Phyllostachys edulis pedarf23 gene and application thereof in regulating plant lignin synthesis

Abstract

The application discloses application of a moso bamboo PedARF23 gene in regulation of plant lignin synthesis and plant root development and belongs to the technical field of genetic engineering. The PedARF23 gene encodes an amino acid sequence as shown in SEQ ID NO. 2. The present application can improve the lignin content, the length of a main root, the number of lateral roots and the length of lateral roots by improving the expression of PedARF23, which indicates that the gene can be applied in cultivation of high-lignin and / or developed-root plant varieties.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the PedARF23 gene sequence of moso bamboo and its application in regulating plant lignin synthesis and plant root development. Background Technology

[0002] Root systems are a vital component of plants, playing an irreplaceable role not only in absorbing water and mineral nutrients but also in anchoring the plant, supporting the above-ground parts, and interacting with soil microorganisms. A well-developed root system allows for more efficient water extraction from deeper soil layers, reducing irrigation needs, especially in arid regions or under seasonal water shortages, thus helping to alleviate water scarcity. A well-distributed root system expands the absorption area for nutrients such as nitrogen, phosphorus, and potassium, reducing the risk of fertilizer runoff and improving fertilizer utilization, thereby reducing environmental pollution and saving costs. Strong root systems make plants more resistant to the effects of dry environments, sustaining life by digging deep underground to find water, ensuring the survival rate of crops under adverse climatic conditions. A stable root system provides better support for the plant, preventing lodging caused by wind and rain, ensuring normal crop growth and final harvest. Active root growth increases soil porosity, improves aeration, promotes the reproduction of beneficial microorganisms, and fosters a healthy soil ecosystem. Root residues decompose and are converted into organic matter, which helps improve soil fertility in the long term and also plays a positive role in mitigating global warming as a carbon sink. Therefore, optimizing root structure and function is crucial for improving crop yield and quality, enhancing stress resistance and adaptability. In modern agricultural production, facing challenges such as climate change and land degradation, cultivating crop varieties with strong root systems has become one of the key strategies for achieving sustainable development goals.

[0003] With the development of molecular biology techniques and gene-editing tools, scientists have been able to understand to some extent how specific genes regulate root development. Lignin is an important component of plant cell walls, especially in secondary walls. It gives root cell walls extra strength and rigidity, enabling roots to effectively penetrate the soil and provide physical support for the plant. This is crucial for the stable growth of the taproot and lateral roots. Similar research findings not only deepen our understanding of plant root growth mechanisms but also provide theoretical basis and technical support for the development of new crop varieties. Lignin participates in the construction of the vascular bundle system, particularly the xylem vessels. These structures are responsible for transporting water and dissolved minerals from the roots to the aboveground parts. Healthy lignin synthesis is essential for ensuring efficient water absorption and transport. However, different plants have vastly different genetic backgrounds. Further exploration of new genes that regulate root development using auxin content, and the development of new methods to optimize crop root structure by regulating the expression of key genes, remains vital for promoting green agriculture and meeting society's growing demand for efficient and environmentally friendly agricultural products. Summary of the Invention

[0004] To address the aforementioned technical problems, this invention provides a PedARF23 gene from moso bamboo (Phyllostachys edulis) and its application in regulating plant root development and cultivating varieties with high nitrogen utilization rates.

[0005] This invention cloned the PedARF23 gene from moso bamboo and constructed and compared PedARF23 overexpression lines with wild-type lines in terms of root length, number of lateral roots, lateral root length, auxin, and lignin accumulation. The results showed that the overexpression lines were superior in all of the above indicators. The PedARF23 gene encodes a nucleotide sequence with the amino acid sequence shown in SEQ ID NO.2. This gene holds promise for application in plant genetic engineering breeding, providing a theoretical basis for increasing lignin content in plant roots and creating new germplasm with robust root systems. Considering codon degeneracy, modifications to the bases of the above nucleotide sequence without altering the amino acid sequence also fall within the scope of this invention.

[0006] On the one hand, the present invention provides a protein that regulates plant root development, characterized in that the sequence of the protein is shown in SEQ ID NO.2.

[0007] Furthermore, a gene regulating plant root development is characterized in that the gene encodes an amino acid sequence as shown in SEQ ID NO. 2.

[0008] Preferably, the gene sequence comprises a nucleotide sequence as shown in SEQ ID NO.1, or a nucleotide sequence that is completely inversely complementary to the sequence shown in SEQ ID NO.1.

