Application of hydroxymethyl glutaryl-CoA synthase 2 gene in treatment of ejection fraction retention type heart failure

Abstract

The invention discloses application of a hydroxymethyl glutaryl coenzyme A synthase 2 gene in treatment of ejection fraction retention type heart failure, and belongs to the technical field of gene engineering. Animal experiment and cell experiment research finds that the myocardial cell specific overexpression HMGCS2 improves HFpEF pathological characteristics such as cardiac dysfunction, active oxygen generation, glucose and lipid metabolism disorder and the like of HFpEF model mice, while the knock-down HMGCS2 produces an opposite effect, which indicates that the myocardial cell specific overexpression HMGCS2 has the effect of relieving or treating HFpEF, and the myocardial cell specific overexpression HMGCS2 has the effect of relieving or treating HFpEF. A new treatment strategy is provided for treatment of the HFpEF, and a theoretical basis is provided for taking the HMGCS2 gene or protein as a potential biomarker for diagnosis of the HFpEF.

Description

Technical Field

[0001] The present invention relates to the technical field of gene engineering, and in particular to application of hydroxymethylglutaryl coenzyme A synthase 2 gene in treating heart failure with preserved ejection fraction. Background Art

[0002] Heart failure with preserved ejection fraction (HFpEF) is a heterogeneous metabolic syndrome characterized by a left ventricular ejection fraction ≥50%. Although the exact cause is still uncertain, studies have found that HFpEF is associated with obesity, metabolic dysfunction, and physical insufficiency. Currently, only sodium-glucose cotransporter-2 inhibitors (SGLT2i) and glucagon-like peptide-1 receptor agonists are effective for HFpEF. This is mainly due to the lack of understanding of the pathogenesis of HFpEF. The basic pathological changes of HFpEF include left ventricular diastolic dysfunction, inflammation, and cardiac remodeling. Excessive fibrosis and myocardial hypertrophy caused by metabolic reprogramming and oxidative stress are the main causes of cardiac remodeling. Therefore, elucidating the mechanisms behind metabolic reprogramming and oxidative stress can provide a basis for the treatment of HFpEF.

[0003] Hydroxymethylglutaryl-CoA synthase 2 (HMGCS2) is a member of the HMG-CoA synthase protein family, located in mitochondria, and is the rate-limiting enzyme for ketone body production in adult liver. It provides energy to extrahepatic tissues under various physiological and pathological conditions, including starvation, post-exercise, diabetes, and obesity. Recent studies have shown that HMGCS2 in cardiomyocytes can significantly promote cardiac maturation and repair by promoting ketone body production. However, there are no reports on the regulatory or therapeutic effects of the HMGCS2 gene on HFpEF, nor on its regulatory effects on metabolic reprogramming in HFpEF. Summary of the invention

[0004] The purpose of the present invention is to provide an application of the hydroxymethylglutaryl-CoA synthase 2 gene in the treatment of heart failure with preserved ejection fraction, so as to solve the problems existing in the above-mentioned prior art. The present invention has found through animal experiments and cell experiments that myocardial cell-specific overexpression of the HMGCS2 gene improves HFpEF pathological characteristics such as cardiac dysfunction, reactive oxygen production, glucose and lipid metabolism disorders in HFpEF model mice, while myocardial cell-specific knockdown of the HMGCS2 gene has the opposite effect, indicating that myocardial cell-specific overexpression of the HMGCS2 gene has the effect of alleviating or treating HFpEF, providing a new treatment strategy for the treatment of HFpEF, and providing a theoretical basis for the HMGCS2 gene or protein as a potential biomarker for the diagnosis of HFpEF.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides use of a reagent for overexpressing the HMGCS2 gene in preparing a drug for treating HFpEF.

[0007] Optionally, the reagent for overexpressing the HMGCS2 gene includes a plasmid and an adeno-associated virus having the function of overexpressing the HMGCS2 gene.

[0008] Furthermore, the drug for treating HFpEF achieves the effect of treating HFpEF by participating in metabolic reprogramming.

