Kluyveromyces marxianus engineering strain for synthesizing inositol by synchronously saccharifying and fermenting starch and application of kluyveromyces marxianus engineering strain

Abstract

The invention belongs to the technical field of bioengineering, and particularly relates to kluyveromyces marxianus engineering bacteria for synthesizing inositol by synchronously saccharifying and fermenting starch and application of the kluyveromyces marxianus engineering bacteria. According to the kluyveromyces marxianus engineering bacterium, a glucose-6-phosphate isomerase PGI gene, a glucose-6-phosphate dehydrogenase ZWF1 gene, an inositol oxygenase MIOX5 gene and an inositol transporter protein ITR2 gene of a kluyveromyces marxianus FIM1 delta ura3 strain are sequentially knocked out, and the kluyveromyces marxianus engineering bacterium is obtained. And transferring into a carrier pUKDN115-Ptef-TbIPS-Ttef-Pgp-EcIMP-Tgp-Pinu-alpha BadGLA-Tinu, wherein the carrier is used for simultaneously expressing a trypanosoma buchneri inositol phosphate synthase TbIPS gene, an escherichia coli inositol monophosphate enzyme EcIMP gene and a saccharifying enzyme BadGLA of adenine yeast, so as to obtain the trypanosoma buchneri inositol phosphate synthase TbIPS-Ttef-Pgp-EcIMP-Tgp-Pinu-alpha BadGLA-Tinu. The Kluyveromyces marxianus engineering strain is used as a fermentation strain, starch is used as a raw material, the inositol is produced through simultaneous saccharification and fermentation, and the yield of the inositol in supernatant can reach 45.5 g / L.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and in particular relates to an engineering bacterium of Kluyveromyces marxianus for synthesizing inositol and an application thereof. Background Art

[0002] Inositol is a sugar-like cyclic alcohol, often called vitamin B8, widely distributed in plants, animals and microorganisms. There are nine isomers in the inositol structure, namely myo-inositol, muco-inositol, neo-inositol, scyllo-inositol, l-chiro-inositol, d-chiro-inositol, epi-inositol and allo-inositol, and the last allo-inositol isomer does not exist in nature. Inositol and its derivatives have aroused great interest due to their important physiological functions and have potential application prospects in medicine, food, feed and other industrial fields. In addition to being a structural component of lipids, inositol is essential for cell growth and is involved in glucose metabolism and insulin signaling pathways (López-Gambero et al., Biomedicines. 2020, 20; 8(9): 295). In mammals, inositol is an essential nutrient synthesized from glucose in the brain, kidneys, and liver, but a deficiency of inositol may lead to severe metabolic and mood disorders, such as slow growth, insulin resistance, lipid changes, and hormone imbalance. Dietary inositol has been found to inhibit dual external glucose absorption, promote hepatic glycogen synthesis, and reduce glycemic index through competitive affinity for sodium-coupled transporters (SMIT1 and SMIT2) and insulin-mimetic effects (Schneider et al., FEBS Lett., 2015, 589, 10: 1049-1058).

[0003] Myo-inositol (cis-1,2,3,5-trans-4,6-cyclohexanedohexanol) is the most abundant of the nine inositol isomers and is mainly found in cereals and legumes. In nature, inositol branches out from the central glycolytic metabolite glucose-6-phosphate (Glc6P), requiring two enzymes, NAD+-dependent inositol-3-phosphate synthase (IPase) and inositol monophosphatase (IMPase), to cyclize glucose-6-phosphate to inositol-3-phosphate (Ins3P) and dephosphorylate Ins3P to free inositol (Michell et al.,. Nat Rev Mol Cell Biol 9, 2008, 151-161). Currently, large-scale production of inositol mainly relies on chemical acid hydrolysis of phytate at low pH, high temperature and high pressure, which has high energy consumption costs and produces phosphorus-rich wastewater that seriously pollutes the environment. Bio-based inositol synthesis has attracted more attention because it can be achieved by in vitro enzyme catalysis or in vivo microbial conversion of cheap raw materials. However, the direct distribution of carbon flux to inositol synthesis is a huge challenge for inositol biosynthesis in metabolic microorganisms. In order to promote the production of inositol, it is necessary to delete the glucose 6-phosphate isomerase encoding gene PGI and the glucose-6-phosphate dehydrogenase encoding gene ZWF in Escherichia coli, which can block glucose metabolism through glycolysis and the pentose phosphate pathway (PPP) (You et al., Microb Cell Fact. 2020, 24; 19: 109).

