Recombinant yarrowia lipolytica as well as construction method and application thereof

Abstract

The invention provides recombinant yarrowia lipolytica as well as a construction method and application thereof. According to the method disclosed by the invention, beta-carotene synthesis related genes are transferred into a yarrowia lipolytica starting strain to obtain the recombinant yarrowia lipolytica with the capacity of high yield of beta-carotene; furthermore, related genes are introduced on the basis of the recombinant yarrowia lipolytica with high yield of beta-carotene, so that efficient conversion from beta-carotene to zeaxanthin is successfully realized.

Description

Technical Field

[0001] The present invention belongs to the field of microbial technology, and particularly relates to a recombinant Yarrowia lipolytica capable of producing high-yield beta-carotene or zeaxanthin, a construction method thereof, and an application thereof. Background Art

[0002] Zeaxanthin is present in large quantities in plant tissues such as green vegetables, red pepper, marigold, corn seeds, wolfberry and Physalis fruit, and some non-photosynthetic bacteria. Studies have shown that the macular pigment of the human eye retina is composed of two kinds of lutein present in the diet, namely lutein and zeaxanthin. The two pigments can absorb the function of blue light waves that damage the retina, and then play a role in protecting the eyeball. At the same time, zeaxanthin can also prevent the infringement of free radicals on biofilms, quench singlet oxygen and capture active oxygen free radicals, and has specific antioxidant function. In terms of the treatment of other chronic diseases, zeaxanthin has a special effect that is different from other carotenoids, and also has a unique physiological effect in preventing cardiovascular diseases, cataracts, preventing cancer and enhancing immunity (CN101293863A). In addition, zeaxanthin is also widely used in dietary pigments, agriculture and cosmetics (CN10123616A).

[0003] At present, there are four main ways to obtain zeaxanthin in industry: extraction from plants; chemical synthesis; chemical transformation using other intermediates; and microbial fermentation. Plant extraction mainly obtains zeaxanthin from plants such as capsicum (CN110590630A), marigold (CN113582899A; CN105254549; CN114057072A), corn (CN102603590A), wolfberry (CN106349136A; CN107098839A; CN106349137A), and physalis (CN106565574A). This method often requires a large amount of organic solvents and is assisted by inefficient and expensive means such as supercritical extraction and ultrasound to obtain the final product. The process is complex, the energy consumption is high, the product yield is low, and the removal effect of other carotenoids is poor.

[0004] Plant extraction mainly obtains zeaxanthin from plants such as capsanthin, marigold, corn, wolfberry and sour berry. This method often requires a large amount of organic solvents, and is assisted by inefficient and expensive means such as supercritical extraction and ultrasound to obtain the final product. The process is complex, energy consumption is high, product yield is low, and the removal effect of other carotenoids is poor. As for the total synthesis strategy, as summarized in "Chang, An-Ni. Total synthesis of (3R, 3'R, 6'R)-lutein, (3R, 3'R)-zeaxanthin and their stereoisomers. University of Maryland, College Park, 2008", total synthesis often has complex process steps, serious process pollution, and high synthesis cost. At present, this method is still a long way from commercialization. The use of canthaxanthin (CN101293863A), lutein (CN105085351A, CN101153017B; Helv.Chim.Acta 39 (1956) 2041; Justus Liebigs Ann.Chem.603 (1957) 129), or astaxanthin (CN110143904B) can largely solve the problems caused by total synthesis, but the use of toxic reagents and harsh reaction parameters in the process have brought severe challenges to the industrial scale-up of zeaxanthin.

[0005] Microbial synthesis has opened up a new way of thinking for the commercial production of zeaxanthin. Patents such as CN10123616A, CN103038358B, and CN105886518A have also conducted a lot of research on different genera. Yarrowia lipolytica is a known strain for the production of zeaxanthin, but the production of zeaxanthin by Yarrowia lipolytica is limited. Summary of the invention

[0006] In order to solve the above problems, the present invention genetically modified Yarrowia lipolytica to significantly increase the yield of zeaxanthin.

[0007] In a first aspect, the present invention provides a recombinant Yarrowia yeast comprising introduced genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP) and geranylgeranyl diphosphate synthase (CrtE).

[0008] In certain embodiments, the phytoene dehydrogenase is from Mucor circinelloides.

[0009] In certain embodiments, the phytoene dehydrogenase comprises the amino acid sequence shown in SEQ ID NO:1.

[0010] In certain embodiments, the gene encoding phytoene dehydrogenase comprises the nucleotide sequence shown in SEQ ID NO:13.

[0011] In certain embodiments, the number of copies of the gene encoding phytoene dehydrogenase introduced is 2, 3, 4 or 5.

[0012] In certain embodiments, the different copy numbers of genes are the same or different.

[0013] In certain embodiments, the lycopene cyclase / phytoene synthase is from Mucor circinelloides.

[0014] In certain embodiments, the lycopene cyclase / phytoene synthase comprises the amino acid sequence shown in SEQ ID NO:2.

[0015] In certain embodiments, the gene encoding lycopene cyclase / phytoene synthase comprises the nucleotide sequence shown in SEQ ID NO:14.

[0016] In certain embodiments, the geranylgeranyl diphosphate synthase is from Xanthophyllomyces dendrorhous.

[0017] In certain embodiments, the geranylgeranyl diphosphate synthase comprises the amino acid sequence shown in SEQ ID NO:3.

[0018] In certain embodiments, the gene encoding geranylgeranyl diphosphate synthase comprises the nucleotide sequence shown in SEQ ID NO:15.

[0019] In certain embodiments, the number of copies of the geranylgeranyl diphosphate synthase gene introduced is 2, 3, 4 or 5.

[0020] In certain embodiments, the different copy numbers of genes are the same or different.

[0021] In certain embodiments, the recombinant Yarrowia rosenbergii further comprises an introduced gene encoding a first β-carotene hydroxylase CrtZ.

[0022] In certain embodiments, the first β-carotene hydroxylase is CrtZ_9GAMM from Pantoeastewartii.

[0023] In certain embodiments, the β-carotene hydroxylase CrtZ_9GAMM comprises the amino acid sequence shown in SEQ ID NO:6.

[0024] In certain embodiments, the gene encoding β-carotene hydroxylase CrtZ_9GAMM comprises the nucleotide sequence shown in SEQ ID NO:18.

[0025] In certain embodiments, the recombinant Yarrowia rosenbergii further comprises an introduced gene encoding diacylglycerol acyltransferase (DGA1).

[0026] In certain embodiments, the diacylglycerol acyltransferase is from Yarrowia lipolytica.

[0027] In certain embodiments, the diacylglycerol acyltransferase comprises the amino acid sequence shown in SEQ ID NO:4.

[0028] In certain embodiments, the gene encoding diacylglycerol acyltransferase comprises the nucleotide sequence shown in SEQ ID NO:16.

[0029] In certain embodiments, the recombinant Yarrowia rosenbergii further comprises an introduced gene encoding 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) or a truncation thereof (tHMGR).

[0030] In certain embodiments, the 3-hydroxy-3-methylglutaryl-CoA reductase or a truncation thereof is from Yarrowia lipolytica.

[0031] In certain embodiments, the 3-hydroxy-3-methylglutaryl-CoA reductase or a truncate thereof comprises the amino acid sequence shown in SEQ ID NO:5.

[0032] In certain embodiments, the gene encoding 3-hydroxy-3-methylglutaryl-CoA reductase or a truncation thereof comprises the nucleotide sequence shown in SEQ ID NO:17.

[0033] In certain embodiments, the recombinant Yarrowia rosenbergii further comprises an introduced gene encoding mevalonate-5-pyrophosphate decarboxylase (ERG19).

[0034] In certain embodiments, the mevalonate 5-pyrophosphate decarboxylase is from Yarrowia lipolytica.

[0035] In certain embodiments, the mevalonate 5-pyrophosphate decarboxylase comprises the amino acid sequence shown in SEQ ID NO:7.

[0036] In certain embodiments, the gene encoding mevalonate 5-pyrophosphate decarboxylase comprises the nucleotide sequence shown in SEQ ID NO:19.

[0037] In certain embodiments, the recombinant Yarrowia rosenbergii further comprises an introduced gene encoding a second β-carotene hydroxylase.

[0038] In certain embodiments, the second β-carotene hydroxylase is CrtZ_SACS2 from Saccharolobus solfataricus.

[0039] In certain embodiments, the β-carotene hydroxylase CrtZ_SACS2 comprises the amino acid sequence shown in SEQ ID NO:8.

[0040] In certain embodiments, the gene encoding β-carotene hydroxylase CrtZ_SACS2 comprises the nucleotide sequence shown in SEQ ID NO: 20 or 21.

[0041] In certain embodiments, the number of copies of the gene encoding β-carotene hydroxylase CrtZ_SACS2 introduced is 2, 3, 4 or 5.

[0042] In certain embodiments, the sequences of the different copy numbers are identical or different.

[0043] In certain embodiments, the Yarrowia lipolytica comprises the nucleotide sequences shown in SEQ ID NOs: 20 and 21 or degenerate sequences thereof.

[0044] In certain embodiments, the recombinant Yarrowia serrata further comprises an introduced gene encoding a β-carotene hydroxylase-endoplasmic reticulum targeting sequence fusion protein.

[0045] In certain embodiments, the endoplasmic reticulum targeting sequence is KDEL.

[0046] In certain embodiments, the β-carotene hydroxylase is β-carotene hydroxylase CrtZ_9GAMM from Pantoea stearii or β-carotene hydroxylase CrtZ_SACS2 from Saccharolobus solfataricus.

[0047] In certain embodiments, the β-carotene hydroxylase CrtZ_9GAMM comprises the amino acid sequence shown in SEQ ID NO:6.

[0048] In certain embodiments, the gene encoding β-carotene hydroxylase CrtZ_9GAMM comprises the nucleotide sequence shown in SEQ ID NO:18.

[0049] In certain embodiments, the β-carotene hydroxylase CrtZ_SACS2 comprises the amino acid sequence shown in SEQ ID NO:8.

[0050] In certain embodiments, the gene encoding β-carotene hydroxylase CrtZ_SACS2 comprises the nucleotide sequence shown in SEQ ID NO: 20 or 21.

[0051] In certain embodiments, the recombinant Yarrowia roxburghii further comprises an introduced fusion gene encoding a fusion protein of β-carotene hydroxylase and a protein related to lipid metabolism.

[0052] In certain embodiments, the fusion gene includes a gene encoding β-carotene hydroxylase and a gene encoding a protein related to lipid metabolism.

[0053] In certain embodiments, the β-carotene hydroxylase is β-carotene hydroxylase CrtZ_9GAMM from Pantoea stearii or β-carotene hydroxylase CrtZ_SACS2 from Saccharolobus solfataricus.

[0054] In certain embodiments, the β-carotene hydroxylase CrtZ_9GAMM comprises the amino acid sequence shown in SEQ ID NO:6.

[0055] In certain embodiments, the gene encoding β-carotene hydroxylase CrtZ_9GAMM comprises the nucleotide sequence shown in SEQ ID NO:18.

[0056] In certain embodiments, the β-carotene hydroxylase CrtZ_SACS2 comprises the amino acid sequence shown in SEQ ID NO:8.

[0057] In certain embodiments, the gene encoding β-carotene hydroxylase CrtZ_SACS2 comprises the nucleotide sequence shown in SEQ ID NO: 20 or 21.

[0058] In certain embodiments, the lipid metabolism-related proteins include one or more of sterol methyltransferase (ERG6), 1-acylglycerol-3-phosphate-O-acyltransferase (SLC1), phospholipid acyltransferase (LOA1) and sterol ester hydrolase (TGL1).

[0059] In certain embodiments, the sterol methyltransferase is from Yarrowia lipolytica.

[0060] In certain embodiments, the sterol methyltransferase comprises the amino acid sequence shown in SEQ ID NO:9.

[0061] In certain embodiments, the gene encoding sterol methyltransferase comprises the nucleotide sequence shown in SEQ ID NO:22.

[0062] In certain embodiments, the 1-acylglycerol-3-phosphate-O-acyltransferase is from Yarrowia lipolytica.

[0063] In certain embodiments, the 1-acylglycerol-3-phosphate-O-acyltransferase comprises the amino acid sequence shown in SEQ ID NO:10.

[0064] In certain embodiments, the gene encoding 1-acylglycerol-3-phosphate-O-acyltransferase comprises the nucleotide sequence shown in SEQ ID NO:23.

[0065] In certain embodiments, the phospholipid acyltransferase is from Yarrowia lipolytica.

[0066] In certain embodiments, the phospholipid acyltransferase comprises the amino acid sequence shown in SEQ ID NO:11.

[0067] In certain embodiments, the gene encoding phospholipid acyltransferase comprises the nucleotide sequence shown in SEQ ID NO:24.

[0068] In certain embodiments, the sterol ester hydrolase is from Yarrowia lipolytica.

[0069] In certain embodiments, the sterol ester hydrolase comprises the amino acid sequence shown in SEQ ID NO:12.

[0070] In certain embodiments, the gene encoding sterol ester hydrolase comprises the nucleotide sequence shown in SEQ ID NO:25.

[0071] In certain embodiments, the β-carotene hydroxylase is linked to the lipid metabolism-related protein via a flexible linker.

[0072] In certain embodiments, the flexible linker is a GS linker.

[0073] In certain embodiments, the flexible linker comprises the amino acid sequence shown in SEQ ID NO: 65 or SEQ ID NO: 66.

[0074] In certain embodiments, the genes introduced into the recombinant Yarrowia spp. include the following combinations:

[0075] 1) Genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), and geranylgeranyl diphosphate synthase (CrtE);

[0076] 2) genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgeranyl diphosphate synthase (CrtE), and diacylglycerol acyltransferase (DGA1);

[0077] 3) genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgeranyl diphosphate synthase (CrtE), diacylglycerol acyltransferase (DGA1), and 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) or their truncations (tHMGR);

[0078] 4) genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgeranyl diphosphate synthase (CrtE), diacylglycerol acyltransferase (DGA1), 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) or its truncation (tHMGR), and β-carotene hydroxylase CrtZ_9GAMM;

[0079] 5) genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgeranyl diphosphate synthase (CrtE), diacylglycerol acyltransferase (DGA1), 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) or its truncation (tHMGR), β-carotene hydroxylase CrtZ_9GAMM, and mevalonate-5-pyrophosphate decarboxylase (ERG19);

[0080] 6) genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgeranyl diphosphate synthase (CrtE), diacylglycerol acyltransferase (DGA1), 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) or its truncation (tHMGR), β-carotene hydroxylase CrtZ_9GAMM and mevalonate-5-pyrophosphate decarboxylase (ERG19), and β-carotene hydroxylase CrtZ_SACS2;

[0081] 7) genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgeranyl diphosphate synthase (CrtE), diacylglycerol acyltransferase (DGA1), 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) or its truncation (tHMGR), β-carotene hydroxylase CrtZ_9GAMM, mevalonate-5-pyrophosphate decarboxylase (ERG19), and β-carotene hydroxylase CrtZ_SACS2-KDEL fusion protein;

[0082] 8) genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgeranyl diphosphate synthase (CrtE), diacylglycerol acyltransferase (DGA1), 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) or its truncation (tHMGR), β-carotene hydroxylase CrtZ_9GAMM, mevalonate-5-pyrophosphate decarboxylase (ERG19), and β-carotene hydroxylase crtZ_9GAM-KDEL fusion protein;

[0083] 9) genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgeranyl diphosphate synthase (CrtE), diacylglycerol acyltransferase (DGA1), 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) or its truncation (tHMGR), β-carotene hydroxylase CrtZ_9GAMM, mevalonate-5-pyrophosphate decarboxylase (ERG19), β-carotene hydroxylase CrtZ_SACS2, and β-carotene hydroxylase CrtZ_SACS2-ERG6 fusion protein;

[0084] 10) genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgeranyl diphosphate synthase (CrtE), diacylglycerol acyltransferase (DGA1), 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) or its truncation (tHMGR), β-carotene hydroxylase CrtZ_9GAMM, mevalonate-5-pyrophosphate decarboxylase (ERG19), β-carotene hydroxylase CrtZ_SACS2, and β-carotene hydroxylase CrtZ_SACS2-SLC1 fusion protein;

[0085] 11) genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgeranyl diphosphate synthase (CrtE), diacylglycerol acyltransferase (DGA1), 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) or its truncation (tHMGR), β-carotene hydroxylase CrtZ_9GAMM, mevalonate-5-pyrophosphate decarboxylase (ERG19), β-carotene hydroxylase CrtZ_SACS2, and β-carotene hydroxylase CrtZ_SACS2-LOA1 fusion protein;

[0086] 12) Genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgeranyl diphosphate synthase (CrtE), diacylglycerol acyltransferase (DGA1), 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) or its truncation (tHMGR), β-carotene hydroxylase CrtZ_9GAMM, mevalonate-5-pyrophosphate decarboxylase (ERG19), β-carotene hydroxylase CrtZ_SACS2, and β-carotene hydroxylase CrtZ_SACS2 and TGL1 fusion protein.