[0009] Furthermore, the drug for treating HFpEF has the effects of alleviating cardiac dysfunction, alleviating oxidative stress damage to cardiac tissue, and regulating glucose and lipid metabolism disorders.

[0010] Furthermore, the cardiac dysfunction is diastolic dysfunction.

[0011] Furthermore, reducing oxidative stress damage to cardiac tissue includes reducing the content of reactive oxygen species in cardiac tissue.

[0012] Furthermore, the regulation of glucose and lipid metabolism disorders includes reducing glucose tolerance and inhibiting lipid accumulation in myocardial cells.

[0013] The present invention discloses the following technical effects:

[0014] The present invention discovered that the HMGCS2 gene is a key gene in HFpEF through transcriptome sequencing, and verified the regulatory effect of the HMGCS2 gene on HFpEF through animal experiments and cell experiments: in a HFpEF mouse model given a high-fat diet and Nω-nitro-L-arginine methyl ester (L-NAME) in drinking water, overexpression of HMGCS2 improved the HFpEF disease phenotypes such as cardiac dysfunction, reactive oxygen production, and glucose and lipid metabolism disorders in mice, while knocking down HMGCS2 produced the opposite effect, indicating that overexpression of the HMGCS2 gene has the effect of alleviating or treating HFpEF. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0016] Figure 1 It is a schematic diagram of the map of the pAV-cTNT-P2A-GFP recombinant vector;

[0017] Figure 2 It is a schematic diagram of the pAV-cTNT-GFP-miR30-shRNA recombinant vector;

[0018] Figure 3 Figure 2 is the screening result of key genes in HFpEF; A is a visualized heat map of gene expression changes in mice; B is a Venn diagram of differentially expressed genes between cardiomyocytes of HFD+L-treated mice and control mice (red) or between db / db mice and BLKs mice (blue); C is the KEGG analysis result of differentially expressed genes in B; D is a differential protein interaction network diagram; E is a visualization heat map of gene expression changes in HFpEF mice at different time points (0, 5, 10, 17, 20, 22 and 27 weeks). A shows the expression of HMGCS2 protein in AC16 cardiomyocytes (n=7 in each group); F shows the expression of HMGCS2 protein in AC16 cardiomyocytes after PA+L treatment for different time periods (0, 6, 12, 24, 48 and 72 hours) (n=4 in each group); G shows the staining results of HMGCS2, cTNI, CD31 and vimentin in cardiomyocytes of HFpEF mice (scale bar: 50 μm); In E and F, data are expressed as mean ± SD, and one-way ANOVA was performed followed by Tukey's multiple comparisons;

[0019] Figure 4 The results of the effect of overexpression of HMGCS2 gene in cardiomyocytes on HFpEF mice; A is the H&E staining, Sirius Red staining, and WGA staining of heart tissue sections of mice in each group (n=6 in each group, scale bar is 50μm); B is a representative image of the heart of mice in each group (scale bar is 2mm); C is the calculation result of heart weight / tibia length (HW / TL) of mice in each group (n=6 in each group); D is the body weight of mice in each group (n=6 in each group); E is the early peak / atrial peak (E / A) of mice in each group; F is E / E' of mice in each group; G is the heart rate of mice in each group; H is the ejection fraction of mice in each group; I is the ratio of wet lung weight to dry lung weight (LW) of mice in each group (n=6 in each group); J is the results of oral glucose tolerance test of mice in each group; in A, CJ, data are expressed as mean ± standard deviation, and one-way ANOVA was followed by Tukey's multiple comparisons;

[0020] Figure 5The results of the effects of knockdown of HMGCS2 gene in cardiomyocytes on HFpEF mice; A is the H&E staining, Sirius Red staining, and WGA staining of heart tissue sections of mice in each group (n=6 in each group, scale bar is 50 μm); B is a representative image of the heart of mice in each group (scale bar is 2 mm); C is the calculation result of heart weight / tibia length (HW / TL) of mice in each group (n=6 in each group); D is the body weight of mice in each group (n=6 in each group); E is the early peak / atrial peak (E / A) of mice in each group; F is E / E' of mice in each group; G is the heart rate of mice in each group; H is the ejection fraction of mice in each group; I is the ratio of wet lung weight to dry lung weight (LW) of mice in each group (n=6 in each group); J is the results of oral glucose tolerance test of mice in each group; in A, CJ, data are expressed as mean ± standard deviation, and one-way ANOVA was followed by Tukey's multiple comparisons;