[0004] Existing inositol biosynthesis technology is basically based on glucose as raw material, and the production cost is relatively high. Starch is a more economical biosynthetic raw material, widely distributed in cereals, roots and tubers (Majzoobi et al., Food Hydrocolloid, 2021, 111: 106393). In industrial food processing operations, starch granules may undergo an irreversible transformation when heated in the presence of water, called gelatinization (Xie et al., Int J Food Eng, 2007, 25), and starch gelatinization involves the diffusion of water through the granules, the absorption of water by the amorphous region, the swelling of starch granules, the loss of birefringence, the reduction of the crystalline region, the rupture of starch granules, the leaching of amylose, the dissolution of starch and the increase in viscosity (Hoover et al., Carbohydrate Polymers, 2001, 45: 253-267). Starch is usually hydrolyzed into reducing sugars using enzymes such as amyloglucosidase, Taka amylase, β-amylase-pullulanase and β-amylase-isoamylase (Yan et al., Carbohydrate Polymers, 2024, 340: 122273). The structure of starch changes after gelatinization, which changes its utilization and enzymatic hydrolysis ability, and then enzymatic hydrolysis into monosaccharides can be absorbed and utilized by microorganisms.

[0005] The present invention constructs an engineered strain of Kluyveromyces marxianus that can produce inositol by simultaneous saccharification and fermentation. The strain can produce inositol by fermentation of liquefied starch or directly by fermentation of soluble starch. Compared with the prior art, the present invention not only has high production efficiency, but also has simpler process and lower cost. Summary of the invention

[0006] The purpose of the present invention is to provide a metabolic engineering strain of Kluyveromyces marxianus for synthesizing inositol by simultaneous saccharification and fermentation of starch with high efficiency and low cost and application thereof.

[0007] The metabolic engineering strain of Kluyveromyces marxianus for simultaneously saccharifying and fermenting starch to synthesize inositol provided by the present invention is constructed by the following steps:

[0008] (1) Using Crispr gene editing technology, four genes related to sugar metabolism and inositol metabolism and transport, including the glucose-6-phosphate isomerase PGI gene (Genbank accession number: QGN13438.1), glucose-6-phosphate dehydrogenase ZWF1 gene (Genbank accession number: QGN16990.1), inositol oxygenase MIOX5 gene (Genbank accession number: QGN14246.1) and inositol transporter ITR2 gene (Genbank accession number: QGN17849.1), were knocked out in the genome of Kluyveromyces marxianus FIM1Δura3 strain to construct a Kluyveromyces marxianus strain named FIM1Δura3ΔpgiΔzwf1Δmiox5Δitr2;

[0009] (2) Using TEF promoter Ptef and TEF terminator Ttef, the expression cassette of Trypanosoma brucei inositol phosphate synthase TbIPS gene was constructed; using GAP promoter Pgap and GAP terminator Tgap, the expression cassette of Escherichia coli inositol monophosphatase EcIMP gene was constructed; using inulinase promoter Pinu and inulinase terminator Tinu, the expression cassette of adenine yeast Blastobotrys adeninivorans saccharifying enzyme BadGLA gene expression cassette, and the TbIPS gene expression cassette, EcIMP gene expression cassette and BadGLA gene expression cassette were inserted into a Kluyveromyces marxianus expression vector pUKDN132 in sequence to construct a co-expression plasmid of inositol phosphate synthase TbIPS, inositol monophosphatase EcIMP and saccharifying enzyme BadGLA, which was recorded as pUKDN132-Ptef-TbIPS-Ttef-Pgap-EcIMP-Tgap-Pinu-αBadGLA-Tinu.

[0010] (3) The constructed expression plasmid pUKDN132-Ptef-TbIPS-Ttef-Pgap-EcIMP-Tgap-Pinu-αBadGLA-Tinu was transformed into the Kluyveromyces marxianus strain FIM1Δura3ΔpgiΔzwf1Δmiox5Δitr2 described in step (1); and the following were obtained by screening:

[0011] The engineered Kluyveromyces marxianus strain was recorded as FIM1Δura3ΔpgiΔzwf1Δmiox5Δitr2 / pUKDN132-Ptef-TbIPS-Ttef-Pgap-EcIMP-Tgap-Pinu-αBadGLA-Tinu and named as Kluyveromyces marxianus JC-5.

[0012] The Kluyveromyces marxianus FIM1Δura3 strain is obtained by knocking out the uracil synthase gene URA3 on the genome of the Kluyveromyces marxianus FIM1 strain (accession number: CGMCC No. 10621) deposited in the China General Microbiological Culture Collection Center.

[0013] The Kluyveromyces marxianus expression vector pUKDN132 described in step (2) contains a Kluyveromyces marxianus autonomous replication sequence, an inulinase promoter, an α-factor signal peptide, an inulinase terminator and a selection marker gene URA3 element (patent application number 201810153537.X).

[0014] In the Kluyveromyces marxianus strain FIM1Δura3, the glucose-6-phosphate isomerase PGI gene was knocked out, the purpose of which was to block the isomerization of glucose-6-phosphate to fructose-6-phosphate in the cell and block its entry into the EMP pathway (Embden-Meyerhof-Parnas pathway).

