (ii) a 3' blocking molecule; and (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides; (d) a second SDA primer, the second SDA primer comprising: (i) a sequence complementary to the 5'SDA primer binding sequence of the forward primer comprising a portion of the restriction enzyme recognition sequence; (ii) a 3' blocking molecule; and (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides, the 5' stabilizing sequence comprising a partial restriction enzyme recognition sequence that together with the partial restriction enzyme recognition sequence in the 5' SDA primer binding sequence forms a complete restriction enzyme recognition sequence; (e) shearing enzyme; (f) a DNA polymerase having strand displacement activity; (g) single-chain binding protein; and (h)dNTPs.

70. The composition of claim 69, wherein the 3' blocking molecule of the first SDA primer and / or the second SDA primer is selected from the group consisting of 3' ddNTP, 3' reverse dT, 3' carbon chain spacer, 3' hexanediol, 3' amino spacer and 3' phosphorylation.

71. The composition of any one of claims 69-70, wherein at least one of the stabilizing sequences is a hairpin stabilizing sequence.

72. The composition of any one of claims 69-71, wherein both stabilizing sequences are hairpin stabilizing sequences.

73. The composition of any one of claims 69-72, wherein at least one of the stabilizing sequences comprises a T7 promoter sequence.

74. The composition of any one of claims 69-73, wherein the DNA polymerase is selected from the group consisting of Bsu DNAP, Klenow LF, Klenow Exo- and Isopol and Bst DNAP.

75. The composition of any one of claims 69-74, wherein the single-stranded binding protein is T4gp32.

76. The composition of any one of claims 69-75, wherein the concentration of the single-stranded binding protein is at least 200 ng / μl.

77. The composition of any one of claims 69-76, wherein the composition further comprises KOAc or PEG.

78. The composition of any one of claims 69-78, wherein at least one native restriction enzyme recognition sequence is about 3 to about 7 nucleotides.

79. A composition as described in claim 78, wherein the native restriction enzyme recognition sequence is 7 nucleotides.

80. The composition of any one of claims 69-79, wherein the at least one native restriction enzyme recognition sequence is a native nickase recognition sequence.

81. The composition of claim 80, wherein the at least one nickase recognition sequence is a GCTGAGG nickase recognition sequence.

82. A composition according to any one of claims 80-81, wherein the nickase is Nb.BbvCl nickase.

83. The composition of any one of claims 80-82, wherein the composition further comprises a bump primer.

84. The composition of any one of claims 69-79, wherein at least one of the dNTPs is a modified dNTP.

85. The composition of any one of claims 69 to 79 and 84, wherein the first SDA primer sequence complementary to the first native restriction enzyme recognition sequence comprises one or more modified nucleotides.

86. The composition of any one of claims 69-79 and 84-85, wherein the first SDA primer sequence complementary to the first native restriction enzyme recognition sequence comprises a PTO linkage.

87. The composition of any one of claims 69-79 and 84-86, wherein the second SDA primer sequence complementary to the second native restriction enzyme recognition sequence comprises one or more modified nucleotides.

88. The composition of any one of claims 69-79 and 84-87, wherein the second SDA primer sequence complementary to the first native restriction enzyme recognition sequence comprises a PTO linkage.

89. The composition of claim 70, wherein the 3' carbon chain spacer is a carbon chain that blocks the extension from binding to the 3' OH group.

90. The composition of claim 89, wherein the carbon chain spacer can be 3C, 4C, 5C, 6C, 7C, 8C, 9C, 10C, 11C, 12C or longer in length.

91. The composition of any one of claims 69-90, wherein the composition further comprises: (h) a detection system, the detection system comprising: (i) a guide nucleic acid comprising a nucleic acid sequence complementary to the target nucleic acid region or a portion thereof; and (ii) Cas enzymes with incidental cleavage activity; (iii) a nucleic acid reporter probe that is sensitive to the incidental cleavage activity, such that the nucleic acid reporter probe has a first uncleaved state and a second cleaved state that are detectably different.

92. The composition of claim 91, wherein the Cas enzyme is a Cas13 enzyme or a Cas12 enzyme.

93. The composition of claim 92, wherein the Cas13 enzyme is a Cas13a enzyme.

94. The composition of any one of claims 91-93, wherein the nucleic acid reporter probe comprises a fluorophore and a quencher.

95. The composition of any one of claims 69-90, wherein the composition further comprises: (h) a detection system, the detection system comprising: (i) capture probes; and (ii) A conjugate capture probe comprising a detectable label and a 3' blocking entity.