[0021] Figure 6 Figure 2 shows the effects of HMGCS2 gene in cardiomyocytes on lipid metabolism and myocardial remodeling in HFpEF; A shows the lipid accumulation in cardiac tissue after HMGCS2 was overexpressed in cardiomyocytes of each group of mice using Oil Red O staining (n=6 in each group, scale bar is 50 μm); B shows the lipid accumulation in cardiac tissue after HMGCS2 was inhibited in cardiomyocytes of each group of mice using Oil Red O staining (n=6 in each group, scale bar is 50 μm); C shows the lipid droplets in NRVMs of each group using BODIPY staining (n=6 in each group, scale bar is 50 μm); D is the expression of CD36 protein in NRVMs of each group (n=4 in each group); E is the effect of HMGCS2 overexpression in cardiomyocytes on the content of reactive oxygen species in mouse heart tissue; F is the effect of HMGCS2 inhibition in cardiomyocytes on the content of reactive oxygen species in mouse heart tissue; G is the effect of HMGCS2 overexpression on the content of reactive oxygen species in NRVMs; H is the observation of myocardial cell structural remodeling by rhodamine phalloidin staining (scale bar, 50 μm); in AE, data are expressed as mean ± SD, and one-way ANOVA was performed followed by Tukey's multiple comparisons. DETAILED DESCRIPTION

[0022] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0023] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0024] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0025] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0026] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0027] Example 1

[0028] 1. Reagent preparation:

[0029] AAV9-oxHMG, AAV9-shHMG, AAV9-shNC and AAV9-oxNC were prepared according to the following steps:

[0030] The target gene was amplified using the 5' primer: CGCAAATGGGCGGTAGGCGTG (SEQ ID NO.1) and the 3' primer: TCGCCGGACACGCTGAACT (SEQ ID NO.2), and the target gene was inserted into the pAV-cTNT-P2A-GFP vector to obtain the pAV-cTNT-P2A-GFP recombinant vector (see vector map for details). Figure 1) was used to prepare AAV9-oxHMG virus. The sequence: CCTCTACAAATGTGGTATGGC (SEQ ID NO.3) was inserted into the pAV-cTNT-P2A-GFP vector to obtain the pAV-cTNT-GFP-miR30-shRNA recombinant vector (see vector map for details). Figure 2 ) was used to prepare AAV9-shHMG virus. The nonsense sequence: AAGGCAGAAGTATGCAAAGCATTAGTGAAGCCACAGATGTAATGCTTTGCATACTTCTG CCTG (SEQID NO.4) was inserted into the pAV-cTNT-GFP-mir30-shRNA vector to construct a recombinant vector for preparing AAV9-shNC virus as a negative control. AAV9-oxNC virus was prepared with the pAV-cTNT-GFP vector as another negative control.

[0031] When the HEK293T cells reach a concentration of more than 90%, plate them at a ratio of 1:3 (approximately 2.5×10 cells per plate). 6 cells), and the culture medium was Hyclone high-glucose DMEM medium (containing 10% FBS). About 1-2h before transfection, change to serum-free medium. Transfect the above recombinant vectors into the cells respectively. Collect the virus 72h after transfection, collect the virus-producing cells together with the culture medium into a 50mL centrifuge tube, centrifuge, and harvest the culture supernatant and cell precipitate respectively: use PEG8000 to precipitate the virus in the culture supernatant; lyse the cell precipitate to collect the virus; combine the AAV obtained from the cell precipitate and supernatant. Subsequently, the virus is purified and concentrated, and the virus titer is tested for standby use. The above process was carried out by Weizhen Biotech Co., Ltd.