[0087] In certain embodiments, in the combinations 1) to 12), the copy number of the gene encoding CarB is 2.

[0088] In certain embodiments, in the combinations 4) to 12), the copy number of the gene encoding CrtE is 2.

[0089] In certain embodiments, in the combination 6), the gene encoding CrtZ_SACS2 comprises two copies.

[0090] In certain embodiments, the two copies respectively comprise the nucleotide sequence shown in SEQ ID NO: 20 or 21 or a degenerate sequence thereof.

[0091] In certain embodiments, the genome is inserted with the following DNA sequences or a combination of their fragments:

[0092] 1) SEQ ID NO: 26;

[0093] 2) SEQ ID NO: 26 and SEQ ID NO: 27;

[0094] 3) SEQ ID NO: 26, SEQ ID NO: 27 and SEQ ID NO: 28;

[0095] 4) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28 and SEQ ID NO: 29;

[0096] 5) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29 and SEQ ID NO: 30;

[0097] 6) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30 and SEQ ID NO: 31;

[0098] 7) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31 and SEQ ID NO: 32;

[0099] 8) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32 and SEQ ID NO: 39;

[0100] 9) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31 and SEQ ID NO: 33;

[0101] 10) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29,

[0102] SEQ ID NO: 30, SEQ ID NO: 31 and SEQ ID NO: 34;

[0103] 11) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29,

[0104] SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32 and SEQ ID NO: 35;

[0105] 12) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29,

[0106] SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32 and SEQ ID NO: 36;

[0107] 13) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29,

[0108] SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32 and SEQ ID NO: 37;

[0109] 14) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29,

[0110] SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32 and SEQ ID NO:38.

[0111] In certain embodiments, the fragment is a sequence obtained by removing the resistance gene or the screening gene based on any one of SEQ ID NOs: 26-39.

[0112] In certain embodiments, the recombinant Yarrowia robur is Yarrowia lipolytica.

[0113] In certain embodiments, the starting strain for constructing the recombinant Yarrowia lipolytica is selected from the group consisting of Yarrowia lipolytica Po1f, Po1d, Po1e, Po1g and Po1h.

[0114] The second aspect of the present invention provides use of the recombinant Yarrowia rosenbergii described in the first aspect of the present invention in producing β-carotene and / or zeaxanthin.

[0115] The third aspect of the present invention provides a method for producing zeaxanthin, which comprises fermenting the recombinant Yarrowia rosenbergii described in the first aspect of the present invention to produce zeaxanthin.

[0116] A fourth aspect of the present invention provides a method for producing recombinant Yarrowia rosenbergii, the method comprising introducing genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP) and geranylgeranyl diphosphate synthase (CrtE) into a starting strain of Yarrowia rosenbergii.

[0117] In certain embodiments, the number of copies of the gene encoding phytoene dehydrogenase introduced is 2, 3, 4 or 5.

[0118] In certain embodiments, the number of copies of the gene encoding geranylgeranyl diphosphate synthase introduced is 2, 3, 4 or 5.

[0119] In certain embodiments, the method further introduces one or more of the following genes: a gene encoding diacylglycerol acyltransferase (DGA1), a gene encoding 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) or a truncation thereof (tHMGR), a gene encoding β-carotene hydroxylase, a gene encoding a fusion protein of β-carotene hydroxylase and an endoplasmic reticulum targeting sequence, a gene encoding a fusion protein of β-carotene hydroxylase and a protein related to lipid metabolism, and a gene encoding mevalonate-5-pyrophosphate decarboxylase (ERG19).

[0120] In certain embodiments, the gene encoding β-carotene hydroxylase includes a gene encoding β-carotene hydroxylase CrtZ_9GAMM from Pantoea stewartii, and a gene encoding β-carotene hydroxylase CrtZ_SACS2 from Saccharolobus solfataricus.

[0121] In certain embodiments, the gene encoding the fusion protein of β-carotene hydroxylase and endoplasmic reticulum targeting sequence includes a gene encoding β-carotene hydroxylase CrtZ_9GAMM-endoplasmic reticulum targeting sequence fusion protein and a gene encoding β-carotene hydroxylase CrtZ_SACS2-endoplasmic reticulum targeting sequence fusion protein. Wherein, the CrtZ_9GAMM is the β-carotene hydroxylase of Pantoea stewartii, and the CrtZ_SACS2 is the β-carotene hydroxylase of Saccharolobus solfataricus.

[0122] In certain embodiments, the gene encoding the fusion protein of β-carotene hydroxylase and lipid metabolism-related protein includes a gene encoding a β-carotene hydroxylase CrtZ_SACS2-ERG6 fusion protein, a gene encoding a β-carotene hydroxylase CrtZ_SACS2-SLC1 fusion protein, a gene encoding a β-carotene hydroxylase CrtZ_SACS2-LOA1 fusion protein, and a gene encoding a β-carotene hydroxylase CrtZ_SACS2-TGL1 fusion protein.

[0123] In certain embodiments, the number of introduced copies of the gene encoding the same enzyme is 1-5; preferably 1 or 2; more preferably, the gene sequences of different copies are the same or different.

[0124] In certain embodiments, the phytoene dehydrogenase is from Mucor circinelloides; preferably, the phytoene dehydrogenase comprises the amino acid sequence shown in SEQ ID NO: 1; preferably, the gene encoding the phytoene dehydrogenase comprises the nucleotide sequence shown in SEQ ID NO: 13;

[0125] and / or,

[0126] The lycopene cyclase / phytoene synthase is from Mucor circinelloides; preferably, the lycopene cyclase / phytoene synthase comprises the amino acid sequence shown in SEQ ID NO: 2; preferably, the gene encoding the lycopene cyclase / phytoene synthase comprises the nucleotide sequence shown in SEQ ID NO: 14;

[0127] And / or, the geranylgeranyl diphosphate synthase is from Xanthophyllomyces dendrorhous; preferably, the geranylgeranyl diphosphate synthase comprises the amino acid sequence shown in SEQ ID NO: 3; preferably, the gene encoding the geranylgeranyl diphosphate synthase comprises the nucleotide sequence shown in SEQ ID NO: 15;

[0128] And / or, preferably, the diacylglycerol acyltransferase is from Yarrowia lipolytica; preferably, the diacylglycerol acyltransferase comprises the amino acid sequence shown in SEQ ID NO: 4; the gene encoding the diacylglycerol acyltransferase comprises the nucleotide sequence shown in SEQ ID NO: 16;

[0129] And / or, the 3-hydroxy-3-methylglutaryl-CoA reductase or a truncate thereof is from Yarrowia lipolytica; preferably, the 3-hydroxy-3-methylglutaryl-CoA reductase or a truncate thereof comprises the amino acid sequence shown in SEQ ID NO: 5; the gene encoding the truncated 3-hydroxy-3-methylglutaryl-CoA reductase comprises the nucleotide sequence shown in SEQ ID NO: 17;

[0130] And / or, the β-carotene hydroxylase CrtZ_9GAMM comprises the amino acid sequence shown in SEQ ID NO: 6; the gene encoding the β-carotene hydroxylase CrtZ_9GAMM comprises the nucleotide sequence shown in SEQ ID NO: 18;

[0131] And / or, the mevalonate-5-pyrophosphate decarboxylase is from Yarrowia lipolytica, preferably, the mevalonate-5-pyrophosphate decarboxylase comprises the amino acid sequence shown in SEQ ID NO: 7; the gene encoding the mevalonate-5-pyrophosphate decarboxylase comprises the nucleotide sequence shown in SEQ ID NO: 19;

[0132] And / or, the β-carotene hydroxylase CrtZ_SACS2 comprises the amino acid sequence shown in SEQ ID NO: 8; preferably, the gene encoding the β-carotene hydroxylase CrtZ_SACS2 comprises the nucleotide sequence shown in SEQ ID NO: 20 or 21;

[0133] And / or, the sterol methyltransferase is from Yarrowia lipolytica; preferably, the sterol methyltransferase comprises the amino acid sequence shown in SEQ ID NO: 9; preferably, the gene encoding the sterol methyltransferase comprises the nucleotide sequence shown in SEQ ID NO: 22;

[0134] and / or,

[0135] The 1-acylglycerol-3-phosphate-O-acyltransferase is from Yarrowia lipolytica; preferably, the 1-acylglycerol-3-phosphate-O-acyltransferase comprises SEQ ID NO:

[0136] The amino acid sequence shown in 10; preferably, the gene encoding 1-acylglycerol-3-phosphate-O-acyltransferase comprises the nucleotide sequence shown in SEQ ID NO: 23;

[0137] and / or,

[0138] The phospholipid acyltransferase is from Yarrowia lipolytica; preferably, the phospholipid acyltransferase comprises the amino acid sequence shown in SEQ ID NO: 11; preferably, the gene encoding the phospholipid acyltransferase comprises the nucleotide sequence shown in SEQ ID NO: 24;

[0139] and / or,

[0140] The sterol ester hydrolase is from Yarrowia lipolytica; preferably, the sterol ester hydrolase comprises the amino acid sequence shown in SEQ ID NO: 12; preferably, the gene encoding the sterol ester hydrolase comprises the nucleotide sequence shown in SEQ ID NO: 25.

[0141] In certain embodiments, the introduction is performed by homologous recombination or non-homologous recombination.

[0142] In certain embodiments, the introduction is by non-homologous recombination of the donor DNA.

[0143] In certain embodiments, the donor DNA comprises the nucleotide sequence shown in SEQ ID NO: 26 or a degenerate sequence thereof.

[0144] In certain embodiments, the donor DNA further comprises a nucleotide sequence selected from one or more of SEQ ID NOs: 27-39 or a degenerate sequence thereof.

[0145] In certain embodiments, the introduced DNA comprises a combination of:

[0146] 1) SEQ ID NO: 26;

[0147] 2) SEQ ID NO: 26 and SEQ ID NO: 27;

[0148] 3) SEQ ID NO: 26, SEQ ID NO: 27 and SEQ ID NO: 28;

[0149] 4) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28 and SEQ ID NO: 29;

[0150] 5) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29 and SEQ ID NO: 30;

[0151] 6) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30 and SEQ ID NO: 31;

[0152] 7) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31 and SEQ ID NO: 32;

[0153] 8) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32 and SEQ ID NO: 39;

[0154] 9) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31 and SEQ ID NO: 33;

[0155] 10) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29,

[0156] SEQ ID NO: 30, SEQ ID NO: 31 and SEQ ID NO: 34;

[0157] 11) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29,

[0158] SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32 and SEQ ID NO: 35;

[0159] 12) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29,

[0160] SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32 and SEQ ID NO: 36;

[0161] 13) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29,

[0162] SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32 and SEQ ID NO: 37;

[0163] 14) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29,

[0164] SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32 and SEQ ID NO:38.

[0165] In certain embodiments, the method further comprises recovering the resistance gene or tag gene contained in the sequence shown in any one of SEQ ID NOs: 26-39 from the recombinant Yarrowia spp.

[0166] In certain embodiments, the recombinant Yarrowia robur is a recombinant Yarrowia lipolytica.

[0167] In certain embodiments, the starting strain is selected from Yarrowia lipolytica Po1f, Po1d, Po1e, Po1g and Po1h; preferably, the starting strain is Po1f.

[0168] The advantages of the present invention over the prior art are:

[0169] The present invention obtains a recombinant Yarrowia lipolytica with the ability to produce high β-carotene by transferring β-carotene synthesis-related genes into a starting strain of Yarrowia lipolytica polf; further, the relevant genes are introduced on the basis of the recombinant Yarrowia lipolytica with high β-carotene production to successfully realize the efficient conversion of β-carotene into zeaxanthin.

[0170] The present invention also significantly improves the yield of zeaxanthin produced by Yarrowia lipolytica by introducing CrtZ from different sources, CrtZ with different codon optimization schemes, fusing CrtZ to an endoplasmic reticulum targeting sequence to locate CrtZ on the endoplasmic reticulum (ER) membrane, and fusing CrtZ with other proteins related to lipid biological metabolism. BRIEF DESCRIPTION OF THE DRAWINGS

[0171] Figure 1 The AP18860 plasmid map is shown.

[0172] Figure 2 The DNA6336 plasmid map is shown.

[0173] Figure 3Shown is a comparison of the β-carotene production abilities of strains BOTA01025, BOTA01027, and BOTA01017.

[0174] Figure 4 Shown is a comparison of zeaxanthin production by strains BOTA01017, BOTA01017 and BOTA01021.

[0175] Figure 5 Shown is a comparison of zeaxanthin production among strains BOTA01021, BOTA01019 and BOTA01001.

[0176] Figure 6 Shown is a comparison of zeaxanthin production by strains BOTA01021, BOTA01020, BOTA01022, and BOTA01024.

[0177] Figure 7 Shown is a comparison of zeaxanthin production by strains BOTA01019, BOTA01026, BOTA01028, BOTA01029 and BOTA01030. DETAILED DESCRIPTION

[0178] The following definitions are provided to facilitate understanding of the present invention by those skilled in the art. Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those of ordinary skill in the art to which the present invention belongs. Preferred materials and methods are described herein, but any methods and materials similar to or equivalent to those described herein may be used in the practice of the present invention's tests. It should also be understood that the terms used herein are only for the purpose of describing specific embodiments and are not intended to be limiting.

[0179] Definition of terms

[0180] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0181] In order to more readily understand the present disclosure, certain terms are first defined below.

[0182] As used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0183] As used herein, the terms "comprising," "having," "including," and "containing" should be construed as open-ended terms (ie, meaning "including, but not limited to, ").

[0184] In this article, "and / or" refers to and includes any and all possible combinations of one or more items in the associated listed items. For example, a composition comprising A and / or B can be interpreted as a composition comprising A, a composition comprising B, or a composition comprising A and B.

[0185] All numerical designations, such as pH, temperature, time, concentration, and molecular weight, including ranges, are approximate and are appropriately varied in increments of 1.0 or 0.1, or are optionally varied (+) or (-) by + / - 15%, 10%, 5%, 2%. It should be understood that all numerical designations are preceded by the term "about". It should also be understood that the agents described herein are exemplary only and that equivalents thereof are known in the art. When referring to measurable values ​​such as amounts or concentrations, the term "about" as used herein is meant to include variations within 20%, 10%, 5%, 1%, 0.5%, or 0.1% of the specified amount.