[0009] On the other hand, the present invention provides an application of the aforementioned protein or gene in regulating plant root development.

[0010] Furthermore, the regulation of plant root development is achieved by overexpressing the protein of claim 1 or the gene of claim 2 to increase plant root length and / or the number and / or length of lateral roots, or by reducing the expression of the protein of claim 1 or the gene of claim 2 to decrease plant root length and / or the number and / or length of lateral roots.

[0011] Furthermore, the plant is a member of the Brassicaceae or Poaceae family.

[0012] Furthermore, the plant is a plant of the genus *Mucor* or *Phyllostachys*.

[0013] Furthermore, the plant is Arabidopsis thaliana or bamboo.

[0014] On the other hand, the present invention provides an application of the aforementioned protein or gene in regulating the lignin content in plant roots.

[0015] Furthermore, the regulation of plant lignin content is achieved by overexpressing the protein of claim 1 or the gene of claim 2 to increase plant lignin content, or by reducing the expression of the protein of claim 1 or the gene of claim 2 to decrease plant lignin content.

[0016] Furthermore, the plant is a member of the Brassicaceae or Poaceae family.

[0017] Furthermore, the plant is a plant of the genus *Mucor* or *Phyllostachys*.

[0018] Furthermore, the plant is Arabidopsis thaliana or bamboo.

[0019] On the other hand, the present invention provides an application of the aforementioned protein or gene in regulating the content of auxin in plant roots.

[0020] Furthermore, the regulation of auxin content in plant roots is achieved by overexpressing the protein of claim 1 or the gene of claim 2 to increase the auxin content in plant roots, or by reducing the expression of the protein of claim 1 or the gene of claim 2 to decrease the auxin content in plant roots.

[0021] Furthermore, the plant is a member of the Brassicaceae or Poaceae family.

[0022] Furthermore, the plant is a plant of the genus *Mucor* or *Phyllostachys*.

[0023] Furthermore, the plant is Arabidopsis thaliana or bamboo.

[0024] On the other hand, the present invention provides the application of the aforementioned protein or the aforementioned gene in the cultivation of plant varieties with high lignin content.

[0025] Furthermore, the cultivation of plant varieties with high lignin content is achieved by overexpressing the aforementioned proteins or genes to obtain plant varieties with high lignin content.

[0026] Furthermore, the plant is a member of the Brassicaceae or Poaceae family.

[0027] Furthermore, the plant is a plant of the genus *Mucor* or *Phyllostachys*.

[0028] Furthermore, the plant is Arabidopsis thaliana or bamboo.

[0029] On the other hand, the present invention provides an application of the aforementioned protein or gene in the cultivation of plant varieties with well-developed root systems.

[0030] Furthermore, the cultivation of plant varieties with well-developed root systems is achieved by overexpressing the aforementioned proteins or genes to obtain plant varieties with well-developed root systems.

[0031] Furthermore, the indicators of well-developed root system are the increase in plant root length and / or the number and / or length of lateral roots.

[0032] Compared with the prior art, the present invention has the following advantages:

[0033] 1) This invention provides a new protein and its encoding gene, which has the function of regulating plant root length, number of lateral roots, lateral root length, lignin content and auxin content.

[0034] 2) This invention provides a novel method for regulating plant root length, lateral root number, lateral root length, lignin content and auxin content, namely, by increasing the expression of the PedARF23 gene or its encoded protein to increase plant root length, lateral root number, lateral root length, lignin content and auxin content.

[0035] 3) This invention provides a new method for cultivating plant varieties with well-developed root systems, namely, by increasing the expression of the PedARF23 gene or its encoded protein to cultivate plant varieties with well-developed root systems.

[0036] 4) The above methods can effectively improve the efficiency of crop resource utilization and enhance the crop's resistance to adverse conditions. Attached Figure Description

[0037] The beneficial effects of the present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0038] Figure 1 The figure shows the taproot length control between PedARF23-overexpressing Arabidopsis thaliana and wild-type Arabidopsis thaliana.

[0039] Figure 2 The image shows the growth and development control of lateral roots in Arabidopsis thaliana overexpressing PedARF23 and wild-type Arabidopsis thaliana; where A represents the number of lateral roots, B represents the length of lateral roots, and C represents the density of lateral roots.

[0040] Figure 3 The image shows GUS staining of roots from PedARF23-overexpressing Arabidopsis thaliana and wild-type Arabidopsis thaliana.

[0041] Figure 4 The figure shows the root GUS activity of PedARF23 overexpression in Arabidopsis thaliana and wild-type Arabidopsis thaliana.