[0015] In the Kluyveromyces marxianus strain FIM1Δura3, the glucose-6-phosphate dehydrogenase ZWF1 gene was knocked out, the purpose of which was to block the oxidation of glucose-6-phosphate to 6-phosphogluconate in the cell and block its entry into the pentose phosphate pathway.

[0016] Furthermore, the inositol oxygenase MIOX5 gene was knocked out in the Kluyveromyces marxianus FIM1Δura3ΔpgiΔzwf1 strain in order to prevent the generated inositol from being oxidatively degraded.

[0017] In the Kluyveromyces marxianus FIM1Δura3ΔpgiΔzwf1 strain, the inositol transporter ITR2 gene was knocked out to block the transport of inositol into the cell for metabolic utilization.

[0018] In order to allow Kluyveromyces marxianus cells to ferment and utilize amylopectin to synthesize inositol, the present invention provides a method for co-expressing inositol phosphate synthase TbIPS, inositol monophosphatase EcIMP and saccharifying enzyme BadGLA, comprising: constructing a TbIPS gene expression frame, an EcIMP gene expression frame and a BadGLA expression frame in series on a pUKDN132 vector, and then introducing them into Kluyveromyces marxianus.

[0019] The nucleotide sequence of the inositol phosphate synthase TbIPS is shown in SEQ ID No.1, and the amino acid sequence is shown in SEQ ID No.2.

[0020] The nucleotide sequence of the inositol monophosphatase EcIMP is shown in SEQ ID No.3, and the amino acid sequence is shown in SEQ ID No.4.

[0021] The saccharifying enzyme BadGLA has a nucleotide sequence as shown in SEQ ID No.5 and an amino acid sequence as shown in SEQ ID No.6.

[0022] The present invention also provides a method for synthesizing inositol by efficiently fermenting liquefied starch using the above-mentioned Kluyveromyces marxianus metabolic engineering strain JC-5, specifically, the Kluyveromyces marxianus metabolic engineering strain is used as a fermentation strain, liquefied starch, glycerol, yeast extract, peptone and other components are used as a culture medium, and inositol is produced through culture and fermentation.

[0023] The specific operation of starch liquefaction is as follows: weigh 15-25g of starch, add 60-80mL of appropriate amount of water, and gelatinize in a boiling water bath for 10-15min while stirring. Add 20-40mL of 100mM sodium citrate-citric acid buffer with pH=6.2-6.4, add 0.1%-0.2% of anhydrous calcium chloride, add 20-30U / g of high temperature resistant α-amylase, stir evenly, and liquefy at 80-85℃ for 25-30min to obtain liquefied starch.

[0024] The specific operation of fermenting liquefied starch to synthesize inositol is as follows: inoculate Kluyveromyces marxianus JC-5 into 50-150mL YPD medium containing 2%-3% glycerol and 2%-4% liquefied starch, culture at 30°C and 220rpm for 144-168h, and add 1-2mL 50% glycerol when the culture reaches 96h, and add 4-6mL 30% liquefied starch when the culture reaches 120h, ferment for 144h-168h, and obtain high-yield inositol: 22.2g / L-25.5g / L.

[0025] Specifically, after 144 hours of fermentation, the inositol production reached 22.2 g / L, and after 168 hours of fermentation, the inositol production was 25.5 g / L.

[0026] A preferred method is to transfer Kluyveromyces marxianus JC-5 in YPD medium containing 2%-3% glycerol at an inoculation rate of 5%-10% to a fermenter containing YP medium containing 2%-4% glycerol and 4%-6% liquefied starch, feed glycerol as a carbon source, and perform continuous fed-batch fermentation. Under the conditions of continuous fed-batch fermentation, the strain is fermented at a high density for 144-168 hours to obtain a high yield of inositol: 32.45g / L-45.55g / L.

[0027] Specifically, the strain produced 32.45 g / L of inositol after 144 h of high-density fermentation, and 45.55 g / L of inositol after 168 h of high-density fermentation. The conversion rate of starch to inositol was 91.1%.

[0028] In a more preferred embodiment, the metabolically engineered strain JC-5 of Kluyveromyces marxianus provided by the present invention can use soluble starch as a raw material, and starch liquefaction is not required. The Kluyveromyces marxianus JC-5 is inoculated into 50-150 mL of YPD medium containing 2%-3% glycerol for culture, and then transferred to a fermenter containing YP medium containing 2-4% glycerol and 4%-6% soluble starch at an inoculum amount of 5-10%. Glycerol is fed as a carbon source for continuous fed-batch fermentation. Under the conditions of continuous fed-batch fermentation, fermentation is performed for 144h-168h to obtain high-yield inositol: 26.67g / L-32.19g / L.

[0029] Specifically, after 144 hours of fermentation, the inositol production reached 26.67 g / L, and after 168 hours of fermentation, the inositol production was 32.19 g / L.