[0186] In this article, the term "first" or "second" is added before "β-carotene hydroxylase" for descriptive purposes only, and does not limit the order or priority in any way, nor does it limit the specific type and number of β-carotene hydroxylase. The "first β-carotene hydroxylase" and the "second β-carotene hydroxylase" can be the same or different. For example, the "first β-carotene hydroxylase" and the "second β-carotene hydroxylase" can be CrtZ_9GAMM and CrtZ_SACS2, respectively, or CrtZ_SACS2 and CrtZ_9GAMM, respectively. The "first β-carotene hydroxylase" and the "second β-carotene hydroxylase" can also be both CrtZ_9GAMM or both CrtZ_SACS2. When the "first β-carotene hydroxylase" and the "second β-carotene hydroxylase" are the same, the genes encoding the "first β-carotene hydroxylase" and the "second β-carotene hydroxylase" can be the same or different. Furthermore, the genes encoding the "first β-carotene hydroxylase" and the genes encoding the "second β-carotene hydroxylase" may be introduced simultaneously or sequentially.

[0187] As used herein, the term "zeaxanthin", also known as "zeaxanthin", "zeaxanthin", is a fat-soluble pigment component of lutein and a dihydroxy derivative of β-carotene. Zeaxanthin is abundantly present in plant tissues such as green vegetables, corn seeds, wolfberries and Physalis fruits, and in some non-photosynthetic bacteria.

[0188] As used herein, the term "Yarrowia lipolytica", Latin name Yarrowia lipolytica, is a non-conventional yeast belonging to the class Hemiascomycetes. Yarrowia lipolytica is widely used in the production of food additives. The application of Yarrowia lipolytica in the biosynthesis of natural products includes the fermentation production of fatty acids and lipids, terpenoids, flavonoids and other active products such as succinic acid, pyruvic acid, α-ketoglutaric acid, adipic acid, erythritol, cordycepin, etc.

[0189] As used herein, the terms "nucleic acid", "nucleic acid molecule", "nucleic acid sequence", "nucleotide sequence" and "polynucleotide" are used interchangeably and refer to a polymeric form of nucleotides (ribonucleotides or deoxyribonucleotides) of any length. Thus, the term includes, but is not limited to, single-stranded or double-stranded DNA or RNA, genomic DNA, cDNA, DNA / RNA hybrids, or polymers comprising, consisting of, or consisting essentially of purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural or derived nucleotide bases.

[0190] As used herein, the terms "protein", "peptide", "polypeptide" and "amino acid sequence" are used interchangeably and in their broadest sense refer to a polymeric form of two or more amino acid subunits, amino acid analogs or peptide mimetics. "Protein", "peptide", "polypeptide" and "amino acid sequence" contain at least two amino acids, and there is no limit on the maximum number of amino acids. The term "amino acid" as used herein refers to natural and / or non-natural or synthetic amino acids, including D and L optical isomers and amino acid analogs.

[0191] Compared with the protein or amino acid sequence described herein, equivalents with one or more amino acid modifications are also included in the scope of the present invention, provided that the one or more amino acid modifications do not affect or substantially do not affect the activity of the protein or amino acid sequence. In this article, the amino acid modification can be an amino acid substitution, an amino acid deletion or an amino acid insertion. Amino acid substitutions can be conservative amino acid substitutions or non-conservative amino acid substitutions. Conservative substitutions (also known as conservative mutations, conservative substitutions or conservative variations) are amino acid substitutions in proteins that change a given amino acid to a different amino acid with similar biochemical properties (e.g., charge, hydrophobicity or size). In this article, "conservative substitutions" refer to amino acid residues that are replaced by another biologically similar residue. Examples of conservative substitutions include one hydrophobic residue such as isoleucine, valine, leucine or methionine replacing another; or one charged or polar residue replacing another, such as arginine replacing lysine, glutamic acid replacing aspartic acid, glutamine replacing asparagine, etc. Other illustrative examples of conservative substitutions include the following changes: alanine to serine; asparagine to glutamine or histidine; aspartic acid to glutamic acid; cysteine ​​to serine; glycine to proline; histidine to asparagine or glutamine; lysine to arginine, glutamine or glutamic acid; phenylalanine to tyrosine, serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine, and the like.

[0192] In this article, the term "expression" refers to the process by which a nucleic acid sequence is transcribed into mRNA and / or the process by which the transcribed mRNA is subsequently translated into a peptide, polypeptide, amino acid sequence or protein. If the nucleic acid sequence is from genomic DNA, expression may include splicing mRNA in a eukaryotic cell.

[0193] When the term "encoding" is applied to a nucleic acid sequence, it means that if it can be transcribed to produce mRNA and / or translated to produce a polypeptide in its native state or when manipulated by methods well known to those skilled in the art, it is said to be a nucleic acid sequence that "encodes" a polypeptide. Therefore, a "coding sequence" is a nucleic acid sequence that has the above functions, which can be DNA or RNA (e.g., mRNA).

[0194] Herein, "coding gene" includes "coding sequence" and may optionally include other nucleotide sequence elements for regulating gene expression, such as promoter and terminator, etc. In the "coding gene", the coding sequence and other nucleotide sequence elements are arranged in a suitable order to promote the correct expression of the encoded protein.

[0195] "Homology" or "identity" refers to the sequence similarity between two polypeptides or between two nucleic acid sequences. The percent identity can be determined by comparing the positions in each sequence, which can be aligned for the purpose of comparison. When a position in the compared sequences is occupied by the same base or amino acid, then the molecules are identical at that position. The degree of identity between sequences depends on the number of shared matching positions. Tools for comparing similarity between sequences are well known to those skilled in the art, for example, by importing a nucleic acid or amino acid sequence into ClustalW (available from https: / / genome.jp / toolsbin / clustalw / ) and using ClustalW, the alignment and percent sequence identity of the nucleic acid or amino acid sequences provided herein can be obtained.

[0196] In this article, the terms "homolog" and "homologous protein" can be used interchangeably, referring to a reference protein having a higher sequence identity in an amino acid sequence or coding sequence, and having a higher similarity in function, such as being able to achieve the same function, such as being able to catalyze the same reaction process. "Homologous protein" includes a protein having at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with a reference protein. Alternatively, "homologous protein" includes a protein encoded by a polynucleotide having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity with the coding sequence of the reference protein.

[0197] A "non-homologous protein" or "unrelated protein" has less than 40% identity, less than 30% identity or less than 25% identity with the amino acid sequence or coding sequence of the reference protein of the present invention.

[0198] As used herein, the term "promoter" refers to an expression control sequence that controls the initiation and efficiency of transcription of a gene or transgene. Promoters can be, for example, constitutive, inducible, repressible, or tissue-specific. Promoters can contain genetic elements to which regulatory proteins and molecules such as RNA polymerase and transcription factors can bind. Promoters used herein include pTEFin (SEQ ID NO: 68), pGPD (SEQ ID NO: 69), and 8UASEXP (SEQ ID NO: 70).

[0199] In this article, the term "terminator" is a DNA sequence that gives RNA polymerase a transcription termination signal. Terminators can be divided into two categories, one of which can achieve termination without relying on protein cofactors. The other category relies on protein cofactors to achieve termination. This protein cofactor is called a termination factor, also commonly known as a ρ factor. The two types of terminators have common sequence characteristics. There is a palindromic sequence before the transcription termination point. The two repeated parts of the palindromic sequence (each 7 to 20 bp) are separated by several non-repeating bp segments. The symmetry axis of the palindromic sequence is generally 16 to 24 bp away from the transcription termination point. The terminators used in this article include the endogenous terminators Txpr2 and Tlip2 commonly used in Yarrowia lipolytica.

[0200] As used herein, the term "recombination" refers to the process of re-covalent combination of genetic information within or between DNA molecules. When applied to specific microorganisms, such as the Yarrowia lipolytica described in the present invention, the term "recombination" refers to the use of artificial intervention to allow the Yarrowia lipolytica to have certain different characteristics compared to the starting strain, such as improved zeaxanthin production capacity. Those skilled in the art will understand that "engineered microorganisms" are not limited to strains modified by genetic engineering means, and strains containing gene disruptions described in the present invention obtained by means such as UV mutagenesis or chemical mutagenesis should also be included in the scope of the "engineered microorganisms" described in the present invention.

[0201] In this article, the term "non-homologous end joining (NHEJ)" refers to the repair of double-stranded DNA by binding to the ends of double-stranded DNA breaks through a protein complex and recruiting the corresponding ATP-dependent DNA ligase. Compared with homologous recombination (HR), NHEJ does not require a homologous DNA repair template and does not rely on DNA replication. NHEJ is an important mechanism of genetic recombination in microorganisms, especially in Yarrowia lipolytica.

[0202] In this article, the term "Gibson assembly" refers to a recombination-based molecular cloning method for the in vitro assembly of DNA fragments. The core principle of Gibson assembly relies on three enzymes: DNA exonuclease, high-fidelity DNA polymerase, and thermostable DNA ligase. First, T5 exonuclease digests the DNA fragments in the chain direction from 5' to 3', and each DNA fragment forms a single-stranded protrusion. Since a part of these adjacent protruding fragments has homology, they can anneal complementary. Then, high-fidelity DNA polymerase fills the gaps in the annealed fragments, and thermostable DNA ligase finally seals the gaps in the assembled DNA to generate a double-stranded completely sealed DNA molecule.

[0203] In this article, the term "resistance gene" is a gene that can confer resistance to a specific antibiotic on a cell. In genetic engineering, resistance genes are often used to screen successfully transfected / transformed cells to ensure that the target gene is successfully introduced into the cell. The expression product of the resistance gene is usually an enzyme that can make the cell resistant to the corresponding antibiotic, thereby surviving in a selective culture medium containing the antibiotic. The resistance gene used herein is a hygromycin encoding gene. Hygromycin is often used to screen prokaryotic or eukaryotic cells that have been successfully transfected / transformed with a hygromycin resistance gene. The phosphotransferase encoded by the hygromycin resistance gene (hyg or hph) can phosphorylate hygromycin, making it inactive, thereby playing a detoxifying role. Based on this mechanism, hygromycin can be used to screen cells that have been successfully transfected with a hygromycin resistance gene.

[0204] In this article, the term "screening gene" refers to a specific gene used to screen transformed cells or transformants in genetic engineering. The expression product of the screening gene can give cells a certain phenotype, so that the transformed cells can grow in a culture medium containing a specific selection pressure, while untransformed cells cannot grow. The screening gene used in this article is the URA3 gene or the LEU2 gene. The URA3 gene is a gene on chromosome V of yeast that can encode orotidine 5-phosphate decarboxylase, which plays a key role in the synthesis of yeast RNA pyrimidine nucleotides. When orotidine 5-phosphate decarboxylase is inactivated, yeast cannot grow unless uridine or uracil is added to the culture medium. The URA3 gene is often used for positive selection: the URA3 gene is transformed into an auxotrophic strain, and these strains can grow; on the contrary, untransformed cells cannot grow. The LEU2 gene encodes isoleucine permease, which is involved in the transport and metabolism of isoleucine. In genetic engineering, the LEU2 gene is often used for negative selection: by adding leucine analogs to the culture medium, only cells transformed with the LEU2 gene can grow, while untransformed cells cannot survive. DETAILED DESCRIPTION OF THE INVENTION

[0206] Recombinant Yarrowia lipolytica

[0207] The present invention provides a recombinant Yarrowia lipolytica, which comprises, based on a starting strain, introduced genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP) and geranylgeranyl diphosphate synthase (CrtE).

[0208] In certain embodiments, the copy number of the gene encoding phytoene dehydrogenase introduced is 2, 3, 4 or 5; preferably, the genes of different copy numbers are the same or different; preferably, the copy number is 2; preferably, the genes of different copy numbers are the same.

[0209] In certain embodiments, the recombinant Yarrowia lipolytica can be used for the production of β-carotene.

[0210] In certain embodiments, the function of the phytoene dehydrogenase is to convert phytoene into lycopene via intermediates such as phytofluene, zeta-carotene and neurosporene by introducing four double bonds.

[0211] In certain embodiments, the source of the phytoene dehydrogenase includes, but is not limited to, Mucor circinelloides, Xanthophyllomyces dendrorhous, Pantoea ananatis, and Streptomyces avermitilis.

[0212] In certain embodiments, the phytoene dehydrogenase comprises the amino acid sequence shown in SEQ ID NO: 1 or the amino acid sequence of a homologous protein of SEQ ID NO: 1, or an amino acid sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identity with SEQ ID NO: 1 and retains the function of phytoene dehydrogenase.

[0213] In certain embodiments, the gene encoding phytoene dehydrogenase comprises the nucleotide sequence shown in SEQ ID NO: 13 or a degenerate sequence thereof, or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 13.

[0214] In certain embodiments, the lycopene cyclase / phytoene synthase functions to catalyze two reactions:

[0215] (1) Bicyclization reaction, converting lycopene into β-carotene;

[0216] (2) Two molecules of geranylgeranyl diphosphate (GGPP) condense to form phytoene.

[0217] In certain embodiments, part or all of the catalytic function of the lycopene cyclase / phytoene synthase is derived from microorganisms including but not limited to Mucor circinelloides, Pantoea agglomerans, Pseudomonas fulva, Streptomyces avermitilis, Pantoea ananatis, Xanthophyllomyces dendrorhous and Blakeslea trispora.

[0218] In certain embodiments, the lycopene cyclase / phytoene synthase comprises the amino acid sequence shown in SEQ ID NO: 2 or the amino acid sequence of a homologous protein of SEQ ID NO: 2, or an amino acid sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 2 and retains the function of lycopene cyclase / phytoene synthase.

[0219] In certain embodiments, the gene encoding lycopene cyclase / phytoene synthase comprises the nucleotide sequence shown in SEQ ID NO: 14 or a degenerate sequence thereof, or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 14.

[0220] In certain embodiments, the function of the geranylgeranyl diphosphate synthase is to catalyze the condensation reaction of farnesyl diphosphate (FPP) and isopentenyl diphosphate (IPP) to generate geranylgeranyl diphosphate (GGPP).

[0221] In certain embodiments, the source of the geranylgeranyl diphosphate synthase includes but is not limited to Xanthophyllomyces dendrorhous, Synechococcus sp, Haematococcus pluvialis, Streptomyces avermitilis, Sulfolobus acidocaldarius and Pantoea agglomerans.

[0222] In certain embodiments, the geranylgeranyl diphosphate synthase comprises the amino acid sequence shown in SEQ ID NO:3 or the amino acid sequence of a homologous protein of SEQ ID NO:3, or an amino acid sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:3 and retains the function of geranylgeranyl diphosphate synthase.

[0223] In certain embodiments, the gene encoding geranylgeranyl diphosphate synthase comprises the nucleotide sequence shown in SEQ ID NO: 15 or a degenerate sequence thereof, or a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 15.

[0224] In certain embodiments, the recombinant Yarrowia lipolytica further comprises an introduced gene encoding diacylglycerol acyltransferase (DGA1) and / or 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) or a truncation thereof (tHMGR).

[0225] In certain embodiments, further introduction of DGA1, HMGR and / or tHMGR confers the recombinant Yarrowia lipolytica with improved β-carotene production performance.

[0226] In certain embodiments, the diacylglycerol acyltransferase functions to catalyze the conversion of diacylglycerol and acyl-CoA into triglycerides.

[0227] In certain embodiments, the source of the diacylglycerol acyltransferase includes, but is not limited to, Yarrowia lipolytica, Pichia pastoris, Aspergillus niger, Streptomyces lividans, Saccharomyces cerevisiae, and Rhodosporidium toruloides.

[0228] In certain embodiments, the diacylglycerol acyltransferase comprises the amino acid sequence shown in SEQ ID NO:4 or the amino acid sequence of a homologous protein of SEQ ID NO:4, or an amino acid sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:4 and retains the function of diacylglycerol acyltransferase.

[0229] In certain embodiments, the gene encoding diacylglycerol acyltransferase comprises the nucleotide sequence shown in SEQ ID NO: 16 or a degenerate sequence thereof, or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 16.

[0230] In certain embodiments, the 3-hydroxy-3-methylglutaryl coenzyme A reductase or a truncate thereof converts 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) into mevalonate.