96. The composition of claim 95, wherein the capture probe is a biotinylated capture probe.

97. The composition of any one of claims 95-96, wherein the capture probe is about 10 to about 20 nucleotides.

98. The composition of any one of claims 95-97, wherein the conjugate capture probe is about 10 to about 20 nucleotides.

99. A method for amplifying a double-stranded DNA target nucleic acid sequence in a sample comprising at least one native restriction enzyme sequence, wherein the method comprises (A) contacting the sample with a composition comprising: (a) a forward primer comprising a 3' nucleic acid sequence complementary to a target nucleic acid sequence located downstream or 5' of the native nickase recognition sequence, and a 5' SDA primer binding sequence comprising a portion of the nickase recognition sequence; (b) shearing enzyme; (c) a DNA polymerase having strand displacement activity; (d) single-chain binding protein; (e) dNTPs; Thereby generating a single-stranded DNA (ssDNA) cassette; (B) contacting the ssDNA cassette of step (A) with a composition comprising: (f) a first SDA primer, the first SDA primer comprising: (i) a sequence complementary to the at least one native restriction enzyme sequence in the target nucleic acid sequence; (ii) a 3' blocking molecule; and (iii) a stabilizing sequence comprising about 8 to about 20 nucleotides; and (g) a second SDA primer, the second SDA primer comprising: (i) a sequence complementary to the 5'SDA primer binding sequence of the forward primer comprising a portion of the restriction enzyme recognition sequence; (ii) a 3' blocking molecule; and (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides, said 5' stabilizing sequence comprising a partial nicking enzyme recognition sequence that together with said partial nicking enzyme recognition sequence in said 5' SDA primer binding sequence forms a complete restriction enzyme recognition sequence, thereby producing a reaction mixture; (C) incubating the reaction mixture under conditions that favor the production of multiple copies of a nucleic acid that is identical to or complementary to the ssDNA cassette.

100. The method of claim 99, wherein the blocking molecule of the first SDA primer and the second SDA primer is selected from the group consisting of 3' ddNTP, 3' reverse dT, 3' carbon chain spacer, 3' hexanediol, 3' amino spacer and 3' phosphorylation.

101. The method of any one of claims 99-100, wherein at least one of the stabilizing sequences is a hairpin stabilizing sequence.

102. The method of any one of claims 99-101, wherein both stabilizing sequences are hairpin stabilizing sequences.

103. The method of any one of claims 99-102, wherein at least one of the stabilizing sequences comprises a T7 promoter sequence.

104. The method of any one of claims 99-103, wherein the DNA polymerase is selected from the group consisting of Bsu DNAP, Klenow LF, Klenow Exo- and Isopol, and Bst DNAP.

105. The method of any one of claims 99-104, wherein the single-stranded binding protein is T4gp32.

106. The method of any one of claims 99-105, wherein the concentration of the single-stranded binding protein is at least 200 ng / μl.

107. The method of any one of claims 99-106, wherein the composition further comprises KOAc or PEG.

108. The method of any one of claims 99-107, wherein at least one native restriction enzyme recognition sequence is about 3 to about 7 nucleotides.

109. The method of claim 108, wherein the native restriction enzyme recognition sequence is 7 nucleotides.

110. The method of any one of claims 99-109, wherein the at least one native restriction enzyme recognition sequence is a native nicking enzyme recognition sequence.

111. The method of claim 110, wherein the at least one nicking enzyme recognition sequence is a GCTGAGG nicking enzyme recognition sequence.

112. The method of any one of claims 110-111, wherein the nicking enzyme is Nb.BbvCl nicking enzyme.

113. The method of any one of claims 110-112, wherein the composition further comprises a bump primer.

114. The method of any one of claims 99-109, wherein at least one of the dNTPs is a modified dNTP.

115. The method of any one of claims 99-109 and 114, wherein the first SDA primer sequence complementary to the first native restriction enzyme recognition sequence comprises one or more modified nucleotides.

116. The method of any one of claims 99-109 and 114-115, wherein the first SDA primer sequence complementary to the first native restriction enzyme recognition sequence comprises a PTO linkage.

117. The method of any one of claims 99-109 and 114-116, wherein the second SDA primer sequence complementary to the second native restriction enzyme recognition sequence comprises one or more modified nucleotides.

118. The method of any one of claims 99-109 and 114-117, wherein the second SDA primer sequence complementary to the first native restriction enzyme recognition sequence comprises a PTO linkage.

119. The method of claim 100, wherein the 3' carbon chain spacer is a carbon chain that blocks the extension from binding to the 3' OH group.

120. The method of claim 119, wherein the carbon chain spacer can be 3C, 4C, 5C, 6C, 7C, 8C, 9C, 10C, 11C, 12C or longer in length.

121. The method of any one of claims 99-120, wherein the method further comprises a lysis step.

122. The method of claim 121, wherein the double-stranded DNA target nucleic acid sequence is treated with KOH prior to step (A).

123. The method of any one of claims 99-122, wherein steps (A) to (B) are performed at ambient temperature.

124. The method of any one of claims 99-122, wherein steps (A) to (B) are performed without temperature cycling.

125. The method of any one of claims 99-122, wherein steps (A) to (B) are performed at a maximum of 50°C.

126. The method of any one of claims 99-122, wherein said (A) to (B) is performed at a temperature of at most 40°C.

127. A method for detecting a double-stranded DNA target nucleic acid sequence in a sample comprising at least one native restriction enzyme sequence, wherein the method comprises: (A) contacting at least one copy of the amplified target nucleic acid sequence according to any one of claims 99 to 126 with a composition comprising: (i) a guide nucleic acid comprising a nucleic acid sequence complementary to the DNA cassette; and (ii) Cas enzymes with incidental cleavage activity; (iii) a nucleic acid reporter probe that is sensitive to the incidental cleavage activity, such that the nucleic acid reporter probe has a first uncleaved state and a second cleaved state that are detectably different; and (B) detecting the cleavage of the nucleic acid reporter probe by detecting the difference between the first state and the second state to determine the presence of the target nucleic acid sequence in the sample.