[0032] 2. Experimental methods

[0033] 2.1 Animal experiments

[0034] By knocking down or overexpressing the HMGCS2 gene in healthy animals or HFpEF model animals, the effect of the HMGCS2 gene on HFpEF disease was explored. The specific experimental process is as follows:

[0035] Adult male C57BL / 6J mice aged 8 weeks were selected. The mice were kept in an environment with room temperature (22±2)℃ and 40-50% humidity, with a 12-hour day-night cycle from 6 am to 6 pm. At 8 weeks of age, the mice were randomly assigned to normal feed (control group) or 60% HFD+L-NAME water (HFD+L group, HFpEF animal model group) and fed freely for 10 weeks. Among them, the 60% HFD+L-NAME water feeding method was: 60% high-fat diet (HFD, Medicience) and Nω-nitro-L-arginine methyl ester (L-NAME; 0.5 g / L, Sigma-Aldrich, 51298-62-5) was added to the drinking water.

[0036] The animals were randomly divided into (1) control group (no treatment, n = 30), (2) HFD+L (HFpEF model induced by high-fat diet combined with L-NAME drinking water, n = 30), (3) HFD+L+AAV9-oxNC (HFpEF model mice were injected with 150 μL of virus containing empty AAV9 viral genome via tail vein, n = 10, as a control for overexpression of HMGCS2), (4) HFD+L+AAV9-oxHMG (HFpEF model mice were injected with 150 μL of virus containing 5×10 11 AAV9 viral genome, n = 10), (5) HFD + L + AAV9-shNC (HFpEF model mice were injected with 150 μL of virus containing empty AAV9 viral genome via tail vein, n = 10, as a control for knocking down HMGCS2), (6) HFD + L + AAV9-shHMG (HFpEF model mice were injected with 150 μL of virus containing 5 × 10 11 AAV9 viral genome, n=10); each group of mice was treated with virus injection and then continued to be raised for 5 weeks.

[0037] 2.2 Cell experiments

[0038] By knocking down or overexpressing the HMGCS2 gene in cardiomyocytes, the role of the HMGCS2 gene in vitro was explored. The specific experimental process is as follows:

[0039] 2.2.1 Culture and treatment of cardiomyocytes

[0040] Human AC16 cardiomyocytes (ATCC, CRL-3568) were cultured in DMEM (Gibco, 11965092) containing 10% FBS (Biological Industries, 04-001-1ACS), 100 U / mL penicillin and 100 μg / mL streptomycin (Gibco, 15070063). Then, the cells were treated with L-NAME (100 μM, Sigma-Aldrich, 51298-62-5) and palmitic acid (PA; 0.2 mM, Sigma-Aldrich, P5585) for 24 hours to obtain PA+L cells.

[0041] When the cell density in the six-well plate reached 80%-90%, Hieff Trans Liposomal Transfection Reagent (Yeasen, 40802ES03) was used for transfection. Mixture 1 was composed of 4 μL siRNA and 100 μL serum-free medium, while mixture 2 was composed of 2.5 μL Hieff Trans Liposomal Transfection Reagent and 100 μL serum-free medium. The two mixtures were then mixed on ice for 5 minutes. Subsequently, after incubation on ice for 15 minutes, the culture medium in the six-well plate was removed and replaced with 1800 μL serum-free medium containing 200 μL mixed solution. The above siRNA is a specific human HMGCS2-siRNA with the sequence: positive chain: 5'-CCUGAGGAGUUCACAGAAATT-3' (SEQID NO.5), antisense chain: 5'-UUUCUGUGAACUCCUCAGGTT-3' (SEQ ID NO.6). When the cell density in the six-well plate reached 80%-90%, plasmid transfection was performed using HieffTrans Liposomal Transfection Reagent. 2 μg of plasmid DNA was mixed with 4 μL HieffTrans Liposomal Transfection Reagent and 200 μL serum-free medium, incubated at room temperature for 15 minutes, and then added to the six-well plate.