[0231] In certain embodiments, the source of the 3-hydroxy-3-methylglutaryl-CoA reductase or a truncate thereof includes, but is not limited to, Yarrowia lipolytica, Staphylococcus aureus, Streptococcus pneumoniae, B. petrii, Arabidopsis thaliana, Enterococcus faecalis, Methanosarcina mazei and Saccharomyces cerevisiae.

[0232] In certain embodiments, the 3-hydroxy-3-methylglutaryl-CoA reductase or a truncate thereof comprises the amino acid sequence shown in SEQ ID NO:5 or the amino acid sequence of a homologous protein of SEQ ID NO:5, or an amino acid sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:5 and retains the function of 3-hydroxy-3-methylglutaryl-CoA reductase.

[0233] In certain embodiments, the gene encoding 3-hydroxy-3-methylglutaryl-CoA reductase or a truncation thereof comprises the nucleotide sequence shown in SEQ ID NO: 17 or a degenerate sequence thereof or a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 17.

[0234] In certain embodiments, the recombinant Yarrowia lipolytica further comprises an introduced gene encoding a first β-carotene hydroxylase, CrtZ;

[0235] In certain embodiments, further introduction of CrtZ confers the ability to produce zeaxanthin to the recombinant Yarrowia lipolytica.

[0236] In certain embodiments, the first β-carotene hydroxylase catalyzes the hydroxylation reaction of β-carotene to produce zeaxanthin.

[0237] In certain embodiments, the source of the first β-carotene hydroxylase includes, but is not limited to, Pantoea stewartii, Saccharolobus solfataricus, Gentianalutea, Flavobacterium sp., Niastella koreensis, Gossypium raimondii, Chondromyces apiculatus, Spirulina sp., Chondromyces crocatus, Pantoea ananatis, Phaseolus vulgaris, Dunaliella salina, Crocus sativus, Zea mays, Ornithocercus magnificus, Cucurbita moschata, Tagetes erecta), Pseudescherichia vulneris, Paracoccus zeaxanthinifaciens, Massilia forsythiae, Herrania umbratica, Euhalothece natronophila.

[0238] In certain embodiments, the first β-carotene hydroxylase is β-carotene hydroxylase CrtZ_9GAMM from Pantoeastewartii.

[0239] In certain embodiments, the β-carotene hydroxylase CrtZ_9GAMM comprises the amino acid sequence shown in SEQ ID NO: 6 or the amino acid sequence of a homologous protein of SEQ ID NO: 6, or an amino acid sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 6 and maintains the function of β-carotene hydroxylase.

[0240] In certain embodiments, the gene encoding β-carotene hydroxylase CrtZ_9GAMM comprises the nucleotide sequence shown in SEQ ID NO: 18 or a degenerate sequence thereof or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 18.

[0241] In certain embodiments, the recombinant Yarrowia lipolytica further comprises an introduced gene encoding mevalonate-5-pyrophosphate decarboxylase (ERG19).

[0242] In certain embodiments, the gene encoding mevalonate-5-pyrophosphate decarboxylase (ERG19) is introduced simultaneously with another copy of the gene encoding geranylgeranyl diphosphate synthase (CrtE).

[0243] In certain embodiments, the further introduction of the gene encoding mevalonate-5-pyrophosphate decarboxylase (ERG19) or the simultaneous introduction of the gene encoding mevalonate-5-pyrophosphate decarboxylase (ERG19) and another copy of the gene encoding geranylgeranyl diphosphate synthase (CrtE) confers the recombinant Yarrowia lipolytica with the property of increased zeaxanthin production.

[0244] In certain embodiments, the mevalonate 5-pyrophosphate decarboxylase converts mevalonate 5-diphosphate (MVAPP) into isopentenyl diphosphate (IPP) via an ATP-dependent decarboxylation reaction.

[0245] In certain embodiments, the source of the mevalonate-5-pyrophosphate decarboxylase includes, but is not limited to, Yarrowia lipolytica, Staphylococcus aureus, Streptococcus pneumoniae, B. petrii, Arabidopsis thaliana, Enterococcus faecalis, Methanosarcina mazei, and Saccharomyces cerevisiae.

[0246] In certain embodiments, the mevalonate-5-pyrophosphate decarboxylase comprises the amino acid sequence shown in SEQ ID NO: 7 or the amino acid sequence of a homologous protein of SEQ ID NO: 7, or an amino acid sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 7 and retains the function of mevalonate-5-pyrophosphate decarboxylase.

[0247] In certain embodiments, the gene encoding mevalonate-5-pyrophosphate decarboxylase comprises the nucleotide sequence shown in SEQ ID NO: 19 or a degenerate sequence thereof, or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 19.

[0248] In certain embodiments, the recombinant Yarrowia lipolytica further comprises an introduced gene encoding a second β-carotene hydroxylase CrtZ.

[0249] In certain embodiments, the first β-carotene hydroxylase CrtZ and the second β-carotene hydroxylase CrtZ are of different microbial origin.

[0250] In certain embodiments, the introduction of a gene encoding a second β-carotene hydroxylase, CrtZ, confers further enhanced zeaxanthin production performance to the recombinant Yarrowia lipolytica.

[0251] In certain embodiments, the source of the second β-carotene hydroxylase includes but is not limited to Saccharolobus solfataricus, Pantoea stewartii, Gentianalutea, Flavobacterium sp., Niastella koreensis, Gossypium raimondii, Chondromyces apiculatus, Spirulina sp., Chondromyces crocatus, Pantoea ananatis, Phaseolus vulgaris, Dunaliella salina, Crocus sativus, Zea mays, Ornithocercus magnificus, Cucurbita moschata, Tagetes erecta, Pseudescherichia woundii, Paracoccus zeaxanthinifaciens, Massilia forsythiae, Herrania umbratica and Euhalothece natronophila.

[0252] In certain embodiments, the second β-carotene hydroxylase is β-carotene hydroxylase CrtZ_SACS2 derived from Saccharolobus solfataricus.

[0253] In certain embodiments, the function of the β-carotene hydroxylase CrtZ_SACS2 is to catalyze the hydroxylation reaction of β-carotene to produce zeaxanthin.

[0254] In some embodiments, the β-carotene hydroxylase CrtZ_SACS2 comprises the amino acid sequence shown in SEQ ID NO: 8 or the amino acid sequence of a homologous protein of SEQ ID NO: 8, or an amino acid sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 8 and maintains the function of β-carotene hydroxylase.

[0255] In certain embodiments, the gene encoding β-carotene hydroxylase CrtZ_SACS2 comprises the nucleotide sequence shown in SEQ ID NO: 20 or 21, or a degenerate sequence thereof, or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identity with SEQ ID NO: 20 or 21. Preferably, the Yarrowia lipolytica comprises the nucleotide sequence shown in SEQ ID NO: 20 and 21, or a degenerate sequence thereof, or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identity with SEQ ID NO: 20 or 21.

[0256] In certain embodiments, any one of SEQ ID NO: 20 or 21 is introduced.

[0257] In certain embodiments, SEQ ID NOs: 20 and 21 are introduced simultaneously.

[0258] In certain embodiments, the recombinant Yarrowia lipolytica further comprises an introduced gene encoding a β-carotene hydroxylase-endoplasmic reticulum targeting sequence fusion protein.

[0259] In certain embodiments, the ER targeting sequence can effectively promote the conversion of β-carotene to zeaxanthin by targeting CrtZ to the ER for expression.

[0260] In certain embodiments, the further introduction of the gene encoding the β-carotene hydroxylase-endoplasmic reticulum targeting sequence fusion protein increases the conversion rate of β-carotene to zeaxanthin, thereby increasing the yield of zeaxanthin.

[0261] In certain embodiments, the endoplasmic reticulum targeting sequence is KDEL.

[0262] In certain embodiments, the β-carotene hydroxylase is β-carotene hydroxylase CrtZ_9GAMM from Pantoea stearii or β-carotene hydroxylase CrtZ_SACS2 from Saccharolobus solfataricus.

[0263] In certain embodiments, the β-carotene hydroxylase CrtZ_9GAMM comprises the amino acid sequence shown in SEQ ID NO: 6 or the amino acid sequence of a homologous protein of SEQ ID NO: 6, or an amino acid sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 6 and maintains the function of β-carotene hydroxylase.

[0264] In certain embodiments, the gene encoding β-carotene hydroxylase CrtZ_9GAMM comprises the nucleotide sequence shown in SEQ ID NO: 18 or a degenerate sequence thereof or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 18.

[0265] In some embodiments, the β-carotene hydroxylase CrtZ_SACS2 comprises the amino acid sequence shown in SEQ ID NO: 8 or the amino acid sequence of a homologous protein of SEQ ID NO: 8, or an amino acid sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 8 and maintains the function of β-carotene hydroxylase.

[0266] In certain embodiments, the gene encoding β-carotene hydroxylase CrtZ_SACS2 comprises the nucleotide sequence shown in SEQ ID NO: 20 or 21, or a degenerate sequence thereof, or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identity with SEQ ID NO: 20 or 21. Preferably, the Yarrowia lipolytica comprises the nucleotide sequence shown in SEQ ID NO: 20 and 21, or a degenerate sequence thereof, or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identity with SEQ ID NO: 20 or 21.

[0267] In certain embodiments, the recombinant Yarrowia lipolytica further comprises an introduced fusion gene encoding a fusion protein of β-carotene hydroxylase and a protein related to lipid metabolism; the fusion gene comprises a gene encoding β-carotene hydroxylase and a gene encoding a protein related to lipid metabolism.

[0268] In certain embodiments, fusing β-carotene hydroxylase to a protein related to lipid metabolism can effectively localize CrtZ into liposomes to promote the conversion of β-carotene stored in liposomes into zeaxanthin.

[0269] In certain embodiments, the fusion gene encoding the fusion protein of β-carotene hydroxylase and a protein related to lipid metabolism is further introduced to increase the conversion rate of β-carotene to zeaxanthin, thereby increasing the yield of zeaxanthin.

[0270] In certain embodiments, the β-carotene hydroxylase is β-carotene hydroxylase CrtZ_9GAMM from Pantoea stearii or β-carotene hydroxylase CrtZ_SACS2 from Saccharolobus solfataricus.

[0271] In certain embodiments, the β-carotene hydroxylase CrtZ_9GAMM comprises the amino acid sequence shown in SEQ ID NO: 6 or the amino acid sequence of a homologous protein of SEQ ID NO: 6, or an amino acid sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 6 and maintains the function of β-carotene hydroxylase.

[0272] In certain embodiments, the gene encoding β-carotene hydroxylase CrtZ_9GAMM comprises the nucleotide sequence shown in SEQ ID NO: 18 or a degenerate sequence thereof or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 18.

[0273] In some embodiments, the β-carotene hydroxylase CrtZ_SACS2 comprises the amino acid sequence shown in SEQ ID NO: 8 or the amino acid sequence of a homologous protein of SEQ ID NO: 8, or an amino acid sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 8 and maintains the function of β-carotene hydroxylase.

[0274] In certain embodiments, the gene encoding β-carotene hydroxylase CrtZ_SACS2 comprises the nucleotide sequence shown in SEQ ID NO: 20 or 21, or a degenerate sequence thereof, or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identity with SEQ ID NO: 20 or 21. Preferably, the Yarrowia lipolytica comprises the nucleotide sequence shown in SEQ ID NO: 20 and 21, or a degenerate sequence thereof, or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identity with SEQ ID NO: 20 or 21.

[0275] In certain embodiments, the lipid metabolism-related proteins include one or more of sterol methyltransferase (ERG6), 1-acylglycerol-3-phosphate-O-acyltransferase (SLC1), phospholipid acyltransferase (LOA1) and sterol ester hydrolase (TGL1).

[0276] In some embodiments, the function of the sterol methyltransferase is to catalyze the methyl transfer reaction from S-adenosylmethionine (SAM) to the C-24 position of zymosterol to produce fecosterol.

[0277] In certain embodiments, the source of the sterol methyltransferase includes, but is not limited to, Yarrowia lipolytica and Saccharomyces cerevisiae.

[0278] In certain embodiments, the sterol methyltransferase comprises the amino acid sequence shown in SEQ ID NO:9 or the amino acid sequence of a homologous protein of SEQ ID NO:9, or an amino acid sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:9 and retains the function of sterol methyltransferase.

[0279] In certain embodiments, the gene encoding sterol methyltransferase comprises the nucleotide sequence shown in SEQ ID NO: 22 or a degenerate sequence thereof, or a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 22.

[0280] In certain embodiments, the 1-acylglycerol-3-phosphate-O-acyltransferase functions to catalyze the acylation reaction of lysophosphatidic acid.

[0281] In certain embodiments, the source of the 1-acylglycerol-3-phosphate-O-acyltransferase includes, but is not limited to, Yarrowia lipolytica and Saccharomyces cerevisiae.

[0282] In certain embodiments, the 1-acylglycerol-3-phosphate-O-acyltransferase comprises the amino acid sequence shown in SEQ ID NO: 10, or the amino acid sequence of a homologous protein of SEQ ID NO: 10, or an amino acid sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 10 and retains the function of 1-acylglycerol-3-phosphate-O-acyltransferase.

[0283] In certain embodiments, the gene encoding 1-acylglycerol-3-phosphate-O-acyltransferase comprises the nucleotide sequence shown in SEQ ID NO: 23 or a degenerate sequence thereof, or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 23.

[0284] In certain embodiments, the phospholipid acyltransferase functions to catalyze the acylation reaction of lysophosphatidic acid.

[0285] In certain embodiments, the sources of the phospholipid acyltransferase include, but are not limited to, Yarrowia lipolytica and Saccharomyces cerevisiae.

[0286] In certain embodiments, the phospholipid acyltransferase comprises the amino acid sequence shown in SEQ ID NO: 11 or the amino acid sequence of a homologous protein of SEQ ID NO: 11, or an amino acid sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 11 and retains the function of a phospholipid acyltransferase.

[0287] In certain embodiments, the gene encoding phospholipid acyltransferase comprises the nucleotide sequence shown in SEQ ID NO: 24 or a degenerate sequence thereof, or a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 24.

[0288] In certain embodiments, the sterol ester hydrolase functions to break down triglycerides into glycerol and fatty acids.

[0289] In certain embodiments, the sources of the sterol ester hydrolase include, but are not limited to, Yarrowia lipolytica and Saccharomyces cerevisiae.

[0290] In certain embodiments, the sterol ester hydrolase comprises the amino acid sequence shown in SEQ ID NO: 12 or the amino acid sequence of a homologous protein of SEQ ID NO: 12, or an amino acid sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 12 and retains the function of sterol ester hydrolase.

[0291] In certain embodiments, the gene encoding sterol ester hydrolase comprises the nucleotide sequence shown in SEQ ID NO: 25 or a degenerate sequence thereof, or a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 25.

[0292] In certain embodiments, the β-carotene hydroxylase is linked to the lipid synthesis-related protein via a flexible linker.

[0293] In certain embodiments, the flexible linker is a GS linker; preferably, the flexible linker comprises the amino acid sequence shown in SEQ ID NO: 65 or SEQ ID NO: 66.

[0294] In certain embodiments, the number of introduced copies of the gene encoding the same enzyme is 1-5; preferably 1 or 2; more preferably, the gene sequences of different copies are the same or different.