[0030] The Kluyveromyces marxianus engineered strain provided by the present invention can efficiently utilize liquefied starch to synthesize inositol, has broad application prospects, can realize large-scale fermentation production of inositol, has significant advantages in yield, and has good application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 The secretory expression of 5 different saccharifying enzymes in Kluyveromyces marxianus. Lanes 1-10 in Figure a are: Marker, AflGLA, BadGLA, RdeGLA, PoxGLA, ApuGLA, Top1BHΔUΔatg (empty bacteria control), positive control Liquozyme SUPRA, positive control 2pHera, and lanes 1-10 in Figure b are: Top1BHΔUΔatg (empty bacteria control), Marker, BthGLA, CspGLA, SapGLA, SfiGLA, ScoGLA, positive control Liquozyme SUPRA, positive control 2pHera.

[0032] Figure 2 Component analysis of starch hydrolyzed by five saccharifying enzymes secreted and expressed by Kluyveromyces marxianus.

[0033] Figure 3 A technical roadmap for metabolic modification of engineered bacteria for synthesizing inositol by fermenting starch with Kluyveromyces marxianus.

[0034] Figure 4 This is the plasmid map for recombinant co-expression of saccharifying enzyme BadGLA, inositol synthase TbIPS and EcIMP.

[0035] Figure 5 Growth curve (a) and inositol production curve (b) of the constructed Kluyveromyces marxianus engineered strain JC-5 for synthesizing inositol in shake flask fermentation in 2% (liquefied starch and soluble starch) and 2% glycerol YPD.

[0036] Figure 6 The bacterial growth (a) and inositol production (b) of the constructed Kluyveromyces marxianus engineered strain JC-5 for synthesizing inositol in a continuous fed-batch fermentation tank. DETAILED DESCRIPTION

[0037] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention.

[0038] Example 1: Recombinant secretory expression of 10 saccharifying enzymes from different sources by Kluyveromyces marxianus

[0039] Since Kluyveromyces marxianus cannot produce starch hydrolases by itself, in order to synthesize inositol using starch as raw material, it is necessary to secrete and express saccharifying enzymes in the strain to hydrolyze starch and release glucose that can be used by Kluyveromyces marxianus. To this end, the present invention screened 10 saccharifying enzyme genes from different sources from Genbank, namely AflGLA (Genbank accession number: EED46010.1), BadGLA (Genbank accession number: CAA86997.1), RdeGLA (Genbank accession number: EIE81396.1), PoxGLA (Genbank accession number: EPS30575.1), ApuGLA (Genbank accession number: ADN65120.1), BthGLA (Genbank accession number: AAC44671.1), CspGLA (Genbank accession number: BAA02251.1), SapGLA (Genbank accession number: KEZ43430.1), SfiGLA (Genbank accession number: AAA83997.1), ScoGLA (Genbank accession number: EFI95688.1). These genes were fully synthesized after codon optimization. The synthesized saccharifying enzyme gene was inserted between the Sma I and Not I sites of the expression vector pUKDN132 to obtain expression plasmids pUKDN132-AflGLA, pUKDN132-BadGLA, pUKDN132-RdeGLA, pUKDN132-PoxGLA, pUKDN132-ApuGLA, pUKDN132-BthGLA, pUKDN132-CspGLA, pUKDN132-SapGLA, pUKDN132-SflGLA, and pUKDN132-ScoGLA. Then, the above 10 expression plasmids were transformed into Kluyveromyces marxianus TopBHΔUra3, respectively. The recombinant expression strains TopBHΔUra3 / PUKDN132-AflGLA, TopBHΔUra3 / PUKDN132-BadGLA, TopBHΔUra3 / PUKDN132-RdeGLA, TopBHΔUra3 / PUKDN132-PoxGLA, TopBHΔUra3 / PUKDN132-ApuGLA, TopBHΔUra3 / PUKDN132-BthGLA, TopBHΔUra3 / PUKDN132-CspGLA, TopBHΔUra3 / PUKDN132-SapGLA, TopBHΔUra3 / PUKDN132-SflGLA, and TopBHΔUra3 / PUKDN132-ScoGLA were obtained.The above 10 strains were inoculated into 50 mL of YD medium (2% yeast extract, 4% glucose) and cultured at 30°C, 220 rpm for 72 h, and the expression of saccharifying enzymes in the culture supernatant was detected by SDS-PAGE. The results are as follows. Figure 1 As shown, it was shown that the secretion expression levels of five saccharifying enzymes in Kluyveromyces marxianus were relatively high, namely BadGLA, PoxGLA, CspGLA, SapGLA and SfiGLA.