128. The method of claim 127, wherein the Cas enzyme is a Cas13 enzyme or a Cas12 enzyme.

129. The method of claim 128, wherein the Cas13 enzyme is a Cas13a enzyme.

130. The method of any one of claims 127-130, wherein the nucleic acid reporter probe comprises a fluorophore and a quencher.

131. A method for detecting a double-stranded DNA target nucleic acid sequence in a sample comprising at least one native restriction enzyme sequence, wherein the method comprises: (A) contacting at least one copy of the amplified target nucleic acid sequence according to any one of claims 99 to 126 with a composition comprising: (i) capture probes; and (ii) a conjugate capture probe comprising a detectable label and a 3' blocking entity; (B) detecting the presence of the detectable label bound to the solid substrate to determine the presence of the target nucleic acid sequence in the sample.

132. The method of claim 131, wherein the capture probe is a biotinylated capture probe.

133. The method of any one of claims 127-132, wherein the capture probe is about 10 to about 20 nucleotides.

134. The method of any one of claims 127-133, wherein the conjugate capture probe is about 10 to about 20 nucleotides.

135. The method of any one of claims 127-134, wherein amplification and detection are performed at ambient temperature.

136. The method of any one of claims 127-135, wherein amplification and detection are performed without temperature cycling.

137. The method of any one of claims 127-136, wherein amplification and detection are performed at a maximum of 50°C.

138. The method of any one of claims 127-137, wherein amplification and detection are performed at a maximum of 40°C.

139. A composition comprising: (a) RNA target nucleic acid; (b) a reverse primer, the reverse primer comprising: (i) a 3' sequence complementary to the RNA target nucleic acid; and (ii) a 5'SDA primer binding sequence, wherein the primer binding sequence comprises a restriction enzyme recognition sequence, a portion of a restriction enzyme recognition sequence, or a complement thereof; (c) reverse transcriptase; and (d) a forward primer, the forward primer comprising: (i) a 3' sequence complementary to the RNA target polynucleotide; and (ii) 5'SDA primer binding, wherein the primer binding sequence comprises a restriction enzyme recognition sequence or a portion of a restriction enzyme recognition sequence, or a complement thereof; (e) a first SDA primer, the first SDA primer comprising: (i) a sequence complementary to the 5' SDA primer binding sequence of the reverse primer; (ii) a 3' blocking molecule; and (iii) comprising a 5' stabilizing sequence of about 8 to about 20 nucleotides, and when the reverse primer comprises only a partial restriction enzyme recognition sequence, the first SDA primer comprises a partial restriction enzyme recognition sequence that together with the partial restriction enzyme recognition sequence in the 5' SDA primer binding sequence of the reverse primer forms a complete restriction enzyme recognition sequence; (f) a second SDA primer, the second SDA primer comprising: (i) a sequence complementary to the 5' SDA primer binding sequence of the forward primer; (ii) a 3' blocking molecule; and (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides, and when the forward primer comprises only a partial restriction enzyme recognition sequence, the first SDA primer comprises a partial restriction enzyme recognition sequence that together with the partial restriction enzyme recognition sequence in the 5' SDA primer binding sequence of the forward primer forms a complete restriction enzyme recognition sequence; (g) shearing enzyme; (h) a polymerase having strand displacement activity; (i) a single-chain binding protein; and (j) dNTPs.

140. The composition of claim 139, wherein the reverse transcriptase has RNASEh activity.

141. The composition of any one of claims 139-140, wherein the reverse transcriptase is selected from the group consisting of MMLV, AMV, Protoscript II, Superscript I and II and II and IV, RTx, GOScript, Sensiscript, Primescript and Maxima.

142. The composition of any one of claims 139-141, wherein the composition further comprises a bump primer.

143. The composition of any one of claims 139-142, wherein the 3' blocking molecule of the first SDA primer and the second SDA primer is selected from the group consisting of 3' ddNTP, 3' reverse dT, 3' carbon chain spacer, 3' hexanediol, 3' amino spacer and 3' phosphorylation.

144. The composition of any one of claims 139-143, wherein at least one of the stabilizing sequences is a hairpin stabilizing sequence.

145. The composition of any one of claims 139-144, wherein both stabilizing sequences are hairpin stabilizing sequences.

146. The composition of any one of claims 139-145, wherein at least one of the stabilizing sequences comprises a T7 promoter sequence.

147. The composition of any one of claims 139-146, wherein the DNA polymerase is selected from the group consisting of BsuDNAP, Klenow LF, Klenow Exo- and Isopol, and Bst DNAP.

148. The composition of any one of claims 139-147, wherein the single-chain binding protein is T4gp32.

149. The composition of any one of claims 139-148, wherein the concentration of the single-stranded binding protein is at least 200 ng / μl.