[0295] In certain embodiments, the genes introduced into the recombinant Yarrowia lipolytica comprise the following combination:

[0296] 1) Genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), and geranylgeranyl diphosphate synthase (CrtE);

[0297] 2) genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgeranyl diphosphate synthase (CrtE), and diacylglycerol acyltransferase (DGA1);

[0298] 3) genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgeranyl diphosphate synthase (CrtE), diacylglycerol acyltransferase (DGA1), and 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) or their truncations (tHMGR);

[0299] 4) genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgeranyl diphosphate synthase (CrtE), diacylglycerol acyltransferase (DGA1), 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) or its truncation (tHMGR), and β-carotene hydroxylase CrtZ_9GAMM;

[0300] 5) genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgeranyl diphosphate synthase (CrtE), diacylglycerol acyltransferase (DGA1), 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) or its truncation (tHMGR), β-carotene hydroxylase CrtZ_9GAMM, and mevalonate-5-pyrophosphate decarboxylase (ERG19);

[0301] 6) genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgeranyl diphosphate synthase (CrtE), diacylglycerol acyltransferase (DGA1), 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) or its truncation (tHMGR), β-carotene hydroxylase CrtZ_9GAMM and mevalonate-5-pyrophosphate decarboxylase (ERG19), and β-carotene hydroxylase CrtZ_SACS2;

[0302] 7) genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgeranyl diphosphate synthase (CrtE), diacylglycerol acyltransferase (DGA1), 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) or its truncation (tHMGR), β-carotene hydroxylase CrtZ_9GAMM, mevalonate-5-pyrophosphate decarboxylase (ERG19), and β-carotene hydroxylase CrtZ_SACS2-KDEL fusion protein;

[0303] 8) genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgeranyl diphosphate synthase (CrtE), diacylglycerol acyltransferase (DGA1), 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) or its truncation (tHMGR), β-carotene hydroxylase CrtZ_9GAMM, mevalonate-5-pyrophosphate decarboxylase (ERG19), and β-carotene hydroxylase crtZ_9GAM-KDEL fusion protein;

[0304] 9) genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgeranyl diphosphate synthase (CrtE), diacylglycerol acyltransferase (DGA1), 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) or its truncation (tHMGR), β-carotene hydroxylase CrtZ_9GAMM, mevalonate-5-pyrophosphate decarboxylase (ERG19), β-carotene hydroxylase CrtZ_SACS2, and β-carotene hydroxylase CrtZ_SACS2-ERG6 fusion protein;

[0305] 10) genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgeranyl diphosphate synthase (CrtE), diacylglycerol acyltransferase (DGA1), 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) or its truncation (tHMGR), β-carotene hydroxylase CrtZ_9GAMM, mevalonate-5-pyrophosphate decarboxylase (ERG19), β-carotene hydroxylase CrtZ_SACS2, and β-carotene hydroxylase CrtZ_SACS2-SLC1 fusion protein;

[0306] 11) genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgeranyl diphosphate synthase (CrtE), diacylglycerol acyltransferase (DGA1), 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) or its truncation (tHMGR), β-carotene hydroxylase CrtZ_9GAMM, mevalonate-5-pyrophosphate decarboxylase (ERG19), β-carotene hydroxylase CrtZ_SACS2, and β-carotene hydroxylase CrtZ_SACS2-LOA1 fusion protein;

[0307] 12) Genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgeranyl diphosphate synthase (CrtE), diacylglycerol acyltransferase (DGA1), 3-hydroxy-3-methylglutaryl-CoA reductase truncated (HMGR) or its shortened form (tHMGR), β-carotene hydroxylase CrtZ_9GAMM, mevalonate-5-pyrophosphate decarboxylase (ERG19), β-carotene hydroxylase CrtZ_SACS2, and β-carotene hydroxylase CrtZ_SACS2 and TGL1 fusion protein.

[0308] In certain embodiments, the phytoene dehydrogenase comprises the amino acid sequence shown in SEQ ID NO: 1 or the amino acid sequence of a homologous protein of SEQ ID NO: 1, or an amino acid sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identity with SEQ ID NO: 1 and retains the function of phytoene dehydrogenase.

[0309] In certain embodiments, the gene encoding phytoene dehydrogenase comprises the nucleotide sequence shown in SEQ ID NO: 13 or a degenerate sequence thereof, or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 13.

[0310] In certain embodiments, the lycopene cyclase / phytoene synthase comprises the amino acid sequence shown in SEQ ID NO: 2 or the amino acid sequence of a homologous protein of SEQ ID NO: 2, or an amino acid sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 2 and retains the function of lycopene cyclase / phytoene synthase.

[0311] In certain embodiments, the gene encoding lycopene cyclase / phytoene synthase comprises the nucleotide sequence shown in SEQ ID NO: 14 or a degenerate sequence thereof, or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 14.

[0312] In certain embodiments, the geranylgeranyl diphosphate synthase comprises the amino acid sequence shown in SEQ ID NO:3 or the amino acid sequence of a homologous protein of SEQ ID NO:3, or an amino acid sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:3 and retains the function of geranylgeranyl diphosphate synthase.

[0313] In certain embodiments, the gene encoding geranylgeranyl diphosphate synthase comprises the nucleotide sequence shown in SEQ ID NO: 15 or a degenerate sequence thereof, or a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 15.

[0314] In certain embodiments, the diacylglycerol acyltransferase comprises the amino acid sequence shown in SEQ ID NO:4 or the amino acid sequence of a homologous protein of SEQ ID NO:4, or an amino acid sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:4 and retains the function of diacylglycerol acyltransferase.

[0315] In certain embodiments, the gene encoding diacylglycerol acyltransferase comprises the nucleotide sequence shown in SEQ ID NO: 16 or a degenerate sequence thereof, or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 16.

[0316] In certain embodiments, the 3-hydroxy-3-methylglutaryl-CoA reductase truncate comprises the amino acid sequence shown in SEQ ID NO: 5 or the amino acid sequence of a homologous protein of SEQ ID NO: 5, or an amino acid sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 5 and retains the function of 3-hydroxy-3-methylglutaryl-CoA reductase.

[0317] In certain embodiments, the gene encoding the 3-hydroxy-3-methylglutaryl-CoA reductase truncation comprises the nucleotide sequence shown in SEQ ID NO: 17 or a degenerate sequence thereof, or a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 17.

[0318] In certain embodiments, the β-carotene hydroxylase CrtZ_9GAMM comprises the amino acid sequence shown in SEQ ID NO: 6 or the amino acid sequence of a homologous protein of SEQ ID NO: 6, or an amino acid sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 6 and maintains the function of β-carotene hydroxylase.

[0319] In certain embodiments, the gene encoding β-carotene hydroxylase CrtZ_9GAMM comprises the nucleotide sequence shown in SEQ ID NO: 18 or a degenerate sequence thereof or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 18.

[0320] In certain embodiments, the mevalonate-5-pyrophosphate decarboxylase comprises the amino acid sequence shown in SEQ ID NO: 7 or the amino acid sequence of a homologous protein of SEQ ID NO: 7, or an amino acid sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 7 and retains the function of mevalonate-5-pyrophosphate decarboxylase.

[0321] In certain embodiments, the gene encoding mevalonate-5-pyrophosphate decarboxylase comprises the nucleotide sequence shown in SEQ ID NO: 19 or a degenerate sequence thereof, or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 19.

[0322] In some embodiments, the β-carotene hydroxylase CrtZ_SACS2 comprises the amino acid sequence shown in SEQ ID NO: 8 or the amino acid sequence of a homologous protein of SEQ ID NO: 8, or an amino acid sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 8 and maintains the function of β-carotene hydroxylase.

[0323] In certain embodiments, the gene encoding β-carotene hydroxylase CrtZ_SACS2 comprises the nucleotide sequence shown in SEQ ID NO: 20 or 21, or a degenerate sequence thereof, or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identity with SEQ ID NO: 20 or 21. Preferably, the Yarrowia lipolytica comprises the nucleotide sequence shown in SEQ ID NO: 20 and 21, or a degenerate sequence thereof, or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identity with SEQ ID NO: 20 or 21.

[0324] In certain embodiments, the sterol methyltransferase comprises the amino acid sequence shown in SEQ ID NO:9 or the amino acid sequence of a homologous protein of SEQ ID NO:9, or an amino acid sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO:9 and retains the function of sterol methyltransferase.

[0325] In certain embodiments, the gene encoding sterol methyltransferase comprises the nucleotide sequence shown in SEQ ID NO: 22 or a degenerate sequence thereof, or a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 22.

[0326] In certain embodiments, the 1-acylglycerol-3-phosphate-O-acyltransferase comprises the amino acid sequence shown in SEQ ID NO: 10, or the amino acid sequence of a homologous protein of SEQ ID NO: 10, or an amino acid sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 10 and retains the function of 1-acylglycerol-3-phosphate-O-acyltransferase.

[0327] In certain embodiments, the gene encoding 1-acylglycerol-3-phosphate-O-acyltransferase comprises the nucleotide sequence shown in SEQ ID NO: 23 or a degenerate sequence thereof, or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 23.

[0328] In certain embodiments, the phospholipid acyltransferase comprises the amino acid sequence shown in SEQ ID NO: 11 or the amino acid sequence of a homologous protein of SEQ ID NO: 11, or an amino acid sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 11 and retains the function of a phospholipid acyltransferase.

[0329] In certain embodiments, the gene encoding phospholipid acyltransferase comprises the nucleotide sequence shown in SEQ ID NO: 24 or a degenerate sequence thereof, or a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 24.

[0330] In certain embodiments, the sterol ester hydrolase comprises the amino acid sequence shown in SEQ ID NO: 12 or the amino acid sequence of a homologous protein of SEQ ID NO: 12, or an amino acid sequence that has at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 12 and retains the function of sterol ester hydrolase.

[0331] In certain embodiments, the gene encoding sterol ester hydrolase comprises the nucleotide sequence shown in SEQ ID NO: 25 or a degenerate sequence thereof, or a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 25.

[0332] In certain embodiments, in the combinations 1) to 12), the copy number of the gene encoding CarB is 2.

[0333] In certain embodiments, in the combinations 4) to 12), the copy number of the gene encoding CrtE is 2.

[0334] In certain embodiments, in the combination 6), the gene encoding CrtZ_SACS2 comprises two copies; the two copies respectively comprise the nucleotide sequence shown in SEQ ID NO: 20 or 21 or a degenerate sequence thereof.

[0335] In certain embodiments, the starting strain of the recombinant Yarrowia lipolytica is Yarrowia lipolytica Po1f.

[0336] In certain embodiments, the introduction is carried out by integrating a donor DNA comprising a target gene and a gene selected from a resistance gene and a selection gene into the Yarrowia lipolytica genome through non-homologous end joining (NHEJ).

[0337] In certain embodiments, the resistance gene comprises a hygromycin gene.

[0338] In certain embodiments, the screening gene comprises the URA3 gene or the LEU2 gene.

[0339] In certain embodiments, the resistance gene or tag gene in the donor DNA comprises the same two LoxP sites (Lox71 and Lox66) in the front and back directions.

[0340] In certain embodiments, after the donor DNA is integrated into the Yarrowia lipolytica genome, the resistance gene or selection gene is recovered by transferring a Cre enzyme expression plasmid.

[0341] In certain embodiments, the promoters used in the expression cassette of the target gene include pTEFin, pGPD and 8UASEXP.

[0342] In certain embodiments, the terminators used in the expression cassette of the target gene are Txpr2 and Tlip2.

[0343] In certain embodiments, the DNA introduced into the recombinant Yarrowia lipolytica comprises the following combination:

[0344] 1) SEQ ID NO: 26;

[0345] 2) SEQ ID NO: 26 and SEQ ID NO: 27;

[0346] 3) SEQ ID NO: 26, SEQ ID NO: 27 and SEQ ID NO: 28;

[0347] 4) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, and SEQ ID NO: 29;

[0348] 5) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30;

[0349] 6) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31;

[0350] 7) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32; 8) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 39;

[0351] 9) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 33;

[0352] 10) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 34;

[0353] 11) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 35;

[0354] 12) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 36;

[0355] 13) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32 and SEQ ID NO: 37;

[0356] 14) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32 and SEQ ID NO: 38. In certain embodiments, the recombinant Yarrowia lipolytica of the present invention is shown in Table 1 below.

[0357]

[0358] The synthetic pathway for producing zeaxanthin from carotene of the present invention exists in nature and is widely described in the literature (https: / / doi.org / 10.1016 / j.tifs.2017.11.006).

[0359] Method for producing recombinant Yarrowia lipolytica

[0360] The present invention provides a method for producing recombinant Yarrowia lipolytica, wherein genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP) and geranylgeranyl diphosphate synthase (CrtE) are introduced into a starting strain.

[0361] In certain embodiments, one or more of the following genes are further introduced: a gene encoding diacylglycerol acyltransferase (DGA1), a gene encoding 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) or a truncate thereof (tHMGR), a gene encoding β-carotene hydroxylase, a gene encoding a fusion protein of β-carotene hydroxylase and an endoplasmic reticulum targeting sequence, a gene encoding a fusion protein of β-carotene hydroxylase and a lipid metabolism-related protein, a gene encoding mevalonate-5-pyrophosphate decarboxylase (ERG19); preferably, the gene encoding β-carotene hydroxylase includes a gene encoding β-carotene hydroxylase CrtZ_9GAMM, a gene encoding β-carotene hydroxylase CrtZ_S ACS2; preferably, the gene encoding the fusion protein of β-carotene hydroxylase and endoplasmic reticulum targeting sequence includes a gene encoding β-carotene hydroxylase CrtZ_9GAMM-endoplasmic reticulum targeting sequence fusion protein, and a gene encoding β-carotene hydroxylase CrtZ_SACS2-endoplasmic reticulum targeting sequence fusion protein; preferably, the gene encoding the fusion protein of β-carotene hydroxylase and lipid metabolism-related protein includes a gene encoding β-carotene hydroxylase CrtZ_SACS2-ERG6 fusion protein, a gene encoding β-carotene hydroxylase CrtZ_SACS2-LOA1 fusion protein, and a gene encoding β-carotene hydroxylase CrtZ_SACS2-TGL1 fusion protein. The β-carotene hydroxylase CrtZ_9GAMM is a β-carotene hydroxylase from Pantoea stewartii, and the β-carotene hydroxylase CrtZ_SACS2 is a β-carotene hydroxylase from Saccharolobus solfataricus.

[0362] In certain embodiments, the starting strain is Yarrowia lipolytica Po1f.

[0363] In certain embodiments, the number of introduced copies of the gene encoding the same enzyme is 1-5; preferably 1 or 2; more preferably, the gene sequences of different copies are the same or different.

[0364] In certain embodiments, the phytoene dehydrogenase comprises the amino acid sequence shown in SEQ ID NO: 1, or the amino acid sequence of a homologous protein of SEQ ID NO: 1, or an amino acid sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 1 and retains the function of phytoene dehydrogenase; the gene encoding the phytoene dehydrogenase comprises the nucleotide sequence shown in SEQ ID NO: 13, or a degenerate sequence thereof, or a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 13.

[0365] In certain embodiments, the lycopene cyclase / phytoene synthase comprises the amino acid sequence shown in SEQ ID NO:2, or the amino acid sequence of a homologous protein of SEQ ID NO:2, or an amino acid sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO:2 and retains the function of lycopene cyclase / phytoene synthase; the gene encoding the lycopene cyclase / phytoene synthase comprises the nucleotide sequence shown in SEQ ID NO:14, or a degenerate sequence thereof, or a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO:14.

[0366] In certain embodiments, the geranylgeranyl diphosphate synthase comprises the amino acid sequence shown in SEQ ID NO:3 or the amino acid sequence of a homologous protein of SEQ ID NO:3, or an amino acid sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:3 and retains the function of geranylgeranyl diphosphate synthase; the gene encoding geranylgeranyl diphosphate synthase comprises the nucleotide sequence shown in SEQ ID NO:15 or its degenerate sequence, or a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:15.

[0367] In certain embodiments, the diacylglycerol acyltransferase comprises the amino acid sequence shown in SEQ ID NO:4, or the amino acid sequence of a homologous protein of SEQ ID NO:4, or an amino acid sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4 and retains the function of diacylglycerol acyltransferase; the gene encoding the diacylglycerol acyltransferase comprises the nucleotide sequence shown in SEQ ID NO:16, or a degenerate sequence thereof, or a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:16.