[0040] Example 2: Starch hydrolysis ability of saccharifying enzymes from different sources expressed by Kluyveromyces marxianus

[0041] The strains of the five saccharifying enzymes BadGLA, PoxGLA, CspGLA, SapGLA, and SfiGLA that can be expressed in Kluyveromyces marxianus were inoculated into 50 mL of YD medium (2% yeast extract, 4% glucose) and cultured at 30°C, 220 rpm for 72 hours. A 5% soluble starch solution was prepared with 0.1 M sodium acetate buffer (pH = 5.5), 50 μL of fermentation supernatant was taken, and 250 μL was added to react at 37°C for 20 minutes. Afterwards, the reaction was terminated in a boiling water bath for 10 minutes, and its ability to hydrolyze starch was detected by high performance liquid chromatography. The results are as follows: Figure 2 As shown in the figure, under the same reaction conditions and time, BadGLA can release the most glucose and has the best starch hydrolysis performance.

[0042] The specific conditions of HPLC detection are as follows: the analytical column is ZORBAX NH2 (Agilent 250×4.6mm, 5μm), the column temperature is 30°C, the mobile phase is 80% acetonitrile solution, the flow rate is 1mL / min, the detection time is 20min, the detector is a differential refractive index detector, and the detector temperature is 35°C.

[0043] Example 3: Construction of Kluyveromyces marxianus FIM1Δura3ΔpgiΔzwf1Δmiox5Δitr2 strain

[0044] (1) Construction of Kluyveromyces marxianus FIM1Δura3Δpgi strain

[0045] In the synthesis process of inositol, glucose-6-phosphate generates inositol phosphate under the catalysis of inositol phosphate synthase IPS, and then inositol monophosphatase IMP catalyzes phosphate hydrolysis to generate inositol. In order to improve the synthesis efficiency of inositol in Kluyveromyces marxianus, it is necessary to block the downstream metabolism of glucose-6-phosphate in the glycolysis pathway of Kluyveromyces marxianus and guide the glucose metabolic flow into the inositol synthesis pathway. Glucose-6-phosphate isomerase (PGI) is a key enzyme in glycolysis that converts glucose-6-phosphate into fructose-6-phosphate. Therefore, the present invention uses CRISPR Cas9 gene editing technology to knock out the glucose-6-phosphate isomerase gene PGI of Kluyveromyces marxianus FIM1Δura3 strain. And synthesize gRNA primers PGIg-F (tcatggcaactgagttgtccgca) and PGIg-R (aactgcggacaactcagttgcca), and gRNA targets the 35-55bp position of the PGI cds region. The gRNA plasmid and donor sequence required for knocking out the PGI gene were constructed, where the Donor sequence consisted of 500 bp upstream and downstream of the PGI gene cds region, totaling 1000 bp. The gRNA plasmid and donor sequence were simultaneously transformed into the FIM1Δura3 strain, and clones with successful knockout of the PGI gene were obtained through uracil-deficient plate screening and PCR verification. The strain that lost the gRNA plasmid was then screened on a 5-fluoroorotic acid plate to obtain the strain FIM1Δura3Δpgi.

[0046] (2) Construction of Kluyveromyces marxianus FIM1Δura3ΔpgiΔzwf1 strain

[0047] Based on the strain FIM1Δura3Δpgi, the glucose-6-phosphate dehydrogenase ZWF1 gene was further knocked out. The gRNA plasmid and donor sequence required for knocking out the ZWF1 gene were first constructed using basic molecular cloning technology. The gRNA primers were ZWF1g-F (tcatttggtacagaaggccgcgg) and ZWF1g-R (aacccgcggccttctgtaccaaa) targeting the 667-687bp position of the ZWF1 cds region. The donor sequence consisted of 500bp upstream and downstream of the ZWF1 gene cds region. At the same time, the gRNA plasmid and donor sequence were simultaneously transformed into the FIM1Δura3Δpgi strain, and clones with successful knockout of the ZWF1 gene were obtained through uracil deficiency plate screening and PCR verification. The strains that lost the gRNA plasmid were then screened on 5-fluoroorotic acid plates. Since the glucose metabolism of Kluyveromyces marxianus was theoretically completely blocked after the PGI and ZWF1 genes were knocked out at the same time, glycerol with a final concentration of 2% was required as the second carbon source to maintain cell growth during screening and subsequent culture. The Kluyveromyces marxianus strain FIM1Δura3ΔpgiΔzwf1 was obtained.

[0048] (3) Construction of Kluyveromyces marxianus FIM1Δura3ΔpgiΔzwf1Δmiox5 strain

[0049] The FIM1Δura3ΔpgiΔzwf1 strain has blocked the downstream shunt of glucose-6-phosphate, further blocking the downstream decomposition pathway of inositol. The inositol oxygenase MIOX5 gene was further knocked out based on the FIM1Δura3ΔpgiΔzwf1 strain. The gRNA plasmid and donor sequence required for knocking out the MIOX5 gene were first constructed using basic molecular cloning technology. The gRNA primers are as follows: MOIX5g-F: TCAagtcattattcatagtgata; MIOX5g-R: AACtatcactatgaataatgact, targeting the 66-86bp position of the MIOX5 gene cds region. The donor sequence consists of 500bp upstream and downstream of the MIOX5 gene cds region, totaling 1000bp. At the same time, the gRNA plasmid and donor sequence were transformed into the FIM1Δura3ΔpgiΔzwf1 strain. The clones with successful knockout of miox5 were obtained by uracil-deficient plate screening and PCR verification. The strains that lost the gRNA plasmid were then screened on 5-fluoroorotic acid plates to obtain the strain FIM1Δura3ΔpgiΔzwf1Δmiox5.