150. The composition of any one of claims 139-149, wherein the composition further comprises KOAc or PEG.

151. A composition according to any one of claims 139-150, wherein the restriction enzyme recognition sequence is a nicking enzyme recognition sequence.

152. A composition according to any one of claims 139-151, wherein the nickase is Nt.CviPII nickase or Nb.BbvCI nickase.

153. The composition of any one of claims 139-150, wherein at least one of the dNTPs is a modified dNTP.

154. The composition of any one of claims 139-150 and 153, wherein the first SDA primer sequence complementary to the first native restriction enzyme recognition sequence comprises one or more modified nucleotides.

155. The composition of any one of claims 139-150 and 153-154, wherein the first SDA primer sequence complementary to the first native restriction enzyme recognition sequence comprises a PTO linkage.

156. The composition of any one of claims 139-150 and 153-155, wherein the second SDA primer sequence complementary to the second native restriction enzyme recognition sequence comprises one or more modified nucleotides.

157. The composition of any one of claims 139-150 and 153-156, wherein the second SDA primer sequence complementary to the first native restriction enzyme recognition sequence comprises a PTO linkage.

158. The composition of claim 143, wherein the 3' carbon chain spacer is a carbon chain that blocks the extension from binding to the 3' OH group.

159. The composition of claim 158, wherein the carbon chain spacer can be 3C, 4C, 5C, 6C, 7C, 8C, 9C, 10C, 11C, 12C or longer in length.

160. The composition of any one of claims 139-159, wherein the composition further comprises: (h) a detection system, the detection system comprising: (i) a guide nucleic acid comprising a nucleic acid sequence complementary to the target nucleic acid region or a portion thereof; and (ii) Cas enzymes with incidental cleavage activity; (iii) a nucleic acid reporter probe that is sensitive to the incidental cleavage activity, such that the nucleic acid reporter probe has a first uncleaved state and a second cleaved state that are detectably different.

161. The composition of any one of claim 160, wherein the Cas enzyme is a Cas13 enzyme or a Cas12 enzyme.

162. The composition of any one of claim 161, wherein the Cas13 enzyme is a Cas13a enzyme.

163. The composition of any one of claims 160-162, wherein the nucleic acid reporter probe comprises a fluorophore and a quencher.

164. The composition of any one of claims 139-159, wherein the composition further comprises: (h) a detection system, the detection system comprising: (i) capture probes; and (ii) A conjugate capture probe comprising a detectable label and a 3' blocking entity.

165. The composition of claim 164, wherein the capture probe is a biotinylated capture probe.

166. The composition of any one of claims 164-165, wherein the capture probe is about 10 to about 20 nucleotides.

167. The composition of any one of claims 164-166, wherein the conjugate capture probe is about 10 to about 20 nucleotides.

168. A method for amplifying an RNA target nucleic acid sequence in a sample, comprising: (A) contacting the sample with a composition comprising: (a) a reverse primer, the reverse primer comprising: (i) a 3' sequence complementary to the RNA target nucleic acid; and (ii) a 5'SDA primer binding sequence, wherein the primer binding sequence comprises a restriction enzyme recognition sequence, a portion of a restriction enzyme recognition sequence, or a complement thereof; (b) reverse transcriptase; and (c) a forward primer, the forward primer comprising: (i) a 3' sequence complementary to the RNA target nucleic acid; and (ii) a 5'SDA primer binding sequence, wherein the primer binding sequence comprises a restriction enzyme recognition sequence, a portion of a restriction enzyme recognition sequence, or a complement thereof, thereby producing a first reaction mixture; (B) incubating the first reaction mixture under conditions that favor the production of a single-stranded DNA (ssDNA) cassette; (C) contacting the ssDNA cassette of (B) with a composition comprising: (d) a first SDA primer, the first SDA primer comprising: (i) a sequence complementary to the 5' SDA primer binding sequence of the reverse primer; (ii) a 3' blocking molecule; and (iii) comprising a 5' stabilizing sequence of about 8 to about 20 nucleotides, and when the reverse primer comprises only a partial restriction enzyme recognition sequence, the first SDA primer comprises a partial restriction enzyme recognition sequence that together with the partial restriction enzyme recognition sequence in the 5' SDA primer binding sequence of the reverse primer forms a complete restriction enzyme recognition sequence; (e) a second SDA primer, the second SDA primer comprising: (i) a sequence complementary to the 5' SDA primer binding sequence of the forward primer; (ii) a 3' blocking molecule; and (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides, and when the forward primer comprises only a partial restriction enzyme recognition sequence, the first SDA primer comprises a partial restriction enzyme recognition sequence that together with the partial restriction enzyme recognition sequence in the 5' SDA primer binding sequence of the forward primer forms a complete restriction enzyme recognition sequence; and (f) at least one cleavage enzyme, a polymerase having strand displacement activity, a single-strand binding protein, and dNTPs; and thereby producing a second reaction mixture; (D) incubating the second reaction mixture under conditions that favor the production of multiple copies of a nucleic acid that is identical to or complementary to the ssDNA cassette.