[0042] Figure 5 The figure shows the auxin content in PedARF23-overexpressing Arabidopsis thaliana and wild-type Arabidopsis thaliana.

[0043] Figure 6 The figure shows the lignin content of PedARF23-overexpressing Arabidopsis thaliana and wild-type Arabidopsis thaliana.

[0044] Figure 7 The figure shows the expression levels of PedARF23 in wild-type and transgenic Arabidopsis thaliana. Detailed Implementation

[0045] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0046] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0047] The nucleotide sequence of the PedARF23 gene from moso bamboo in this embodiment is shown in SEQ ID NO.1:

[0048]

[0049] The amino acid sequence of Moso bamboo PedARF23 protein is shown in SEQ ID NO.2:

[0050] MTGIDLNTVEEDEEEAEEVATNCSHHSQASSAATGTPPRPSAVCLELWHACAGPVAPLPRKGSVVVYLPQGHLEHLGSAAAGGVSGAPSAAAASAVPPHVFCRVVDVTLHADAATDEVYAQLSLVAENEEVARRLREGTDDGSAGDAEDGDTVKQRFARMPHMFCKTLTASDTSTHGGFSVPRRAAEDCFPPLDYSQQRPSQELVAKDLHGTEWRFRHIYRGQPRRHLLTTGWSAFVNKKKLVSGDAVLFLRGDDGELRLGVRRAAQLKNGSAFPALYKQCANLGTLANVAHAVATKSMFHIYYNPRLSQSEFIVPYWKFMKSLSQPFSVGLRFKMRYESEDAAERRYTGIITGSGDADPMWRGSKWKCLLVRWDDDGEFRRPNRVSPWEIELTSSVSASHLSTPNSKRLKPCLPHVNPEYMVPHGGGRSDFAESALFHKVLQGQELLGFKTHDGAAVATSQPCEARNLQYIDERSCSNDASNSILGVPRLGVRSPLGNPGLSYHCSGFGESQRFQKVLQGQEVFRPYRRTLVDACMRNSGFHQQDGPRAPGMANKWNTQLHGCAFRGLPSPVLPCQSSSPPSVLMFQQANSKISQFEFGHGHLDKNKDDRRARFGPAEGIGRTEQTLPLRPHLVSGEEIDGHAAVEKLHQPVRLGKDGPDNKNVSTNSCKIFGISLTEKVPAREEIDCGDANYPSPFQSLKQQVPKSLGNSCATVHEQRPVVGRVIDVSTMDMMI

[0051] Examples

[0052] Example 1 Construction of an overexpression vector of Moso bamboo PedARF23 gene

[0053] Based on the unigene sequence obtained from previous sequencing in our laboratory, a pair of specific primers, PedARF23-F (ATGACGGGGATCGACCTCAACACC) and PedARF23-R (TCAGATCATCATATCCATTGTTGAA), were designed. RNA was extracted from moso bamboo and reverse transcribed into cDNA. The moso bamboo was grown in a greenhouse at Nanjing Forestry University. The PCR amplification system consisted of 20 μL: 10 μL PrimeSTAR Max Premix enzyme (TaKaRa, Dalian, China), 7 μL ddH2O, 1 μL template cDNA, and 1 μL each of forward and reverse primers. The RT-PCR reaction program was as follows: 98 °C pre-denaturation for 3 min; 35 cycles: 98 °C denaturation for 10 s, 54 °C annealing for 30 s, 72 °C extension for 60 s; and 72 °C extension for 5 min. PCR products were recovered using a DNA recovery kit, ligated into the pMD19-T vector, transformed into *E. coli* DH5α competent cells, and single colonies were picked for PCR detection. Finally, plasmids were extracted and sequenced (GenScript, Nanjing, China). Based on the vector sequence and the PedARF23 gene sequence, specific recombination primers PedARF23-F (GGGGACAAGTTTGTACAAAAAAGCAGGCTCGATGACGGGGATCGACCTCAACACC) and PedARF23-R (GGGGACCACTTTGTACAAGAAAGCTGGGTCGATCATCATATCCATTGTTGAA) were designed to amplify the PedARF23 gene. Subsequently, using the Gateway cloning system (Invitrogen), the overexpression vector pB2GW7-PeARF23 was generated through BP and LR recombination reactions.