[0050] (4) Construction of FIM1Δura3ΔpgiΔzwf1Δmiox5Δitr2 strain

[0051] The FIM1Δura3ΔpgiΔzwf1Δmiox5 strain has blocked the downstream shunt of glucose-6-phosphate and the downstream decomposition pathway of inositol. The transport pathway for transporting inositol into the cell is further blocked to prevent the cell from transporting inositol in the system into the cell for use. Therefore, based on the FIM1Δura3ΔpgiΔzwf1Δmiox5 strain, the inositol transporter ITR2 gene was further knocked out. The gRNA plasmid and donor sequence required for knocking out ITR2 were first constructed by basic molecular cloning technology. The gRNA primers are as follows: ITR2g-F: TCAggttgctggtagactagtta; ITR2g-R: AACtaactagtctaccagcaacc, targeting the 480-500bp position of the ITR2 gene cds region. The Donor sequence consists of 500bp upstream and downstream of the ITR2 gene cds region. At the same time, the gRNA plasmid and donor sequence were transformed into the FIM1Δura3ΔpgiΔzwf1Δmiox5 strain. The clones with successful knockout of the ITR2 gene were obtained by uracil-deficient plate screening and PCR verification. The strains that lost the gRNA plasmid were then screened on 5-fluoroorotic acid plates to obtain the strain FIM1Δura3ΔpgiΔzwf1Δmiox5Δitr2.

[0052] Example 4: Construction of a strain for simultaneous saccharification and fermentation of starch to synthesize inositol by Kluyveromyces marxianus

[0053] According to the efficiency of starch hydrolysis enzyme described in Example 2 to produce glucose, BadGLA derived from adenine yeast saccharifying enzyme was selected as the engineering strain of Kluyveromyces marxianus for constructing synchronous saccharification and fermentation of starch. In order to construct an inositol synthesis strain, the inositol phosphate synthase TbIPS derived from Trypanosoma brucei and the inositol monophosphatase EcIMP from Escherichia coli described in Example 3 were codon optimized and synthesized without changing the amino acid sequence. Since synchronous saccharification and fermentation require the construction of an engineering strain of Kluyveromyces marxianus that simultaneously expresses BadGLA, TbIPS and EcIMP, it is necessary to construct three groups of expression elements to regulate the expression of BadGLA, TbIPS and EcIMP respectively. BadGLA, TbIPS and EcIMP fragments were obtained by PCR amplification, and then the BadGLA gene fragment was inserted into the Kluyveromyces marxianus expression vector pUKDN132, and the secretory expression of BadGLA was regulated by the inulinase promoter Pinu, promoter signal peptide and terminator Tinu of the vector. Subsequently, TEF promoter Ptef and TEF terminator Ttef, GAP promoter Pgap and terminator Tgap were obtained by PCR amplification on the plasmid preserved in the laboratory. The six fragments of Ptef, TbIPS, Ttef, Pgap, EcIMP and Tgap were fused into the fragment Ptef-TbIPS-Ttef-Pgap-TbIPS-Tgap by Overlap PCR technology, and the fusion fragment was inserted into the upstream part of the inulinase promoter of Kluyveromyces marxianus expression vector pUKDN132 for expression, obtaining the plasmid pUKDN132-Ptef-TbIPS-Ttef-Pgap-EcIMP-Tgap-Pinu-αBadGLA-Tinu( Figure 4 ).

[0054] The constructed pUKDN132-Ptef-TbIPS-Ttef-Pgap-EcIMP-Tgap-Pinu-αBadGLA-Tinu plasmids were transformed into Kluyveromyces marxianus chassis cells FIM1Δura3ΔpgiΔzwf1Δmiox5Δitr2 (Example 3) to obtain Kluyveromyces marxianus engineered bacteria FIM1Δura3ΔpgiΔzwf1Δmiox5Δitr2 / pUKDN132-Ptef-TbIPS-Ttef-Pgap-EcIMP-Tgap-Pinu-αBadGLA-Tinu, named JC-5.