[0042] 2.2.2 Isolation and culture of neonatal rat ventricular myocytes (NRVMs)

[0043] NRVMs were obtained from the ventricles of 2-3 day old Sprague-Dawley rats. The ventricular tissue was minced and digested with collagenase II (Biosharp, BS164). Digestion was repeated for seven rounds. Subsequently, after centrifugation at 4°C, the supernatant was pre-cultured in a culture flask for 2 hours to remove non-cardiomyocytes. When the cells grew to a concentration of 80%-90%, the plasmid transfection operation of 2.2.1 was performed.

[0044] 3. Detection method

[0045] 3.1 Echocardiographic evaluation

[0046] The mice were anesthetized with isoflurane (1.5-3.0%), and the ejection fraction of the mice was measured using Vevo 3100 ultrasound, while the heart rate, E / E' and E / A were recorded simultaneously.

[0047] 3.2 Oral glucose tolerance test

[0048] The mice were fasted for 12 hours before the test. Then 2 g / kg of D-glucose was given to the mice by gavage. Blood glucose levels were measured at different time intervals (0, 30, 60, 90 and 120 minutes). The glucose tolerance of the animals was assessed by determining the area under the blood glucose curve (AUCs).

[0049] 3.3 Organ weight

[0050] Hearts and lungs of mice in all groups were collected, blood was flushed in 1× phosphate buffered saline (PBS; Pricella, PB180327), wiped dry and weighed. Heart weight (HW) and tibia length (TL) and the ratio of dry lung weight to wet lung weight were recorded.

[0051] 3.4 Immunofluorescence

[0052] Myocardial tissue sections were dewaxed and hydrated, antigens were repaired, and incubated with goat serum (ZSGB-BIO, ZLI-9056) at room temperature for 30 minutes, followed by incubation with primary antibodies (diluted 1:100) at 4°C overnight. Subsequently, the samples were incubated with Alexa Fluor Plus-488 (Invitrogen, A32731) or Alexa Fluor-594 (Invitrogen, A-11005) secondary antibodies for 2 hours at room temperature. After washing with PBS, the sections were stained with DAPI for 5 minutes. The sections were sealed and photographed under a microscope.

[0053] AC16 cardiomyocytes or NRVMs samples treated with PA and L-NAME were washed three times with cold PBS and fixed with 4% paraformaldehyde for 15 minutes. They were then blocked with goat serum for 30 minutes and incubated with primary antibodies (1:100 dilution) at 4°C overnight. After three washes with cold PBS, cell samples were incubated with secondary antibodies conjugated with Alexa fluor plus-488 or Alexa fluor-594 for 2 hours at room temperature. Finally, nuclear staining with DAPI was performed for 5 minutes. The slides were sealed and photographed under a microscope.

[0054] 3.5 Sirius Red staining

[0055] Heart tissue sections were dewaxed and hydrated, and stained with a Picro staining kit (Abcam, ab150681) at room temperature for 60 minutes. After washing with acetic acid twice and ethanol three times, the sections were sealed and photographed under a microscope.

[0056] 3.6 Hematoxylin-eosin staining (H&E)

[0057] Heart tissue sections were stained with H&E (Solarbio, G1120). The sections were stained with hematoxylin for 8 minutes and eosin for 1 minute, then washed in 0.5% hydrochloric acid alcohol, dehydrated and sealed. Photographs were taken under a microscope.

[0058] 3.7 Oil Red O staining

[0059] The heart tissue sections were first washed with clean water and distilled water, followed by a quick rinse with 60% isopropanol for 30 seconds. They were then stained with Oil Red O working solution (Solarbio, G1261) for 20 minutes, followed by a quick rinse with 60% isopropanol for 3 seconds and distilled water for 1 minute. The nuclei were stained with hematoxylin for 1 minute, and the tissues were then rinsed twice with distilled water for 5 minutes each. The sections were finally sealed and photographed under a microscope.

[0060] 3.8 Reactive oxygen species detection, BODIPY staining and wheat germ agglutinin (WGA) detection

[0061] Heart tissue sections were dewaxed and hydrated, and antigens were retrieved by boiling twice in antigen retrieval solution (Bioshary, BL619A), stained with dihydroethidium (DHE; Invitrogen, C10422) or wheat germ agglutinin (WGA; AAT Bioquest, 25530), incubated at 37°C for 30 min, and washed three times with PBS.