[0368] In certain embodiments, the 3-hydroxy-3-methylglutaryl-CoA reductase or a truncation thereof comprises the amino acid sequence shown in SEQ ID NO:5, or the amino acid sequence of a homologous protein of SEQ ID NO:5, or an amino acid sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:5 and retains the function of 3-hydroxy-3-methylglutaryl-CoA reductase; the gene encoding the 3-hydroxy-3-methylglutaryl-CoA reductase or a truncation thereof comprises the nucleotide sequence shown in SEQ ID NO:17, or a degenerate sequence thereof, or a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:17.

[0369] In certain embodiments, the β-carotene hydroxylase CrtZ_9GAMM comprises the amino acid sequence shown in SEQ ID NO:6 or the amino acid sequence of a homologous protein of SEQ ID NO:6 or an amino acid sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO:6 and retains the function of β-carotene hydroxylase; the gene encoding the β-carotene hydroxylase CrtZ_9GAMM comprises the nucleotide sequence shown in SEQ ID NO:18 or its degenerate sequence or a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO:18.

[0370] In certain embodiments, the mevalonate-5-pyrophosphate decarboxylase comprises the amino acid sequence shown in SEQ ID NO:7 or the amino acid sequence of a homologous protein of SEQ ID NO:7 or an amino acid sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO:7 and retains the function of mevalonate-5-pyrophosphate decarboxylase; the gene encoding mevalonate-5-pyrophosphate decarboxylase comprises the nucleotide sequence shown in SEQ ID NO:19 or a degenerate sequence thereof or a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO:19.

[0371] In certain embodiments, the β-carotene hydroxylase CrtZ_SACS2 comprises the amino acid sequence shown in SEQ ID NO: 8 or the amino acid sequence of a homologous protein of SEQ ID NO: 8 or an amino acid sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identity with SEQ ID NO: 8 and maintaining the function of β-carotene hydroxylase; the gene encoding β-carotene hydroxylase CrtZ_SACS2 comprises the nucleotide sequence shown in SEQ ID NO: 20 or 21 or a degenerate sequence thereof or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identity with SEQ ID NO: 20 or 21. Preferably, the Yarrowia lipolytica comprises the nucleotide sequence shown in SEQ ID NO: 20 and 21 or a degenerate sequence thereof or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identity with SEQ ID NO: 20 or 21.

[0372] In certain embodiments, the sterol methyltransferase comprises the amino acid sequence shown in SEQ ID NO:9 or the amino acid sequence of a homologous protein of SEQ ID NO:9, or an amino acid sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:9 and retains the function of sterol methyltransferase; the gene encoding the sterol methyltransferase comprises the nucleotide sequence shown in SEQ ID NO:22 or a degenerate sequence thereof, or a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:22.

[0373] In certain embodiments, the 1-acylglycerol-3-phosphate-O-acyltransferase comprises the amino acid sequence of SEQ ID NO: 10, or the amino acid sequence of a homologous protein of SEQ ID NO: 10, or an amino acid sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 10 and retains the function of 1-acylglycerol-3-phosphate-O-acyltransferase; the gene encoding the 1-acylglycerol-3-phosphate-O-acyltransferase comprises the nucleotide sequence of SEQ ID NO: 23, or a degenerate sequence thereof, or a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 23.

[0374] In certain embodiments, the phospholipid acyltransferase comprises the amino acid sequence shown in SEQ ID NO: 11, or the amino acid sequence of a homologous protein of SEQ ID NO: 11, or an amino acid sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 11 and retains the function of phospholipid acyltransferase; the gene encoding the phospholipid acyltransferase comprises the nucleotide sequence shown in SEQ ID NO: 24, or a degenerate sequence thereof, or a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 24.

[0375] In certain embodiments, the sterol ester hydrolase comprises the amino acid sequence shown in SEQ ID NO: 12 or the amino acid sequence of a homologous protein of SEQ ID NO: 12, or an amino acid sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 12 and retains the function of sterol ester hydrolase; the gene encoding the sterol ester hydrolase comprises the nucleotide sequence shown in SEQ ID NO: 25 or a degenerate sequence thereof, or a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 25.

[0376] In certain embodiments, the introduction method is non-homologous end joining (NHEJ) integration of donor DNA.

[0377] In certain embodiments, the donor DNA comprises the nucleotide sequence shown in SEQ ID NO: 26 or a degenerate sequence thereof, or a nucleotide sequence that is at least 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 26.

[0378] In certain embodiments, the donor DNA further comprises one or more selected from SEQ ID NOs: 27-39.

[0379] In certain embodiments, the donor DNA is obtained by amplifying a linear donor DNA template plasmid.

[0380] In certain embodiments, the donor DNA template plasmid uses pUC57 as a vector backbone, and uses the Gibson method to insert a resistance gene expression cassette or a selection gene expression cassette that can work in Yarrowia lipolytica and a target gene expression cassette that is expected to be integrated into the Yarrowia lipolytica genome.

[0381] In certain embodiments, the resistance gene comprises the hygromycin gene.

[0382] In certain embodiments, the screening gene comprises the URA3 gene or the LEU2 gene.

[0383] In certain embodiments, cloning and DNA amplification of the donor DNA template plasmid is performed by E. coli DH5α.

[0384] In certain embodiments, Lox71 and Lox66 sequences are introduced before and after the resistance gene or selection gene expression frame, respectively, so that the resistance gene or selection gene can be recovered by transferring the Cre enzyme expression plasmid after the linear DNA is integrated into the genome.

[0385] In certain embodiments, the method for recovery of resistance or tag genes used in the present invention is the Cre-LoxP recombination system.

[0386] Example

[0387] The present invention will be more readily understood with reference to the following examples, which are included only to illustrate certain aspects and embodiments of the present invention and are not intended to limit the present invention.

[0388] Unless otherwise stated, the reagents used in this example are all commercially available materials or conventional materials.

[0389] Example 1 Materials and Methods

[0390] 1.1 Starting strain

[0391] In the present embodiment, Yarrowia lipolytica Po1f was used as the starting strain, which was purchased from ATCC and numbered MAY-2613, and the genotype was MATA ura3-302leu2-270xpr-322axp2-deltaNU49XPR2::SUC2.

[0392] 1.2 Culture medium formulation

[0393] Escherichia coli culture medium: LB-Amp culture medium, the formula is: peptone 10g, yeast extract 5g, NaCl 10g, deionized water 1L, add 100mg / L ampicillin (Amp) after sterilization; if it is a solid culture medium, add 2% (20g / L) agar powder.

[0394] Yarrowia lipolytica culture medium YPD: yeast extract 10 g / L, peptone 20 g / L, glucose 20 g / L; if it is a solid culture medium, 2% (20 g / L) agar powder should be added additionally.

[0395] Yarrowia lipolytica medium YPD-Hph: 500 mg / L hygromycin (Hph) was added to the sterile YPD medium.

[0396] Yarrowia lipolytica medium YPD-Nat: 1 g / L nourseothricin was added to the sterilized YPD medium.

[0397] Yarrowia lipolytica culture medium SCD-Ura: yeast inorganic nitrogen source 1.7g / L, ammonium sulfate 5g / L, DOSuplement-Leu / -Trp / -Ura 0.62g / L, 0.1g / L L-leucine (Leu), 0.05g / L L-tryptophan (Trp), glucose 20g / L. If it is a solid culture medium, it is necessary to add 2% (20g / L) agar powder.

[0398] Yarrowia lipolytica culture medium SCD-Leu: yeast inorganic nitrogen source 1.7g / L, ammonium sulfate 5g / L, DOSuplement-Leu / -Trp / -Ura 0.62g / L, 0.02g / L uracil (Ura), 0.05g / L L-tryptophan (Trp), glucose 20g / L. If it is a solid culture medium, it is necessary to add 2% (20g / L) agar powder.

[0399] Yarrowia lipolytica medium BSM: 8 g / L potassium dihydrogen phosphate, 7.5 g / L ammonium sulfate, 6.15 g / L magnesium sulfate heptahydrate, 3.4 g / L urea, 3 ml BSM vitamins, 5 ml BSM metal elements, by adding NaOH or H 2 SO 4Adjust the pH to 5.5. The BSM vitamin formula is: biotin 0.2g / L, potassium p-aminobenzoate 0.8g / L, vitamin B3 4g / L, inositol 10g / L, vitamin B1 4g / L, vitamin B6 4g / L, calcium pantothenate 4g / L. The BSM metal element formula is: 0.5M oxalic acid tetraacetic acid 160ml / L, zinc sulfate heptahydrate 11.5g / L, copper sulfate 0.64g / L, manganese chloride tetrahydrate 0.64g / L, cobalt chloride hexahydrate 0.94g / L, sodium molybdate dihydrate 0.96g / L, ferrous sulfate heptahydrate 5.6g / L, calcium chloride dihydrate 5.6g / L.

[0400] 1.3 Genetic information

[0401] Table 2

[0402]

[0403]

[0404] 1.3 Donor DNA construction method

[0405] The construction of donor DNA includes the following steps

[0406] 1) Construct a donor DNA template plasmid. Using pUC57 as the vector backbone, insert a resistance gene expression cassette or a screening gene expression cassette that can work in Yarrowia lipolytica (resistance genes include hygromycin gene hygromycin, screening genes include URA3 gene or LEU2 gene) and a target gene expression cassette that is expected to be integrated into the Yarrowia lipolytica genome using the Gibson method, and perform plasmid cloning and DNA amplification using Escherichia coli DH5α. The culture medium used is the Escherichia coli culture medium described in 1.2. The Gibson construction method is specifically as follows: first, amplify the backbone and the fragment to be inserted by the PCR method, and use primers to design the interface of the two DNA fragments to be connected to have a 30-40bp homology region; then, these donor DNA fragments and the Gibson Master Mix (NEB) was mixed and incubated at 50℃ for 60 minutes. T5 exonucleolysis will produce single-stranded 3' protruding ends, prompting the complementary terminal repeat sequences (overlapping regions) to anneal. Phusion polymerase will fill the gaps of the annealed fragments, and Taq DNA ligase can connect at the assembled DNA cuts. Finally, the incubated mixture was transferred into Escherichia coli to amplify the plasmid DNA. Lox71 and Lox66 sequences were introduced before and after the resistance gene or screening gene expression frame, respectively, so that the resistance gene or screening gene can be recovered by transferring the Cre enzyme expression plasmid after the linear DNA is integrated into the genome. The promoters used in the target gene expression frame include pTEFin, pGPD and 8UASEXP. The terminators used in the target gene expression frame are Txpr2 and Tlip2.

[0407] 2) Using the donor DNA template plasmid as a template, amplify the DNA fragment including the resistance gene or screening gene expression frame and the target gene expression frame by PCR (primers are shown in Table 4). The PCR reaction system for amplifying the donor DNA fragment is: 50 μL reaction system contains 25 μL Q5 DNA polymerase mix, 2.5 μL upstream primer and downstream primer, 1 μL template and ddH 2 O 19 μL. The PCR cycle program was pre-denaturation at 98°C for 2 min, denaturation at 98°C for 10 s, annealing at 55°C for 10 s, extension at 72°C for 30 s / kb, 31 cycles; extension at 72°C for 3 min, and storage at 4°C.

[0408] 3) The PCR product is purified by magnetic bead method, and the purified donor DNA can be directly transformed into Yarrowia lipolytica to achieve genome integration.

[0409] The donor DNA information in the present invention is shown in Table 3.

[0410] Table 3 Donor DNA information

[0411]

[0412] All the DNAs in Table 3 are linear donor DNAs except DNA6336, which is a suicide plasmid that cannot replicate in yarrowia.

[0413] The primers used for amplification of the above linear donor DNA are shown in Table 4.

[0414] Table 4 Linear donor DNA amplification primers

[0415] Primer name SEQ ID NO Primer sequences hph_AF 40 aagtaccagctcccctcacttacc LIP_R 41 ccattcgatcgcatgctggtttc ADD_LEUF 42 aacaaccgattccaacaggttaccgt GSY_R 43 ctacgtttgcctcacatcgaactact ADD_R1 44 tcgcatctcgatgagctggc 18211-F 45 accgattccaaccagtgactttg 18211-R 46 gggacacaaatacgccgccaacccggtctgtatccacgacaaaaacatttgtc 17881_F 47 accagacaaatgtttttgtcgtggatacagaccgggttggcggcgtatttg 17881_R 48 attccaagttgctgcttgatggg

[0416] The integration information of the linear donor DNA in the genome is shown in Table 5.

[0417] Table 5

[0418]

[0419] 1.4 Recovery of resistance or tag genes

[0420] The method for recovering the resistance or label gene used in the present invention adopts the Cre-LoxP recombination system. After the recombinase plasmid (AP18860) driven by pTEFin to express Cre is transferred into Yarrowia lipolytica (coated on YPD-Nat plate after transformation), the Cre recombinase can recognize two LoxP sites (Lox 71 and Lox66) with the same front and back directions of the resistance or label gene, thereby mediating the knockout of the gene between the two LoxP sites, and Lox71 and Lox66 will be retained on the genome as Lox72 sequence after recombination. The AP18860 plasmid contains the pBR322 sequence and kanamycin resistance marker for replication in Escherichia coli, as well as the ORI1001 sequence and nourseothricin (Nat, nourseothricin) resistance marker for replication in Yarrowia lipolytica. The plasmid map is shown in Figure 1 shown.

[0421] 1.5 96-well plate fermentation method

[0422] 1) After yeast transformation, the transformants were inoculated into a 96-deep-well plate containing YPD medium and cultured in a shaker at 30°C and 800 rpm for 1 day.

[0423] 2) The obtained culture solution was subcultured into a new 96-deep-well plate containing fresh YPD or BSM medium and cultured in a shaker at 30°C and 800 rpm for 3 days.

[0424] 1.6 Extraction and detection methods of β-carotene and zeaxanthin in fermentation products

[0425] Take 20ul of bacterial solution, add 750μl of extraction solution (dimethyl sulfoxide: ethyl acetate: methanol = 1: 0.5: 1), shake at 2000rpm for 20 minutes, ultrasonic at 25℃ for 10 minutes, shake at 30℃ at 1500rpm for 60 minutes, then centrifuge at 25℃ at 4000rpm for 20 minutes, and take the supernatant for ultra-high performance liquid chromatography detection. The detection conditions are as follows:

[0426] 1) Chromatographic column: CHIRALPAK AD-H LC column 4.6mm*250 5μm;

[0427] 2) Mobile phase: A1: isopropanol B1: n-hexane;

[0428] 3) Injection volume: 2.5ul;

[0429] 4) Seal wash: 10% isopropyl alcohol;

[0430] 5) Needle wash: methanol: ethyl acetate = 1:1;

[0431] 6) Column temperature: 30°C;

[0432] 7) Flow rate: 0.7 ml / min;

[0433] 8) Gradient elution

[0434] The conditions are shown in Table 1;

[0435] Table 1: Gradient elution conditions

[0436] Time / min A / ％ B / ％ Flow rate / (ml / min) 0 5.5 94.5 0.7 10 5.5 94.5 0.7 40 15 85 0.7 41 5.5 94.5 0.7 45 5.5 94.5 0.7

[0437] 9) Running time: 45 minutes;

[0438] 10) Wavelength: 452nm.

[0439] By comparing the peak areas of zeaxanthin and β-carotene in the test object in liquid chromatography with the peak areas of the standard, the concentration can be calculated, which is expressed in mg / L in this patent.

[0440] Relative zeaxanthin titer calculation: average zeaxanthin concentration of target strain / average zeaxanthin concentration of starting strain. In this article, concentration and titer refer to the mass of the target substance per unit volume. In this article, the starting strain refers to the chassis strain that demonstrates the technical solution.

[0441] Calculation of zeaxanthin percentage (zeaxanthin%): (zeaxanthin concentration) / (zeaxanthin concentration+β-carotene concentration)×100%.