[0055] Example 5, Production of inositol by fermentation of starch with Kluyveromyces marxianus JC-5 in shake flasks

[0056] Prepare YPD medium with 2% liquefied starch or 2% soluble starch, and add 2% glycerol as a growth carbon source. The specific operation of starch liquefaction is as follows: weigh 25g of starch, add 80mL of water, and gelatinize in a boiling water bath for 10min while stirring. Add 0.1% anhydrous calcium chloride and 20U / g high-temperature resistant α-amylase to 20mL100mM sodium citrate-citric acid buffer with a pH of 6.3, and then liquefy at 80℃ for 25min to obtain liquefied starch.

[0057] Streak the Kluyveromyces marxianus strain JC-4 on a YPD plate containing 2% glycerol, and then culture in a 30°C incubator for 36-48 hours until a single clone is formed. Pick 3-5 single clones and inoculate them into 50 mL of YPD medium containing 2% liquefied starch or 2% soluble starch, and culture for 168 hours at 30°C and 220 rpm. When cultured to 96 hours, add 1 mL of 50% glycerol, and then continue to culture at 30°C and 220 rpm until 120 hours. For the shake flask fermenting liquefied starch, add 4 mL of 30% liquefied starch at 96-120 hours.

[0058] During the culture process, samples were taken every 24 hours to measure the bacterial cell density, as well as the glucose, glycerol, and inositol contents. The bacterial cell density was measured by spectrophotometer at OD600nm absorbance. The glucose, glycerol, and inositol contents were determined by high performance liquid chromatography, and the specific method was as follows: the analytical column was MetaCrab 87H (Agilent 50×4.6mm), the column temperature was 35°C, the mobile phase was 0.01N sulfuric acid solution (290μL sulfuric acid was diluted to 1L with ultrapure water), the flow rate was 0.6mL / min, and the detection time was 25min. The detector was a differential refractive index detector, and the detector temperature was 35°C.

[0059] The cell growth curve and glucose, glycerol and inositol content curves during shake flask culture are shown in Figure 2. Figure 5 As shown. The results showed that the JC-5 strain can grow in a medium with simultaneous saccharification and fermentation of liquefied starch and soluble starch, and the growth in the medium containing 2% liquefied starch is better than that in the medium containing 2% soluble starch. The reason may be that the JC-5 strain is more efficient in expressing saccharifying enzymes to hydrolyze liquefied starch, and the amount of glucose released is also significantly higher than that of soluble starch. Similar to growth, the production of inositol is also higher in the medium with 2% liquefied starch. When the fermentation reached 168h, the JC-5 strain fermented soluble starch, and the cell density was OD 600 =85.5, inositol yield 21.1 g / L, starch liquefaction fermentation, cell density OD 600 =95.3, inositol production 25.5g / L, compared with fermentation of soluble starch increased by 20.9%.

[0060] Example 6: Continuous fed-batch fermentation of starch to produce inositol by Kluyveromyces marxianus JC-5

[0061] Streak strain JC-4 on a YPD plate containing 2% glycerol and activate overnight at 30°C. Pick 3-5 single clones and inoculate them into 150mL YPD medium containing 2% glycerol and culture for 48h. Transfer strain JC-5 to a fermenter containing 5% liquefied starch or 5% soluble starch and 2% glycerol at an initial inoculation amount of 10%, add 50% glycerol as a carbon source, and perform continuous fed-batch fermentation. The dissolved oxygen is maintained at a constant 30% during the process, and the glycerol concentration of the system is 1%-3%.

[0062] During the culture process, samples were taken every 24 hours to measure the cell density, glucose, glycerol, and inositol content. The results showed that ( Figure 6 ), when JC-5 was fermenting soluble starch, the cell density reached OD 600 =134.80, inositol production was 32.19 g / L, and starch-inositol conversion rate was about 64.38%. When JC-5 was fermenting liquefied starch, the cell density reached OD 600 =168.00, inositol production is 45.5g / L; starch-inositol conversion rate is about 91.1%. Compared with fermenting soluble starch, cell density increased by 24.6% and inositol production increased by 41.3%. It also has a higher starch-inositol conversion rate. However, soluble starch can omit the liquefaction step in actual application scenarios, and theoretically has an output value equivalent to that of liquefied starch.