[0062] AC16 cardiomyocytes or NRVMs samples treated with PA and L-NAME were washed three times with cold PBS, diluted with DHE 10 μM, BODIPY493 / 503 (MedChemExpress, 216434-81-0) working solution, added dropwise to the cells, incubated at 37°C for 30 minutes, and washed three times with PBS. The slides were mounted and photographed under a microscope.

[0063] 3.9 Rhodamine-phalloidin staining

[0064] AC16 cardiomyocytes or NRVMs samples treated with PA and L-NAME were washed three times with cold PBS, fixed with 4% paraformaldehyde for 15 minutes, then treated with 0.1% Triton X-100 and washed three times with cold PBS, followed by incubation with rhodamine-labeled phalloidin working solution (diluted 1:100) at room temperature for 2 hours. After washing three times with cold PBS, the nuclei were stained with DAPI (Beyotime, C1002) for 5 minutes. The slides were mounted and photographed under a microscope.

[0065] 3.10 Western blotting

[0066] Cells or heart tissues were lysed on ice with RIPA buffer (Yeasen, 20101ES60) containing PMSF (Biosharp, BL1426A) for 30 minutes, and after centrifugation (12,000g, 4°C, 15 minutes), the supernatant was separated by SDS-polyacrylamide gel electrophoresis and transferred to Immobilon-FL PVDF membrane (Merck, IPFL00010). The membrane was blocked with skim milk (BioFroxx, 1172GR100) at room temperature for 2 hours and incubated with primary antibodies at 4°C overnight. After washing with TBST solution (composed of TBS buffer (Bioshary, BL602a) and Tween-20 (Bioshary, 9005-84-5), the membrane was incubated with secondary antibody goat anti-rabbit IgG (1:1,000, Beyotime, A0208) or goat anti-mouse IgG (1:1,000, Beyotime, A0216) for 2 h at room temperature. ECL developer (Bioshary, BL520A) was added, and the signal was detected using the ChemiDoc XRS+ imaging system (Bio-red, USA).

[0067] 4. Test results

[0068] 4.1 Screening of key genes in HFpEF

[0069] In order to screen the key genes in HFpEF, RNA sequencing (RNAseq) was performed on the hearts of HFpEF model mice induced by high-fat combined with L-NAME drinking water (HFD+L), db / db mice and BLKs mice (purchased from Alpha Biotech Co., Ltd.), and it was found that HMGCS2 is a key gene in HFpEF ( Figure 3 In the heart tissues of HFpEF mice, HMGCS2 protein levels were significantly increased at the 20-week time point and then decreased ( Figure 3 E). Similarly, in cardiomyocytes, HMGCS2 expression increased significantly after PA+L-NAME treatment, reaching a peak at 24 hours and then decreasing ( Figure 3 In addition, immunofluorescence analysis showed that HMGCS2 colocalized with the cardiac marker CTNI ( Figure 3 G). The above data indicate that HMGCS2 is transiently and highly expressed in cardiomyocytes in HFpEF.

[0070] 4.2 Evaluation of the effects of cardiomyocyte-specific overexpression of HMGCS2 in HFpEF mice

[0071] A specific cardiomyocyte adeno-associated virus vector 9 (AAV9-oxHMG) was constructed to overexpress the HMGCS2 gene to study the function of the HMGCS2 gene in vivo. AAV9-oxHMG reversed the myocardial hypertrophy, myocardial fibrosis, weight gain, and increased heart weight (HW) / tibia length (TL) ratio induced by HFD+L-NAME ( Figure 4 AD); improved cardiac dysfunction without affecting left ventricular ejection fraction or heart rate ( Figure 4 In addition, AAV9-oxHMGCS2 administration significantly improved pulmonary congestion and glucose tolerance compared with the model group ( Figure 4 The above data indicate that overexpression of HMGCS2 improves HFpEF disease.