[0442] Example 2 Construction of β-carotene producing strain

[0443] The wild-type strain Po1f (ATCC number MAY-2613) was used as the starting strain, and the plasmid DNA6336 expressing the complete β-carotene pathway genes (CarB / CarRP / CrtE) was transferred to obtain the β-carotene production starting strain BOTA01023. The DNA6336 plasmid map is shown in Figure 2 DNA6336 is a circular plasmid with only the pBR322 sequence for replication in E. coli. After sequencing the whole genome of BOTA01023, it was found that the plasmid was successfully integrated into the site Locus 1 500bp upstream and downstream.

[0444] Subsequently, based on the BOTA01023 strain, the CarB gene expression was introduced into the genome. The linear donor DNA ADD5278 carrying the CarB gene was transformed into the strain BOTA01023 to obtain the strain BOTA01025. Among them, ADD5278 was amplified by the SOE (Gene splicing by overlap extension, overlap extension PCR technology, https: / / doi.org / 10.1038 / nprot.2007.132) method. First, the LEU2 expression cassette was amplified using primers 18211-F and 18211-R, and then the CarB expression cassette was amplified using primers 17881-F and 17881-R. Subsequently, the two fragments were overlapped and spliced ​​using primers 18211-F and 17881-R using these two fragments as templates. After verification by whole genome sequencing, the integration site of the linear donor DNA ADD5278 was Locus 2.

[0445] Subsequently, based on the BOTA01025 strain, the DGA1 gene expression was introduced into the genome. First, the above-mentioned tag gene recovery method was used to obtain a tag gene recovery strain, and then the linear donor DNA ADD6303 with the DGA1 gene was transformed into the strain BOTA01025 to overexpress DGA1 to obtain the strain BOTA01027. The amplification primers of ADD6306 are ADD_LEUF and GSY_R. After verification by whole genome sequencing, the integration site of the linear donor DNA ADD6306 is Locus 3.

[0446] Subsequently, based on the BOTA01027 strain, tHMGR gene expression was introduced into the genome. First, the above-mentioned tag gene recovery method was used to obtain a tag gene recovery strain, and then the linear donor DNA ADD5976 was transformed into the strain BOTA01027 to overexpress tHMGR to obtain the strain BOTA01017. The amplification primers of ADD5976 are ADD_LEUF and GSY_R. After verification by whole genome sequencing, the integration site of the linear donor DNA ADD5976 was Locus 4, and two copies of tHMGR (ADD5976) were found to be integrated at the Locus 4 site, which was caused by the NHEJ integration method adopted.

[0447] The strains BOTA01025, BOTA01027 and BOTA01017 were tested by 96-well plate fermentation method, and the β-carotene production was increased to 21 mg / L, 108 mg / L and 214 mg / L, respectively. Figure 3 ).

[0448] Example 3 Construction of a Zeaxanthin-producing Strain

[0449] Using BOTA01017 as the base strain, CrtZ_9GAMM (transformation linear donor DNA ADD6957) was introduced into the genome to obtain strain BOTA01018, which successfully achieved the conversion of β-carotene to zeaxanthin with a yield of 107 mg / L ( Figure 4 ). The linear donor DNA ADD6957 PCR amplification primers were hph_AF and LIP_R. After verification by whole genome sequencing, the genomic insertion site of ADD6975 was Locus 5.

[0450] In BOTA01018, after obtaining a strain with recovered tagged genes using the above-mentioned tag gene recovery method, CrtE and ERG19 were simultaneously overexpressed in the genome (converted linear donor DNA ADD7684) to obtain strain BOTA01021. The strain was tested using a 96-well plate fermentation method, and the yield of zeaxanthin was further increased to 210 mg / L. Compared with BOTA01018, the yield of zeaxanthin was increased by 96% ( Figure 4 ). The amplification primers for the linear donor DNA ADD7684 are ADD_LEUF and GSY_R. After verification by whole genome sequencing, the genomic insertion site of ADD7684 is Locus 6.

[0451] Example 4 Combining CrtZ from different sources to increase zeaxanthin yield

[0452] The inventors found that using the BOTA01021 strain as a chassis strain and continuing to integrate another copy number of CrtZ_SACS2 from a different source into the genome can increase the yield of zeaxanthin.

[0453] In BOTA01021, after obtaining a strain with recovered tag genes using the above-mentioned tag gene recovery method, the linear donor DNA ADD7670 with codon-optimized version 2 of CrtZ_SACS2 was transformed into BOTA01021 to obtain strain BOTA01019. The amplification primers of ADD7670 were ADD_LEUF and GSY_R. After verification by whole genome sequencing, the genomic insertion site of ADD7670 was Locus 7. The strain BOTA01019 was tested by 96-well plate fermentation method, and the yield of zeaxanthin was increased by 152% compared with BOTA01021 ( Figure 5 ).

[0454] In BOTA01019, after obtaining a strain with tag gene recovery using the above-mentioned tag gene recovery method, the linear donor DNA ADD9497 with codon-optimized version 1 of CrtZ_SACS2 was transformed into BOTA01019 to obtain strain BOTA01001. The amplification primers of ADD9497 are ADD_LEUF and GSY_R. After verification by whole genome sequencing, the genomic insertion site of ADD9497 is Locus 8. The strain BOTA01001 was tested using a 96-well plate fermentation method, and the yield of zeaxanthin was increased by 418% compared with BOTA01021 ( Figure 5 ).

[0455] Example 5 Overexpression of endoplasmic reticulum-targeted CrtZ to increase zeaxanthin production

[0456] β-carotene may be stored in the endoplasmic reticulum of Yarrowia lipolytica, so the conversion of β-carotene to zeaxanthin can be effectively promoted by targeting CrtZ expression to the endoplasmic reticulum.

[0457] Using BOTA01021 as the chassis strain, the endoplasmic reticulum target sequence (amino acid sequence KDEL, DNA sequence AAGGACGAGCTG, SEQ ID NO: 67) was added to the C-terminus of CrtZ to achieve CrtZ targeting to the endoplasmic reticulum.

[0458] In BOTA01021, after obtaining a strain with recovered tag genes using the above tag gene recovery method, the linear donor DNA ADD7773 of CrtZ_SACS2 with the endoplasmic reticulum target sequence was transformed into BOTA01021 to obtain strain BOTA01020, wherein the amplification primers of ADD7773 were ADD_LEUF and ADD_R1.

[0459] In BOTA01021, after obtaining a strain with recovered tag genes using the above tag gene recovery method, the linear donor DNA ADD7776 of crtZ_9GAMM with the endoplasmic reticulum target sequence was transformed into BOTA01021 to obtain strain BOTA01022. The amplification primers of ADD7776 are ADD_LEUF and GSY_R.

[0460] Using the 96-well plate fermentation method, the zeaxanthin production of strain BOTA01020 increased by 45% and that of strain BOTA01022 increased by 25% compared with that of BOTA01021. Figure 6 ).

[0461] Example 6 Fusion expression of CrtZ and lipid metabolism-related genes to increase zeaxanthin production

[0462] In order to effectively localize CrtZ into liposomes to promote the conversion of β-carotene stored in liposomes to zeaxanthin, CrtZ_SACS2 was fused with different genes related to lipid metabolism and the two genes were connected with a flexible linker (APGRY, SEQ ID NO: 65 or GGGGSGGPGS, SEQ ID NO: 66).

[0463] In BOTA01019, after obtaining a strain with recovered tagged genes using the above-mentioned tag gene recovery method, the linear donor DNA ADD9423 was transformed into BOTA01019 to obtain strain BOTA01026. This design contains CrtZ_SACS2 and ERG6 connected with the flexible linker sequence APGRY. The amplification primers of ADD9423 are ADD_LEUF and ADD_R1.

[0464] In BOTA01019, after obtaining a strain with recovered tagged genes using the above-mentioned tag gene recovery method, the linear donor DNA ADD9425 was transformed into BOTA01019 to obtain strain BOTA01028. This design contains CrtZ_SACS2 and SLC1 connected with the flexible linker sequence APGRY. The amplification primers of ADD9425 are ADD_LEUF and ADD_R1.

[0465] In BOTA01019, after obtaining a strain with recovered tag genes using the above-mentioned tag gene recovery method, the linear donor DNA ADD9411 was transformed into BOTA01019 to obtain strain BOTA01029. This design has CrtZ_SACS2 and LOA1 connected with a flexible linker sequence GGGGSGGPGS. The amplification primers of ADD9411 are ADD_LEUF and ADD_R1.

[0466] In BOTA01019, after obtaining a strain with recovered tagged genes using the above-mentioned tag gene recovery method, the linear donor DNA ADD9412 was transformed into BOTA01019 to obtain strain BOTA01030. This design contains CrtZ_SACS2 and TGL1 connected by the flexible linker sequence GGGGSGGPGS. The amplification primers of ADD9412 are ADD_LEUF and ADD_R1.

[0467] The results of the 96-well plate fermentation test showed that the fusion-expressed CrtZ can significantly increase the proportion of zeaxanthin in carotenoids. With BOTA01019 as the chassis, after overexpressing CrtZ fused with ERG6, BOTA01026 had a zeaxanthin proportion of 81%, an increase of 39% over BOTA01019. After overexpressing CrtZ fused with SLC1, BOTA01028 had a zeaxanthin proportion of 80%, an increase of 38% over BOTA01019. After overexpressing CrtZ fused with LOA1, BOTA01029 had a zeaxanthin proportion of 79%, an increase of 36% over BOTA01019. After overexpressing CrtZ fused with TGL1, BOTA01030 had a zeaxanthin proportion of 75%, an increase of 29% over BOTA01019.

Claims

1. A recombinant Yarrowia yeast, characterized in that The introduced genes include phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), and geranylgeranyl diphosphate synthase (CrtE).

2. The recombinant Yarrowia rosenbergii according to claim 1, wherein the phytoene dehydrogenase is derived from Mucor circinelloides; preferably, the phytoene dehydrogenase comprises the amino acid sequence shown in SEQ ID NO: 1; preferably, the gene encoding the phytoene dehydrogenase comprises the nucleotide sequence shown in SEQ ID NO: 13; preferably, the number of copies of the gene encoding the phytoene dehydrogenase introduced is 2, 3, 4 or 5; preferably, genes of different copy numbers are the same or different.

3. The recombinant Yarrowia rosenbergii according to claim 1 or 2, wherein the lycopene cyclase / phytoene synthase is from Mucor circinelloides; preferably, the lycopene cyclase / phytoene synthase comprises the amino acid sequence shown in SEQ ID NO: 2; preferably, the gene encoding the lycopene cyclase / phytoene synthase comprises the nucleotide sequence shown in SEQ ID NO:

14.

4. The recombinant Yarrowia rosenbergii according to any one of claims 1 to 3, wherein the geranylgeranyl diphosphate synthase is from Xanthophyllomyces dendrorhous; preferably, the geranylgeranyl diphosphate synthase comprises the amino acid sequence shown in SEQ ID NO: 3; preferably, the gene encoding the geranylgeranyl diphosphate synthase comprises the nucleotide sequence shown in SEQ ID NO: 15; preferably, the number of copies of the geranylgeranyl diphosphate synthase gene introduced is 2, 3, 4 or 5; preferably, genes of different copy numbers are the same or different.

5. The recombinant Yarrowia rosenbergii according to any one of claims 1 to 4, further comprising an introduced gene encoding a first β-carotene hydroxylase CrtZ; preferably, the first β-carotene hydroxylase is β-carotene hydroxylase CrtZ_9GAMM from Pantoeastewartii; preferably, the β-carotene hydroxylase CrtZ_9GAMM comprises the amino acid sequence shown in SEQ ID NO: 6; preferably, the gene encoding β-carotene hydroxylase CrtZ_9GAMM comprises the nucleotide sequence shown in SEQ ID NO:

18.

6. The recombinant Yarrowia rosenbergii according to any one of claims 1 to 5, further comprising an introduced gene encoding diacylglycerol acyltransferase (DGA1); preferably, the diacylglycerol acyltransferase is from Yarrowia lipolytica; preferably, the diacylglycerol acyltransferase comprises the amino acid sequence shown in SEQ ID NO: 4; preferably, the gene encoding diacylglycerol acyltransferase comprises the nucleotide sequence shown in SEQ ID NO:

16.

7. The recombinant Yarrowia according to any one of claims 1 to 6, further comprising an introduced gene encoding 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) or a truncation thereof (tHMGR); preferably, the 3-hydroxy-3-methylglutaryl-CoA reductase or a truncation thereof is from Yarrowia lipolytica; preferably, the 3-hydroxy-3-methylglutaryl-CoA reductase or a truncation thereof comprises the amino acid sequence shown in SEQ ID NO: 5; preferably, the gene encoding 3-hydroxy-3-methylglutaryl-CoA reductase or a truncation thereof comprises the nucleotide sequence shown in SEQ ID NO:

17.

8. The recombinant Yarrowia according to any one of claims 1 to 7, further comprising an introduced gene encoding mevalonate-5-pyrophosphate decarboxylase (ERG19); preferably, the mevalonate-5-pyrophosphate decarboxylase is from Yarrowia lipolytica; preferably, the mevalonate-5-pyrophosphate decarboxylase comprises the amino acid sequence shown in SEQ ID NO: 7; preferably, the gene encoding mevalonate-5-pyrophosphate decarboxylase comprises the nucleotide sequence shown in SEQ ID NO:

19.

9. The recombinant Yarrowia robur according to any one of claims 1 to 8, further comprising an introduced gene encoding a second β-carotene hydroxylase; preferably, the second β-carotene hydroxylase is β-carotene hydroxylase CrtZ_SACS2 from Saccharolobus solfataricus; preferably, the β-carotene hydroxylase CrtZ_SACS2 comprises the amino acid sequence shown in SEQ ID NO: 8; preferably, the gene encoding β-carotene hydroxylase CrtZ_SACS2 comprises the nucleotide sequence shown in SEQ ID NO: 20 or 21; preferably, the number of copies of the gene encoding β-carotene hydroxylase CrtZ_SACS2 introduced is 2, 3, 4 or 5; preferably, sequences of different copy numbers are the same or different; preferably, the Yarrowia lipolytica comprises the nucleotide sequences shown in SEQ ID NOs: 20 and 21 or their degenerate sequences.

10. The recombinant Yarrowia rosenbergii according to any one of claims 1 to 9, further comprising an introduced gene encoding a β-carotene hydroxylase-endoplasmic reticulum targeting sequence fusion protein; Preferably, the endoplasmic reticulum targeting sequence is KDEL; Preferably, the β-carotene hydroxylase is β-carotene hydroxylase CrtZ_9GAMM from Pantoea stewartii or β-carotene hydroxylase CrtZ_SACS2 from Saccharolobus solfataricus; Preferably, the β-carotene hydroxylase CrtZ_9GAMM comprises the amino acid sequence shown in SEQ ID NO: 6; preferably, the gene encoding the β-carotene hydroxylase CrtZ_9GAMM comprises the nucleotide sequence shown in SEQ ID NO: 18; Preferably, the β-carotene hydroxylase CrtZ_SACS2 comprises the amino acid sequence shown in SEQ ID NO: 8; preferably, the gene encoding the β-carotene hydroxylase CrtZ_SACS2 comprises the nucleotide sequence shown in SEQ ID NO: 20 or 21.