169. The method of claim 168, wherein steps (A) to (D) are performed at ambient temperature.

170. The method of claim 168, wherein steps (A) to (D) are performed without temperature cycling.

171. The method of claim 168, wherein steps (A) to (D) are performed at a temperature of at most 50°C.

172. The method of claim 168, wherein (A) to (D) are performed at a temperature of at most 40°C.

173. The method of any one of claims 168-172, wherein the reverse transcriptase has RNASEh activity.

174. The method of any one of claims 168-173, wherein the reverse transcriptase is selected from the group consisting of MMLV, AMV, Protoscript II, Superscript I and II and II and IV, RTx, GOScript, Sensiscript, Primescript and Maxima.

175. The method of any one of claims 168-174, wherein the composition further comprises a bump primer.

176. The method of any one of claims 168-175, wherein the 3' blocking molecule of the first SDA primer and / or the second SDA primer is selected from the group consisting of 3' ddNTP, 3' reverse dT, 3' carbon chain spacer, 3' hexanediol, 3' amino spacer and 3' phosphorylation.

177. The method of any one of claims 168-176, wherein at least one of the stabilizing sequences is a hairpin stabilizing sequence.

178. The method of any one of claims 168-177, wherein both stabilizing sequences are hairpin stabilizing sequences.

179. The method of any one of claims 168-178, wherein at least one of the stabilizing sequences comprises a T7 promoter sequence.

180. The method of any one of claims 168-179, wherein the DNA polymerase is selected from the group consisting of BsuDNAP, Klenow LF, Klenow Exo- and Isopol, and Bst DNAP.

181. The method of any one of claims 168-180, wherein the single-stranded binding protein is T4gp32.

182. The method of any one of claims 168-181, wherein the concentration of the single-stranded binding protein is at least 200 ng / μl.

183. The method of any one of claims 168-182, wherein the composition further comprises KOAc or PEG.

184. The method of any one of claims 168-183, wherein the restriction enzyme recognition sequence is a nicking enzyme recognition sequence.

185. The method of any one of claims 168-184, wherein the nickase is Nt.CviPII nickase or Nb.BbvCI nickase.

186. The method of any one of claims 168-183, wherein at least one of the dNTPs is a modified dNTP.

187. The method of any one of claims 168-183 and 186, wherein the first SDA primer sequence complementary to the first native restriction enzyme recognition sequence comprises one or more modified nucleotides.

188. The method of any one of claims 168-183 and 186-187, wherein the first SDA primer sequence complementary to the first native restriction enzyme recognition sequence comprises a PTO linkage.

189. The method of any one of claims 168-183 and 186-188, wherein the second SDA primer sequence complementary to the second native restriction enzyme recognition sequence comprises one or more modified nucleotides.

190. The method of any one of claims 168-183 and 186-189, wherein the second SDA primer sequence complementary to the first native restriction enzyme recognition sequence comprises a PTO linkage.

191. The method of claim 176, wherein the 3' carbon chain spacer is a carbon chain that blocks the extension from binding to the 3' OH group.

192. The method of claim 191, wherein the carbon chain spacer can be 3C, 4C, 5C, 6C, 7C, 8C, 9C, 10C, 11C, 12C or longer in length.

193. A method for detecting an RNA target nucleic acid sequence in a sample, wherein the method comprises: (A) contacting at least one copy of a nucleic acid that is identical or complementary to the ssDNA cassette of claims 168-192 with a composition comprising: (i) a guide nucleic acid comprising a nucleic acid sequence complementary to the DNA cassette; and (ii) Cas enzymes with incidental cleavage activity; (iii) a nucleic acid reporter probe that is sensitive to the incidental cleavage activity, such that the nucleic acid reporter probe has a first uncleaved state and a second cleaved state that are detectably different; and (B) detecting the cleavage of the nucleic acid reporter probe by detecting the difference between the first state and the second state to determine the presence of the RNA target nucleic acid sequence in the sample.

194. The method of claim 193, wherein the Cas enzyme is a Cas13 enzyme or a Cas12 enzyme.

195. The method of claim 194, wherein the Cas13 enzyme is a Cas13a enzyme.

196. The method of any one of claims 193-195, wherein the nucleic acid reporter probe comprises a fluorophore and a quencher.

197. A method for detecting an RNA target nucleic acid sequence in a sample, wherein the method comprises: (A) contacting at least one copy of the amplified RNA target nucleic acid sequence according to any one of claims 168 to 192 with a composition comprising: (i) capture probes; and (ii) a conjugate capture probe comprising a detectable label and a 3' blocking entity; (B) detecting the presence of the detectable label bound to the solid substrate to determine the presence of the RNA target nucleic acid sequence in the sample.

198. The method of claim 197, wherein the capture probe is a biotinylated capture probe.

199. The method of any one of claims 197-198, wherein the capture probe is about 10 to about 20 nucleotides.

200. The method of any one of claims 197-199, wherein the conjugate capture probe is about 10 to about 20 nucleotides.

201. The method of any one of claims 197-200, wherein amplification and detection are performed at ambient temperature.

202. The method of any one of claims 197-200, wherein amplification and detection are performed without temperature cycling.