Claims

1. An engineered strain of Kluyveromyces marxianus for simultaneously saccharifying and fermenting starch to synthesize inositol, characterized in that: It is constructed by the following steps: (1) Using Crispr gene editing technology, four genes related to sugar metabolism and inositol metabolism and transport, including glucose-6-phosphate isomerase PGI gene, glucose-6-phosphate dehydrogenase ZWF1 gene, inositol oxygenase MIOX5 gene and inositol transporter ITR2 gene, were knocked out in the genome of Kluyveromyces marxianus FIM1Δura3 strain to construct a Kluyveromyces marxianus strain named FIM1Δura3ΔpgiΔzwf1Δmiox5Δitr2; (2) The TEF promoter Ptef and TEF terminator Ttef were used to construct the expression cassette of the Trypanosoma brucei inositol phosphate synthase TbIPS gene; the GAP promoter Pgap and GAP terminator Tgap were used to construct the expression cassette of the Escherichia coli gene inositol monophosphatase EcIMP; the inulinase promoter Pinu and inulinase terminator Tinu were used to construct the adenine yeast Blastobotrys adeninivorans saccharifying enzyme BadGLA gene expression cassette, TbIPS gene expression cassette, EcIMP gene expression cassette and BadGLA gene expression cassette were inserted into a Kluyveromyces marxianus expression vector pUKDN132 in sequence to construct a co-expression plasmid of inositol phosphate synthase TbIPS, inositol monophosphatase EcIMP and saccharifying enzyme BadGLA, recorded as pUKDN132-Ptef-TbIPS-Ttef-Pgap-EcIMP-Tgap-Pinu-αBadGLA-Tinu; (3) The constructed expression plasmid pUKDN132-Ptef-TbIPS-Ttef-Pgap-EcIMP-Tgap-Pinu-αBadGL A-Tinu was transformed into the Kluyveromyces marxianus strain FIM1Δura3ΔpgiΔzwf1Δmiox5Δitr2 described in step (1); and the following were obtained by screening: The engineered Kluyveromyces marxianus strain was denoted as FIM1Δura3ΔpgiΔzwf1Δmiox5Δitr2 / pUKDN132-Ptef-TbIPS-Ttef-Pgap-EcIMP-Tgap-Pinu-αBadGLA-Tinu and named as Kluyveromyces marxianus JC-5; in: The Kluyveromyces marxianus FIM1Δura3 strain is obtained by knocking out the uracil synthase gene URA3 on the genome of the Kluyveromyces marxianus FIM1 strain (accession number: CGMCC No.10621) preserved in the China General Microbiological Culture Collection Center; The Kluyveromyces marxianus expression vector pUKDN132 contains a Kluyveromyces marxianus autonomous replication sequence, an inulinase promoter, an α-factor signal peptide, an inulinase terminator and a selection marker gene URA3 element; The inositol phosphate synthase TbIPS has a nucleotide sequence as shown in SEQ ID No.1 and an amino acid sequence as shown in SEQ ID No.2; the inositol monophosphatase EcIMP has a nucleotide sequence as shown in SEQ ID No.3 and an amino acid sequence as shown in SEQ ID No.4; the saccharifying enzyme BadGLA has a nucleotide sequence and an amino acid sequence as described in patent CN202310482013.

6.

2. The use of the Kluyveromyces marxianus engineered strain in the simultaneous saccharification and fermentation of starch to synthesize inositol as claimed in claim 1, characterized in that: The Kluyveromyces marxianus engineered strain is used as a fermentation strain, and liquefied starch, glycerol, yeast extract and peptone components are used as a culture medium to produce inositol through culture and fermentation.

3. The use according to claim 2, characterized in that: The specific operation of liquefying starch is as follows: weigh 15-25g of starch, add 60-80mL of appropriate amount of water, and gelatinize in a boiling water bath for 10-15min while stirring; add 20-40mL of 100mM sodium citrate-citric acid buffer with pH=6.2-6.4, add 0.1%-0.2% of anhydrous calcium chloride, add 20-30U / g of high temperature resistant α-amylase, stir evenly, and liquefy at 80-85℃ for 25-30min to obtain liquefied starch.

4. The use according to claim 3, characterized in that: The specific operation of fermenting liquefied starch to synthesize inositol is as follows: inoculate Kluyveromyces marxianus JC-5 into 50-150mL YPD medium containing 2%-3% glycerol and 2%-4% liquefied starch, culture at 30°C and 220rpm for 144-168h, and add 1-2mL 50% glycerol when the culture reaches 96h, and add 4-6mL 30% liquefied starch when the culture reaches 120h, ferment for 144h-168h, and obtain high-yield inositol: 22.2g / L-25.5g / L.

5. The use according to claim 3, characterized in that: The Kluyveromyces marxianus JC-5 cultured in YPD medium containing 2%-3% glycerol was transferred at 5%-10% to a fermenter containing YP medium containing 2%-4% glycerol and 4%-6% liquefied starch, and glycerol was fed as a carbon source for continuous fed-batch fermentation. Under the conditions of continuous fed-batch fermentation, the strain was fermented at a high density for 144-168 hours to obtain a high yield of inositol: 32.45g / L-45.55g / L.

6. The use according to claim 2, characterized in that: Using soluble starch as raw material, Kluyveromyces marxianus JC-5 was inoculated into YPD medium containing glycerol, and then transferred to a fermenter containing YP medium containing 2%-3% glycerol and 4%-6% soluble starch at 5%-10%. Glycerol was fed as a carbon source for continuous fed-batch fermentation. Under the conditions of continuous fed-batch fermentation, the fermentation was carried out for 144h-168h to obtain high-yield inositol: 26.67g / L-32.19g / L.

Images