11. The recombinant Yarrowia rosenbergii according to any one of claims 1 to 10, further comprising an introduced fusion gene encoding a fusion protein of β-carotene hydroxylase and a protein related to lipid metabolism; the fusion gene comprises a gene encoding β-carotene hydroxylase and a gene encoding a protein related to lipid metabolism; Preferably, the β-carotene hydroxylase is β-carotene hydroxylase CrtZ_9GAMM from Pantoea stewartii or β-carotene hydroxylase CrtZ_SACS2 from Saccharolobus solfataricus; Preferably, the β-carotene hydroxylase CrtZ_9GAMM comprises the amino acid sequence shown in SEQ ID NO: 6; the gene encoding the β-carotene hydroxylase CrtZ_9GAMM comprises the nucleotide sequence shown in SEQ ID NO: 18; Preferably, the β-carotene hydroxylase CrtZ_SACS2 comprises the amino acid sequence shown in SEQ ID NO: 8; preferably, the gene encoding the β-carotene hydroxylase CrtZ_SACS2 comprises the nucleotide sequence shown in SEQ ID NO: 20 or 21; Preferably, the lipid metabolism-related proteins include one or more of sterol methyltransferase (ERG6), 1-acylglycerol-3-phosphate-O-acyltransferase (SLC1), phospholipid acyltransferase (LOA1) and sterol ester hydrolase (TGL1); Preferably, the sterol methyltransferase is from Yarrowia lipolytica; preferably, the sterol methyltransferase comprises the amino acid sequence shown in SEQ ID NO: 9; preferably, the gene encoding the sterol methyltransferase comprises the nucleotide sequence shown in SEQ ID NO: 22; Preferably, the 1-acylglycerol-3-phosphate-O-acyltransferase is from Yarrowia lipolytica; preferably, the 1-acylglycerol-3-phosphate-O-acyltransferase comprises the amino acid sequence shown in SEQ ID NO: 10; preferably, the gene encoding the 1-acylglycerol-3-phosphate-O-acyltransferase comprises the nucleotide sequence shown in SEQ ID NO: 23; Preferably, the phospholipid acyltransferase is from Yarrowia lipolytica; preferably, the phospholipid acyltransferase comprises the amino acid sequence shown in SEQ ID NO: 11; preferably, the gene encoding the phospholipid acyltransferase comprises the nucleotide sequence shown in SEQ ID NO: 24; Preferably, the sterol ester hydrolase is from Yarrowia lipolytica; preferably, the sterol ester hydrolase comprises the amino acid sequence shown in SEQ ID NO: 12; preferably, the gene encoding the sterol ester hydrolase comprises the nucleotide sequence shown in SEQ ID NO: 25; Preferably, the β-carotene hydroxylase is connected to the lipid metabolism-related protein via a flexible linker; Preferably, the flexible linker is a GS linker; preferably, the flexible linker comprises the amino acid sequence shown in SEQ ID NO: 65 or SEQ ID NO:

66.

12. The recombinant Yarrowia rosenbergii according to any one of claims 1 to 11, wherein the genes introduced therein comprise the following combination: 1) Genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), and geranylgeranyl diphosphate synthase (CrtE); 2) genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgeranyl diphosphate synthase (CrtE), and diacylglycerol acyltransferase (DGA1); 3) genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgeranyl diphosphate synthase (CrtE), diacylglycerol acyltransferase (DGA1), and 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) or their truncations (tHMGR); 4) genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgeranyl diphosphate synthase (CrtE), diacylglycerol acyltransferase (DGA1), 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) or its truncation (tHMGR), and β-carotene hydroxylase CrtZ_9GAMM; 5) genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgeranyl diphosphate synthase (CrtE), diacylglycerol acyltransferase (DGA1), 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) or its truncation (tHMGR), β-carotene hydroxylase CrtZ_9GAMM, and mevalonate-5-pyrophosphate decarboxylase (ERG19); 6) genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgeranyl diphosphate synthase (CrtE), diacylglycerol acyltransferase (DGA1), 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) or its truncation (tHMGR), β-carotene hydroxylase CrtZ_9GAMM and mevalonate-5-pyrophosphate decarboxylase (ERG19), and β-carotene hydroxylase CrtZ_SACS2; 7) genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgeranyl diphosphate synthase (CrtE), diacylglycerol acyltransferase (DGA1), 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) or its truncation (tHMGR), β-carotene hydroxylase CrtZ_9GAMM, mevalonate-5-pyrophosphate decarboxylase (ERG19), and β-carotene hydroxylase CrtZ_SACS2-KDEL fusion protein; 8) genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgeranyl diphosphate synthase (CrtE), diacylglycerol acyltransferase (DGA1), 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) or its truncation (tHMGR), β-carotene hydroxylase CrtZ_9GAMM, mevalonate-5-pyrophosphate decarboxylase (ERG19), and β-carotene hydroxylase crtZ_9GAM-KDEL fusion protein; 9) genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgeranyl diphosphate synthase (CrtE), diacylglycerol acyltransferase (DGA1), 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) or its truncation (tHMGR), β-carotene hydroxylase CrtZ_9GAMM, mevalonate-5-pyrophosphate decarboxylase (ERG19), β-carotene hydroxylase CrtZ_SACS2, and β-carotene hydroxylase CrtZ_SACS2-ERG6 fusion protein; 10) genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgeranyl diphosphate synthase (CrtE), diacylglycerol acyltransferase (DGA1), 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) or its truncation (tHMGR), β-carotene hydroxylase CrtZ_9GAMM, mevalonate-5-pyrophosphate decarboxylase (ERG19), β-carotene hydroxylase CrtZ_SACS2, and β-carotene hydroxylase CrtZ_SACS2-SLC1 fusion protein; 11) genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgeranyl diphosphate synthase (CrtE), diacylglycerol acyltransferase (DGA1), 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) or its truncation (tHMGR), β-carotene hydroxylase CrtZ_9GAMM, mevalonate-5-pyrophosphate decarboxylase (ERG19), β-carotene hydroxylase CrtZ_SACS2, and β-carotene hydroxylase CrtZ_SACS2-LOA1 fusion protein; 12) genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP), geranylgeranyl diphosphate synthase (CrtE), diacylglycerol acyltransferase (DGA1), 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) or its truncation (tHMGR), β-carotene hydroxylase CrtZ_9GAMM, mevalonate-5-pyrophosphate decarboxylase (ERG19), β-carotene hydroxylase CrtZ_SACS2, and β-carotene hydroxylase CrtZ_SACS2 and TGL1 fusion protein; Preferably, in the combinations 1) to 12), the copy number of the gene encoding CarB is 2; Preferably, in the combinations 4) to 12), the copy number of the gene encoding CrtE is 2; Preferably, in the combination 6), the gene encoding CrtZ_SACS2 comprises two copies; the two copies respectively comprise the nucleotide sequence shown in SEQ ID NO: 20 or 21 or a degenerate sequence thereof.

13. The recombinant Yarrowia rosenbergii according to any one of claims 1 to 12, wherein the genome is inserted with the following DNA sequence or a combination of its fragments: 1) SEQ ID NO: 26; 2) SEQ ID NO: 26 and SEQ ID NO: 27; 3) SEQ ID NO: 26, SEQ ID NO: 27 and SEQ ID NO: 28; 4) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28 and SEQ ID NO: 29; 5) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29 and SEQ ID NO: 30; 6) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30 and SEQ ID NO: 31; 7) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31 and SEQ ID NO: 32; 8) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32 and SEQ ID NO: 39; 9) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31 and SEQ ID NO: 33; 10) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31 and SEQ ID NO: 34; 11) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32 and SEQ ID NO: 35; 12) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32 and SEQ ID NO: 36; 13) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32 and SEQ ID NO: 37; 14) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32 and SEQ ID NO:

38. 14 . The recombinant Yarrowia rosenbergii according to claim 13 , wherein the fragment is a sequence obtained by removing a resistance gene or a screening gene from any one of SEQ ID NOs: 26-39.

15. The recombinant Yarrowia robur according to any one of claims 1 to 14, which is a recombinant Yarrowia lipolytica; preferably, the starting strain used for the construction of the recombinant Yarrowia lipolytica is selected from the group consisting of Yarrowia lipolytica Po1f, Po1d, Po1e, Po1g and Po1h.

16. Use of the recombinant Yarrowia rosenbergii according to any one of claims 1 to 15 in producing β-carotene and / or zeaxanthin.

17. A method for producing zeaxanthin, characterized in that: The recombinant Yarrowia rosenbergii of any one of claims 1 to 15 is fermented to produce zeaxanthin.

18. A method for producing recombinant Yarrowia spp., characterized in that: Genes encoding phytoene dehydrogenase (CarB), lycopene cyclase / phytoene synthase (CarRP) and geranylgeranyl diphosphate synthase (CrtE) are introduced into a starting strain of Yarrowia spp.; preferably, the number of copies of the gene encoding phytoene dehydrogenase introduced is 2, 3, 4 or 5; preferably, the number of copies of the gene encoding geranylgeranyl diphosphate synthase introduced is 2, 3, 4 or 5.

19. The method according to claim 18, further comprising introducing one or more of the following genes: a gene encoding diacylglycerol acyltransferase (DGA1), a gene encoding 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) or a truncate thereof (tHMGR), a gene encoding β-carotene hydroxylase, a gene encoding a fusion protein of β-carotene hydroxylase and an endoplasmic reticulum targeting sequence, a gene encoding a fusion protein of β-carotene hydroxylase and a lipid metabolism-related protein, a gene encoding mevalonate-5-pyrophosphate decarboxylase (ERG19); preferably, the gene encoding β-carotene hydroxylase includes a gene encoding β-carotene hydroxylase CrtZ_9GAMM from Pantoea stewartii, a gene encoding β-carotene hydroxylase CrtZ_9GAMM from Saccharolobus solfataricus); preferably, the gene encoding the fusion protein of β-carotene hydroxylase and endoplasmic reticulum targeting sequence includes a gene encoding β-carotene hydroxylase CrtZ_9GAMM-endoplasmic reticulum targeting sequence fusion protein, a gene encoding β-carotene hydroxylase CrtZ_SACS2-endoplasmic reticulum targeting sequence fusion protein; preferably, the gene encoding the fusion protein of β-carotene hydroxylase and lipid metabolism-related protein includes a gene encoding β-carotene hydroxylase CrtZ_SACS2-ERG6 fusion protein, a gene encoding β-carotene hydroxylase CrtZ_SACS2-LOA1 fusion protein, and a gene encoding β-carotene hydroxylase CrtZ_SACS2-TGL1 fusion protein.

20. The method according to claim 19, wherein the number of introduced copies of the gene encoding the same enzyme is 1-5; preferably 1 or 2; more preferably, the gene sequences of different copies are the same or different.

21. The method according to any one of claims 18 to 20, wherein the phytoene dehydrogenase is from Mucor circinelloides; preferably, the phytoene dehydrogenase comprises the amino acid sequence shown in SEQ ID NO: 1; preferably, the gene encoding the phytoene dehydrogenase comprises the nucleotide sequence shown in SEQ ID NO: 13; and / or, The lycopene cyclase / phytoene synthase is from Mucor circinelloides; preferably, the lycopene cyclase / phytoene synthase comprises the amino acid sequence shown in SEQ ID NO: 2; preferably, the gene encoding the lycopene cyclase / phytoene synthase comprises the nucleotide sequence shown in SEQ ID NO: 14; and / or, The geranylgeranyl diphosphate synthase is from Xanthophyllomyces dendrorhous; preferably, the geranylgeranyl diphosphate synthase comprises the amino acid sequence shown in SEQ ID NO: 3; preferably, the gene encoding the geranylgeranyl diphosphate synthase comprises the nucleotide sequence shown in SEQ ID NO: 15; and / or, Preferably, the diacylglycerol acyltransferase is from Yarrowia lipolytica; preferably, the diacylglycerol acyltransferase comprises the amino acid sequence shown in SEQ ID NO: 4; the gene encoding the diacylglycerol acyltransferase comprises the nucleotide sequence shown in SEQ ID NO: 16; and / or, The 3-hydroxy-3-methylglutaryl-CoA reductase or a truncate thereof is from Yarrowia lipolytica; preferably, the 3-hydroxy-3-methylglutaryl-CoA reductase or a truncate thereof comprises the amino acid sequence shown in SEQ ID NO: 5; the gene encoding the truncated 3-hydroxy-3-methylglutaryl-CoA reductase comprises the nucleotide sequence shown in SEQ ID NO: 17; and / or, The β-carotene hydroxylase CrtZ_9GAMM comprises the amino acid sequence shown in SEQ ID NO: 6; the gene encoding the β-carotene hydroxylase CrtZ_9GAMM comprises the nucleotide sequence shown in SEQ ID NO: 18; and / or, The mevalonate-5-pyrophosphate decarboxylase is from Yarrowia lipolytica, and preferably comprises the amino acid sequence shown in SEQ ID NO: 7; the gene encoding the mevalonate-5-pyrophosphate decarboxylase comprises the nucleotide sequence shown in SEQ ID NO: 19; and / or, Preferably, the β-carotene hydroxylase CrtZ_SACS2 comprises the amino acid sequence shown in SEQ ID NO: 8; preferably, the gene encoding the β-carotene hydroxylase CrtZ_SACS2 comprises the nucleotide sequence shown in SEQ ID NO: 20 or 21; and / or, The sterol methyltransferase is from Yarrowia lipolytica; preferably, the sterol methyltransferase comprises the amino acid sequence shown in SEQ ID NO: 9; preferably, the gene encoding the sterol methyltransferase comprises the nucleotide sequence shown in SEQ ID NO: 22; and / or, The 1-acylglycerol-3-phosphate-O-acyltransferase is from Yarrowia lipolytica; preferably, the 1-acylglycerol-3-phosphate-O-acyltransferase comprises the amino acid sequence shown in SEQ ID NO: 10; preferably, the gene encoding the 1-acylglycerol-3-phosphate-O-acyltransferase comprises the nucleotide sequence shown in SEQ ID NO: 23; and / or, The phospholipid acyltransferase is from Yarrowia lipolytica; preferably, the phospholipid acyltransferase comprises the amino acid sequence shown in SEQ ID NO: 11; preferably, the gene encoding the phospholipid acyltransferase comprises the nucleotide sequence shown in SEQ ID NO: 24; and / or, The sterol ester hydrolase is from Yarrowia lipolytica; preferably, the sterol ester hydrolase comprises the amino acid sequence shown in SEQ ID NO: 12; preferably, the gene encoding the sterol ester hydrolase comprises the nucleotide sequence shown in SEQ ID NO:

25.

22. The method according to any one of claims 18 to 21, wherein the introduction is performed by homologous recombination or non-homologous recombination; preferably, the introduction is performed by non-homologous recombination of donor DNA.

23. The method according to claim 22, wherein the donor DNA comprises the nucleotide sequence shown in SEQ ID NO: 26 or a degenerate sequence thereof; preferably, the donor DNA further comprises a nucleotide sequence shown in one or more selected from SEQ ID NOs: 27-39 or a degenerate sequence thereof.

24. The method of claim 23, wherein the introduced DNA comprises a combination of: 1) SEQ ID NO: 26; 2) SEQ ID NO: 26 and SEQ ID NO: 27; 3) SEQ ID NO: 26, SEQ ID NO: 27 and SEQ ID NO: 28; 4) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28 and SEQ ID NO: 29; 5) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29 and SEQ ID NO: 30; 6) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30 and SEQ ID NO: 31; 7) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31 and SEQ ID NO: 32; 8) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32 and SEQ ID NO: 39; 9) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31 and SEQ ID NO: 33; 10) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31 and SEQ ID NO: 34; 11) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32 and SEQ ID NO: 35; 12) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32 and SEQ ID NO: 36; 13) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32 and SEQ ID NO: 37; 14) SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32 and SEQ ID NO:

38.

25. The method according to claim 24, further comprising recovering the resistance gene or tag gene contained in the sequence shown in any one of SEQ ID NOs: 26-39 from the recombinant Yarrowia spp.

26. The method according to any one of claims 18 to 25, wherein the recombinant Yarrowia robur is a recombinant Yarrowia lipolytica.

27. The method according to any one of claims 18 to 26, wherein the starting strain is selected from the group consisting of Yarrowia lipolytica Po1f, Po1d, Po1e, Po1g and Po1h; preferably, the starting strain is Po1f.

Images