[0072] 4.3 Evaluation of the effects of cardiomyocyte-specific knockdown of HMGCS2 in HFpEF mice

[0073] To further elucidate the function of HMGCS2, AAV9 of HGMCS2 (AAV9-shHMG) was constructed to knock down the HMGCS2 gene in cardiomyocytes of HFpEF mice. Morphological analysis showed that AAV9-shHMG significantly aggravated myocardial hypertrophy and fibrosis, cardiac function, and increased body weight and heart weight / tibia length ratio (HW / TL) ( Figure 5 AD), exacerbated cardiac dysfunction, but had no effect on left ventricular ejection fraction or heart rate (Figure 5EH). In addition, compared with the model group, AAV9-shHMG significantly increased pulmonary congestion and glucose tolerance ( Figure 5 These data suggest that knockdown of HMGCS2 gene exacerbates HFpEF.

[0074] 4.4 Evaluation of the effects of HMGCS2 in cardiomyocytes on lipid metabolism and cardiac hypertrophy in HFpEF

[0075] Since metabolic reprogramming and oxidative stress are the main pathological processes in HFpEF, we then explored the effects of HMGCS2 on lipid metabolism, reactive oxygen species, and structural remodeling. In vivo, AAV9-oxHMG inhibited lipid accumulation in cardiac tissue of HFpEF model ( Figure 6 A) and reactive oxygen species generation ( Figure 6 E), while AAV9-shHMG exacerbated these effects ( Figure 6 In vitro, overexpression of HMGCS2 inhibited fatty acid uptake in PA+L-NAME treated cardiomyocytes, whereas inhibition of HMGCS2 exacerbated this effect. Figure 6 In addition, the reduction of CD36 expression confirmed the role of HMGCS2 in lipid metabolism ( Figure 6 D). To investigate whether HMGCS2 reduces the generation of reactive oxygen species in vitro, dihydroethidium staining was performed, and the results showed that overexpression of HMGCS2 reduced the level of reactive oxygen species, whereas knockdown of HMGCS2 promoted the generation of reactive oxygen species ( Figure 6 G). Rhodamine phalloidin staining was then performed to assess the structural remodeling of cardiomyocytes, e.g. Figure 6 As shown in Figure 3, overexpression of HMGCS2 inhibited cardiomyocyte hypertrophy, while knockdown of HMGCS2 significantly aggravated cardiomyocyte hypertrophy.

[0076] 5. Conclusion:

[0077] The present invention has found through the above studies that HMGCS2 improves HFpEF by regulating metabolic reprogramming induced by high-fat diet / PA+L-NAME. The results of animal and cell experiments showed that AAV9-oxHMG inhibited the disease progression of HFpEF, improved cardiac dysfunction, reactive oxygen production, and glucose and lipid metabolism disorders, while AAV9-shHMG produced the opposite effect. These findings established the biological function of HMGCS2 as a key gene in HFpEF, provided a new therapeutic strategy for the treatment of HFpEF, and supported HMGCS2 as a potential new diagnostic biomarker.

[0078] In summary, HMGCS2 may become a new approach to treat HFpEF by regulating metabolic reprogramming.

[0079] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. Use of an agent that overexpresses the HMGCS2 gene in the preparation of a drug for the treatment of HFpEF.

2. The use according to claim 1, characterized in that: The reagent for overexpressing the HMGCS2 gene includes a plasmid and an adeno-associated virus having the function of overexpressing the HMGCS2 gene.

3. The use according to claim 1, characterized in that: The drug for treating HFpEF achieves the effect of treating HFpEF by participating in metabolic reprogramming.

4. The use according to claim 1, characterized in that: The drug for treating HFpEF has the effects of alleviating cardiac dysfunction, alleviating oxidative stress damage of cardiac tissue and regulating glucose and lipid metabolism disorder.

5. The use according to claim 4, characterized in that: The cardiac dysfunction is diastolic dysfunction.

6. The use according to claim 4, characterized in that: The reducing of oxidative stress damage to cardiac tissue includes reducing the content of reactive oxygen species in cardiac tissue.

7. The use according to claim 4, characterized in that: The regulation of glucose and lipid metabolism disorders includes reducing glucose tolerance and inhibiting lipid accumulation in myocardial cells.

Images