203. The method of any one of claims 197-200, wherein amplification and detection are performed at a maximum of 50°C.

204. The method of any one of claims 197-200, wherein amplification and detection are performed at a maximum of 40°C.

205. A composition comprising: (a) a target polynucleotide; (b) a first probe comprising: a 3'SDA primer binding sequence comprising a portion of a nickase recognition site or its complement, a nucleic acid sequence complementary to the target nucleic acid, and a first nucleic acid sensing component; (c) a second probe comprising: a 5'SDA primer binding sequence comprising a portion of a nickase recognition site or its complement, a nucleic acid sequence complementary to the target nucleic acid, and a second nucleic acid sensor component, wherein each nucleic acid sensing component comprises sequences that serve as, encode or template the encoding of first and second reporter element components, respectively; (d) at least one gap filling oligonucleotide; and (e) ligase, When the first probe and the second probe are ligated together, a single-stranded DNA cassette is generated, encoding at least one reporter and comprising a 3' SDA primer binding sequence and a 5' SDA primer binding sequence, wherein the SDA primer binding sequence comprises a portion of a nickase recognition sequence or its complement.

206. A composition comprising (a) a single-stranded DNA cassette encoding at least one reporter and comprising a 3'SDA primer binding sequence and a 5'SDA primer binding site, wherein the 3'SDA primer binding sequence and the 5'SDA primer binding sequence comprise a partial nickase recognition sequence or its complement; (b) a first SDA primer, the first SDA primer comprising: (i) a sequence complementary to the 3' SDA primer binding sequence; (ii) a 3' blocking molecule; and (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides, said 5' stabilizing sequence comprising a portion of a nickase recognition sequence that together with said portion of the nickase recognition sequence in said 3' SDA primer binding sequence forms a complete nickase primer binding sequence; (c) a second SDA primer, the second SDA primer comprising: (i) a sequence complementary to the 5' SDA primer binding sequence; (ii) a 3' blocking molecule; and (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides, said 5' stabilizing sequence comprising a partial nickase recognition site that together with said partial nickase recognition sequence in said 5' SDA primer binding sequence forms a complete nickase primer binding sequence; and (d) at least one nicking enzyme, a polymerase having strand displacement activity, a single-strand binding protein, and dNTPs.

207. The composition of claim 206, wherein the composition further comprises 2-10% PEG.

208. A composition comprising (a) a single-stranded DNA (ssDNA) cassette encoding at least one reporter and comprising a 3'SDA primer binding sequence and a 5'SDA primer binding sequence, wherein the 3'SDA primer binding sequence and the 5'SDA primer binding sequence comprise a partial nickase recognition sequence or a complement thereof; (b) a first SDA primer, the first SDA primer comprising (i) a sequence complementary to the 3' SDA primer binding sequence; (ii) 3' blocking molecules; and (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides, said 5' stabilizing sequence comprising a partial nickase recognition site that together with said partial nickase recognition sequence in said 3' SDA primer binding sequence forms a complete nickase primer binding sequence; (c) a second SDA primer, the second SDA primer comprising: (i) a sequence complementary to the 5' SDA primer binding sequence; (ii) a 3' blocking molecule; and (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides, said 5' stabilizing sequence comprising a partial nickase recognition site that together with said partial nickase recognition sequence in said 5' SDA primer binding sequence forms a complete nickase primer binding sequence; and (d) a detection system, the detection system comprising: (i) a guide nucleic acid comprising a nucleic acid sequence complementary to the DNA cassette; and (ii) Cas enzymes with incidental cleavage activity; (iii) a nucleic acid reporter probe that is sensitive to the incidental cleavage activity, such that the nucleic acid reporter probe has a first uncleaved state and a second cleaved state that are detectably different; and (e) at least one nicking enzyme, a polymerase having strand displacement activity, a single-strand binding protein, and dNTPs.