[0054] Example 2: Obtaining and identifying TdNRX1.1 transgenic Arabidopsis thaliana

[0055] The recombinant plasmid was sent to Nanjing GenScript Biotech Co., Ltd. (Nanjing, China) for sequencing. The recombinant plasmid pB2GW7-PeARF23, which had been verified by sequencing, was introduced into *Agrobacterium tumefaciens* strain GV3101 using electroporation, and *Arabidopsis thaliana* was genetically transformed using the flower-dip method (Zhang et al., 2006). Transgenic positive seedlings were screened using 1 / 2 MS medium containing hygromycin (35 mg / L), followed by PCR amplification using specific primers (PedGADPH-qF: CAAGGCTGTTGGCAAGGTTC; PedGADPH-qR: CATATGAGGCAGACTTCTCGATTC; PedARF23-qF: AGGAAAGGATGGACCAGATAACAAA; PedARF23-qR: TCAATCACCCTGCCAACAACA). The expression level of PedARF23 in the positive transgenic lines was detected by RT-qPCR. RT-qPCR experiments were performed on a Bio-Rad IQ5 real-time PCR platform using the SYBR PreMix Ex Taq kit (TaKaRa, Dalian, China). The amplification system consisted of 10 μL SYBR PreMix Ex Taq, 7.2 μL dd H2O, 2 μL cDNA, and 0.4 μL each of forward and reverse primers. The RT-qPCR reaction conditions were: 95 °C for 30 s, 95 °C for 10 s, and 60 °C for 20 s, for 40 cycles. Melting curve analysis was performed in the range of 65 °C–95 °C, with increments of 0.5 °C every 5 s to verify amplification specificity. CsTBP was used as an internal control gene (Wu et al., 2016). Nine biological replicates were performed for each sample, based on 2... -ΔΔCT The method involved calculating relative gene expression levels (Pfaffl, 2001). Three different transgenic lines (OE-1 to OE-3) were selected for subsequent experiments. Figure 7 ).

[0056] Subsequently, the obtained Pro35S:PeARF23 line was crossed with the DR5::GUS reporter line, and the resulting Pro35S:PeARF23::DR5::GUS line was selected for further analysis.

[0057] Example 3: Phenotypic Analysis of Arabidopsis thaliana Overexpression with TdNRX1.1

[0058] GUS staining:

[0059] Seeds of DR5::GUS and Pro35S:PeARF23::DR5::GUS germinated for 6 days on medium containing 10 μM NPA, and then grew for 7 days on normal medium. Seedlings were immersed in a GUS staining solution containing 50 mM sodium phosphate (pH 7.0), 10 mM EDTA (pH 8.0), 2 mM potassium ferric chloride, 2 mM potassium ferrous chloride, 0.1% (v / v) Triton X-100, and 2 mM X-Gluc. After 5 minutes of vacuum permeation, the samples were incubated at 37°C for 12 hours. After staining, the solution was discarded, and the seedlings were washed sequentially with 70%, 80%, and 90% ethanol until all chlorophyll was removed. Samples were stored in 90% ethanol at 4°C. Staining results were observed and photographed using a Nikon E100 microscope.

[0060] GUS activity assay:

[0061] For GUS activity assays, 100 mg of root tissue was collected from each sample and ground in GUS extraction buffer (50 mM potassium phosphate buffer, pH 7.0, 2 mM EDTA, 0.1% Triton X-100). The extract was centrifuged at 18,000 g for 20 min at 4°C, and the supernatant was retained for further analysis. Fluorescence measurements were performed in a 96-well plate using 455 μM 4-methylumbelliferone-β-D-glucuronide hydrate (Sigma-Aldrich) at 22°C using a Fluoroskan Ascent FL fluorometer (excitation wavelength 365 nm, emission wavelength 455 nm). Fluorescence was measured after 30 min of reaction, and a standard curve was fitted. Enzyme activity was calibrated using a 4-methylumbelliferone concentration gradient.

[0062] Auxin content determination:

[0063] Approximately 0.2 g of frozen root sample was dissolved in 2 mL of extraction solvent (propanol, water, and concentrated hydrochloric acid; 2:1:0.002, v / v / v). The mixture was shaken at 150 rpm for 20 min at 4°C and then incubated in the dark at 4°C for 10 h. After incubation, 4 mL of dichloromethane was added to each sample, and the mixture was shaken again at 150 rpm for 20 min. The samples were then centrifuged at 12,000 g for 15 min to obtain two phases. The lower phase (1.8 mL) was transferred to a vacuum concentrator (Eppendorf, Concentrator plus, Germany) and concentrated for 2 h at 1,800 g, 10 Pa, and 4°C. After nearly drying, the residue was dissolved in 0.8 mL of 50% methanol and centrifuged again. The supernatant was filtered through a 0.22 μm organic membrane for analysis. Auxin content was analyzed using ultra-high performance liquid chromatography-tandem mass spectrometry (ACQUITY UPLC Xevo TQD, Waters) with a C18 column (2.1 mm × 100 mm, 1.7 μm; Waters) in positive electrospray ionization (ESI+) mode. The column temperature was set to 45°C and the collision energy to 15 V.