209. The composition of claim 208, wherein the stabilizing sequence comprises a T7 promoter sequence.

210. The composition of any one of claims 208-2091, wherein the composition further comprises 2-10% PEG.

211. A method for detecting a target nucleic acid sequence in a sample, comprising: (A) contacting the sample with a composition comprising: (a) a first probe, the first probe comprising: a 3'SDA primer binding sequence comprising a partial nickase recognition sequence or its complement, a nucleic acid sequence complementary to the target nucleic acid, and a first nucleic acid sensing component; (b) a second probe, the second probe comprising: a 5'SDA primer binding sequence comprising a portion of a nickase recognition sequence or its complement, a nucleic acid sequence complementary to the target nucleic acid, and a second nucleic acid sensor component, wherein each nucleic acid sensing component comprises sequences that serve as, encode or template the encoding of first and second reporter element components, respectively; (c) at least one gap filling oligonucleotide; and (d) ligase, wherein, when the first probe and the second probe are ligated together, a single-stranded DNA cassette is generated, the single-stranded DNA cassette encoding at least one reporter and comprising a 3' SDA primer binding sequence and a 5' SDA primer binding sequence, wherein the SDA primer binding sequence comprises a portion of a nickase recognition sequence or its complement, thereby generating a first reaction mixture; (B) incubating the first reaction mixture under conditions favorable for producing a single-stranded DNA (ssDNA) cassette, (C) contacting the ssDNA cassette of (B) with a composition comprising: (i) a first SDA primer, the first SDA primer comprising: a sequence complementary to the 3'SDA primer binding sequence; 3' blocking molecule; and a stabilizing sequence comprising about 8 to about 20 nucleotides, said stabilizing sequence comprising a partial nickase recognition site that together with said partial nickase recognition sequence in said 3' SDA primer binding sequence forms a complete nickase primer binding sequence; (ii) a second SDA primer, the second SDA primer comprising: a sequence complementary to the 5'SDA primer binding sequence; 3' blocking molecule; and a 5' stabilizing sequence comprising about 8 to about 20 nucleotides, said 5' stabilizing sequence comprising a partial nickase recognition site that together with said partial nickase recognition sequence in said 5' SDA primer binding sequence forms a complete nickase primer binding sequence; and (iii) at least one nicking enzyme, a polymerase having strand displacement activity, and a single-stranded binding protein; thereby producing a second reaction mixture; (D) incubating the second reaction mixture under conditions that favor the production of multiple copies of a nucleic acid that is identical to or complementary to the ssDNA cassette; (E) contacting at least one copy of a nucleic acid that is identical or complementary to the ssDNA cassette with a composition comprising a cell-free extract, thereby producing a third reaction mixture; (F) incubating the third reaction mixture under conditions favorable for production of the at least one reporter encoded by the ssDNA cassette; and (G) measuring the expression of the reporter protein produced in step (F) to determine the presence and / or amount of the target nucleic acid sequence in the sample.

212. The method of claim 211, wherein the step of contacting the ssDNA cassette of (C) with a composition comprises 2-10% PEG.

213. A composition comprising: (a) a single-stranded DNA cassette encoding at least one reporter and comprising a 3'SDA primer binding sequence and a 5'SDA primer binding sequence, wherein the 3'SDA primer binding sequence and the 5'SDA primer binding sequence comprise a nickase recognition sequence or a portion of a nickase recognition sequence, or a complement thereof; (b) a first SDA primer, the first SDA primer comprising: (i) a sequence complementary to the 3' SDA primer binding sequence; (ii) a 3' blocking molecule; and (iii) a T7 promoter sequence and / or a stabilizing sequence comprising about 8 to about 20 nucleotides, said stabilizing sequence comprising a partial nickase recognition site that together with said partial nickase recognition site on said 3' SDA primer binding sequence forms a complete nickase primer binding sequence; (c) a second SDA primer, the second SDA primer comprising: (i) a sequence complementary to the 5' SDA primer binding sequence; (ii) a 3' blocking molecule; and (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides, said 5' stabilizing sequence comprising a partial nickase recognition site that together with said partial nickase recognition sequence in said 5' SDA primer binding sequence forms a complete nickase primer binding sequence; and (d) a detection system, the detection system comprising: (i) capture probes; and (ii) a conjugate capture probe comprising a detectable label and a 3' blocking molecule; and (e) at least one nicking enzyme, a polymerase having strand displacement activity, a single-strand binding protein, and dNTPs.

214. The composition of claim 213, wherein the capture probe is a biotinylated capture probe.

215. The composition of any one of claims 213-214, wherein the capture probe is about 10 to about 20 nucleotides.

216. The composition of any one of claims 213-214, wherein the 3' blocking molecule is selected from the group consisting of 3' ddNTP, 3' inverted dT, 3' carbon chain spacer, 3' hexanediol, 3' amino spacer and 3' phosphorylation.

217. The composition of any one of claims 213-214, wherein the composition further comprises 2-10% PEG.

218. The composition of any one of claims 213-214, wherein the capture probe is about 10 to about 20 nucleotides.

219. The composition of any one of claims 213-214, wherein the conjugate capture probe is about 10 to about 20 nucleotides.

220. A method for detecting an RNA target nucleic acid sequence in a sample, comprising: (A) contacting the sample with a composition comprising: A reverse primer, the reverse primer comprising: (i) a 3' sequence complementary to the RNA target nucleic acid; and (ii) a 5' SDA primer binding sequence, wherein the primer binding sequence comprises a nickase recognition sequence, or a portion of a nickase recognition sequence or its complement, Reverse transcriptase, A forward primer, comprising: (i) a 3' sequence complementary to the RNA target polynucleotide: and (ii) a 5' SDA primer binding sequence, wherein the primer binding sequence comprises a nickase recognition sequence or a portion of a nickase recognition sequence, or a complement thereof, thereby producing a first reaction mixture; (B) incubating the first reaction mixture under conditions that favor the production of a single-stranded DNA (ssDNA) cassette; (C) contacting the ssDNA cassette of (B) with a composition comprising: (i) a first SDA primer, the first SDA primer comprising: a sequence complementary to the 5'SDA primer binding sequence; 3' blocking molecule; and a T7 promoter sequence, and / or a stabilizing sequence comprising or consisting of about 8 to about 20 nucleotides, and when the 5' SDA primer binding sequence comprises only a partial nickase recognition site, the stabilizing sequence comprises a partial nickase recognition site that together with the partial nickase recognition site on the SDA primer binding sequence forms a complete nickase primer binding site; (ii) a second SDA primer, the second SDA primer comprising: a sequence complementary to the 3' SDA primer binding sequence of the reverse primer; 3' blocking molecule; and A stabilizing sequence comprising or consisting of at least 8-12 nucleotides, and when the 3'SDA primer binding sequence comprises only a partial nickase recognition site, the stabilizing sequence comprises a partial nickase recognition site that together with the partial nickase recognition site on the 3'SDA primer binding sequence forms a complete nickase primer binding site; and (ii) at least one nicking enzyme, a polymerase having strand displacement activity, and a single-stranded binding protein; thereby producing a second reaction mixture; (D) incubating the second reaction mixture under conditions that favor the production of multiple copies of a nucleic acid that is identical to or complementary to the ssDNA cassette; (E) contacting at least one copy of the nucleic acid that is identical or complementary to the ssDNA cassette with a composition comprising: (i) capture probes; and (ii) a conjugate capture probe comprising a detectable label and a 3' blocking molecule; (f) detecting the presence of the detectable label bound to the solid substrate to determine the presence of the target nucleic acid sequence in the sample.