[0064] Quantitative analysis of lignin content:

[0065] Approximately 0.2 g of sample was placed in a mortar, with three replicates per sample. The sample was homogenized with 1 ml of 95% ethanol, transferred to a 1.5 ml centrifuge tube, and centrifuged at 4500 rpm for 5 minutes. The supernatant was discarded, and the precipitate was washed with 95% ethanol, vortexed, and then centrifuged again. This washing step was repeated three times. The precipitate was then washed twice with an ethanol-hexane mixture, discarding the supernatant each time. The collected precipitate was dried overnight in a 50°C oven. 2 ml of 25% acetic acid-hydrogen bromide solution was added to the dried precipitate and mixed thoroughly until completely dissolved. The mixture was incubated in a 70°C water bath for 30 minutes. Immediately after incubation, a quenching solution (containing 900 μl NaOH solution, 2 ml glacial acetic acid, and 100 μl 7.5 mM hydroxylamine hydrochloride) was added to the centrifuge tube, and the volume was adjusted to 5 ml with glacial acetic acid. The mixture was centrifuged at 4500 rpm for 5 minutes at room temperature, and the supernatant was transferred to a new centrifuge tube. The absorbance was measured at 280 nm using a preheated spectrophotometer. The relative lignin content was calculated using wild type (WT) and control as reference standards (set as 1).

[0066] Phenotypic analysis showed that the pro35S:PedARF23 transgenic line promoted taproot elongation ( Figure 1 ) and lateral root growth ( Figure 2 The length and number of lateral roots both increased significantly. GUS staining showed that PedARF23 was distributed throughout the root system, with the highest content at the root tip. Figure 3GUS activity assays showed that the GUS activity in pro35S:PedARF23 DR5::GUS was higher than that in DR5::GUS ( Figure 4 Auxin () Figure 5 ) and lignin ( Figure 6 The results of the content determination showed that the levels of auxin and lignin at the root tip of the pro35S:PedARF23 transgenic line were significantly higher than those of the wild-type (WT) line.

[0067] Based on the disclosure and teachings of the foregoing specification, those skilled in the art can make appropriate changes and modifications to the above embodiments. Therefore, the present invention is not limited to the specific embodiments disclosed and described above, and some modifications and changes to the present invention should also fall within the protection scope of the claims of the present invention. Furthermore, although some specific terms are used in this specification, these terms are only for convenience of explanation and do not constitute any limitation on the present invention.

Claims

1. A protein that regulates plant root development, characterized in that, The amino acid sequence of the protein is shown in SEQ ID NO.

2.

2. A gene regulating plant root development, characterized in that, The gene encodes the amino acid sequence shown in SEQ ID NO.

2.

3. The application of the protein of claim 1 or the gene of claim 2 in regulating plant root development, characterized in that, The regulation of plant root development is achieved by overexpressing the protein of claim 1 or the gene of claim 2 to increase the length of the taproot and / or the number of lateral roots; the plant is Arabidopsis thaliana or moso bamboo.

4. The application of the protein of claim 1 or the gene of claim 2 in regulating plant lignin content, characterized in that, The regulation of plant lignin content is achieved by overexpressing the protein of claim 1 or the gene of claim 2 to increase plant lignin content; the plant is Arabidopsis thaliana or bamboo.

5. The application of the protein of claim 1 or the gene of claim 2 in regulating plant auxin content, characterized in that, The regulation of plant auxin content is achieved by overexpressing the protein of claim 1 or the gene of claim 2 to increase plant auxin content; the plant is Arabidopsis thaliana or bamboo.

6. The application of the protein of claim 1 or the gene of claim 2 in the cultivation of plant varieties with high lignin content, characterized in that, The plant variety with high lignin content is obtained by overexpressing the protein or the gene; the plant is Arabidopsis thaliana or moso bamboo.

7. The application of the protein of claim 1 or the gene of claim 2 in the cultivation of plant varieties with well-developed root systems, characterized in that, The plant variety with well-developed root system is obtained by overexpressing the protein or the gene; the plant is Arabidopsis thaliana or moso bamboo.

Images