221. The composition of claim 220, wherein the reverse transcriptase has RNASEh activity.

222. The composition of any one of claims 220-221, wherein the capture probe is a biotinylated capture probe.

223. The composition of any one of claims 220-222, wherein the capture probe is about 10 to about 20 nucleotides.

224. The composition of any one of claims 220-223, wherein the 3' blocking molecule is selected from the group consisting of 3' ddNTP, 3' inverted dT, 3' carbon chain spacer, 3' hexanediol, 3' amino spacer and 3' phosphorylation.

225. The composition of any one of claims 220-224, wherein the composition further comprises 2-10% PEG.

226. The composition of any one of claims 220-225, wherein the capture probe is about 10 to about 20 nucleotides.

227. The composition of any one of claims 220-226, wherein the conjugate capture probe is about 10 to about 20 nucleotides.

228. A method for detecting a target nucleic acid sequence in a sample, comprising: (a) contacting the sample with a composition comprising: (i) a first probe comprising: a 3'SDA primer binding sequence comprising a portion of a nickase recognition site or its complement, a nucleic acid sequence complementary to the target nucleic acid, and a first nucleic acid sensor component; (ii) a second probe comprising: a 5'SDA primer binding sequence comprising a portion of a nickase recognition site or its complement, a nucleic acid sequence complementary to the target nucleic acid, and a second nucleic acid sensor component, wherein each nucleic acid sensing component comprises sequences that serve as, encode or template the encoding of first and second reporter element components, respectively; (iii) at least one gap filling oligonucleotide, wherein; and (iv) ligase, which when ligated together generate a single-stranded nucleotide cassette encoding at least one reporter and comprising a 3' SDA primer binding sequence and a 5' SDA primer binding sequence, wherein the primer binding sequence comprises a nickase recognition sequence or a portion of a nickase recognition sequence, thereby generating a first reaction mixture; (b) incubating the first reaction mixture under conditions favorable for producing a single-stranded nucleotide cassette, (c) contacting the nucleotide cassette of (b) with a composition comprising: (i) a first SDA primer, the first SDA primer comprising: (a) a sequence complementary to the 3' SDA primer binding sequence; (b) a 3' blocking molecule; and (c) a stabilizing sequence comprising about 8 to about 20 nucleotides and comprising a partial nickase recognition site that together with the partial nickase recognition site on the 3' SDA primer binding sequence forms a complete nickase primer binding site; (c) a second SDA primer, the second SDA primer comprising: (i) a sequence complementary to the 5' SDA primer binding sequence; (ii) a 3' blocking molecule; and (iii) a 5' stabilizing sequence comprising about 8 to about 20 nucleotides, said 5' stabilizing sequence comprising a partial nickase recognition site that together with said partial nickase recognition sequence in said 5' SDA primer binding sequence forms a complete nickase primer binding sequence; and (ii) at least one nicking enzyme, a polymerase having strand displacement activity, and a single-stranded binding protein; thereby producing a second reaction mixture; (d) incubating the second reaction mixture under conditions that favor the production of multiple copies of a nucleic acid identical to or complementary to the nucleotide cassette; (e) contacting at least one copy of a nucleic acid identical or complementary to the nucleotide cassette with a composition comprising: (i) a guide nucleic acid comprising a nucleic acid sequence complementary to the nucleotide box; and (ii) Cas enzymes with incidental cleavage activity; (iii) a nucleic acid reporter probe that is sensitive to the incidental cleavage activity, such that the nucleic acid reporter probe has a first uncleaved state and a second cleaved state that are detectably different; (f) detecting the cleavage of the nucleic acid reporter probe by detecting the difference between the first state and the second state to determine the presence of the target nucleic acid sequence in the sample.

229. The method of claim 228, wherein the nucleotide cassette is a ssDNA cassette.

230. The method of any one of claims 228-229, wherein the step of contacting the nucleotide cassette of (b) with a composition is further performed in the presence of 2-10% PEG.

Images