Protein mutants and biomaterials thereof for producing l-isoleucine

Abstract

The application discloses a protein mutant and application of a biomaterial thereof in production of L-isoleucine, and belongs to the technical field of biotechnology.The technical problem solved by the application is how to improve the yield of L-isoleucine.The sequence of the disclosed protein mutant is SEQ ID No.4.The yield of L-isoleucine can be improved by replacing the coding gene of the protein shown in SEQ ID No.2 with the coding gene of the protein shown in SEQ ID No.4, or improving the content or activity of the protein shown in SEQ ID No.2 or SEQ ID No.4 in the original biological cell.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to a protein mutant and application of a biological material thereof in production of L-isoleucine. BACKGROUND

[0002] Acyltransferase is a kind of enzyme widely studied in the field of biochemistry and molecular biology. This kind of enzyme has the function of catalyzing acyl transfer and can form lipid or amide compounds in the organism. The acyl donor is mostly acyl-CoA.

[0003] Acyltransferase is a large family of multifunctional proteins, mainly responsible for catalyzing various acylations and deacylations in the organism, and plays an important role in gene expression, metabolism and signal transduction.

[0004] In Escherichia coli, acyltransferase is closely related to the biosynthesis and metabolism of arginine. It includes N-succinylarginine arginine dihydrolase AstB in the arginine catabolic pathway of Escherichia coli; arginine succinyltransferase (AstA) in the arginine catabolic pathway of Escherichia coli; N-acetylornithine aminotransferase with double biosynthetic ability in the biosynthesis of arginine and lysine; carbamoyl phosphate synthase, acetylornithine transaminase and ornithine acetyltransferase in the arginine synthesis pathway, which are key enzymes in the L-arginine synthesis pathway. SUMMARY

[0005] The technical problem to be solved by the present application is how to improve the yield of isoleucine.

[0006] To solve the above technical problem, the present application first provides a protein mutant, which contains the following A1), A2) or A3):

[0007] A1) a protein with an amino acid residue difference at the 182nd amino acid residue compared with SEQ ID No. 2;

[0008] A2) a protein with 98% or more identity and the same function to the amino acid sequence of the protein shown in A1) by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence of the protein shown in A1);

[0009] A3) a fusion protein obtained by connecting a tag to the N terminus or / and C terminus of A1) or A2).

[0010] The protein in A1) above can be obtained by mutating the alanine residue at the 182nd position in SEQ ID No. 2. The mutated amino acid residue can be a threonine residue, but is not limited to a threonine residue.

[0011] Specifically, the protein in A1) above can be the protein shown in SEQ ID No. 4.

[0012] The protein in A2) above is a protein having 98% or more identity to the amino acid sequence of the protein described in A1) and having the same function. The identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page of the NCBI home page website. For example, the identity of a pair of amino acid sequences can be calculated by searching using blastp as the program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as the Matrix, setting Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values), respectively, in Advanced BLAST 2.1, and then the value of the identity (%) can be obtained. The 98% or more identity refers to 98% or 99% identity.

[0013] The protein in A2) above can be specifically the protein shown in SEQ ID No. 2.

[0014] The protein in A2) above can be artificially synthesized or can be obtained by first synthesizing the encoding gene and then performing biological expression.

[0015] The encoding gene of the protein in A2) above can be obtained by deleting one or several codons of the amino acid residues in the DNA sequence shown in SEQ ID No. 3, and / or performing one or several missense mutations of nucleotide pairs, and / or connecting the encoding sequence of a tag at the 5' end and / or 3' end, such as the encoding gene shown in SEQ ID No. 1. The DNA molecule shown in SEQ ID No. 3 encodes the protein shown in SEQ ID No. 4, and the DNA molecule shown in SEQ ID No. 1 encodes the protein shown in SEQ ID No. 2.

[0016] The tag in A3) above can be a polypeptide or protein that is fused and expressed with the target protein by using DNA in vitro recombination technology, so as to facilitate the expression, detection, tracking and / or purification of the target protein. The tag can be Poly-Arg, Poly-His, FLAG, Strep-tag II, c-myc, MBP tag, HA tag, GST tag and / or SUMO tag, etc.

[0017] In one embodiment of the present application, the protein mutant is the protein shown in SEQ ID No. 4.

[0018] In another embodiment of the present application, the protein mutant is the protein shown in SEQ ID No. 2.

[0019] The present application also provides biological materials related to the protein, which contain any one of the following B1) to B4):

[0020] B1) a nucleic acid molecule encoding the protein;

[0021] B2) an expression cassette containing the nucleic acid molecule of B1);

[0022] B3) a recombinant vector containing the nucleic acid molecule of B1), or a recombinant vector containing the expression cassette of B2);

[0023] B4) a recombinant microorganism containing the nucleic acid molecule of B1), or a recombinant microorganism containing the expression cassette of B2), or a recombinant microorganism containing the recombinant vector of B3).

[0024] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA, etc.

[0025] Those artificially modified nucleotides having 75% or more identity with the nucleotide sequence of the protein of the present application, as long as they encode the above-mentioned protein and have the same protein function, are derived from the nucleotide sequence of the present application and are equivalent to the sequence of the present application.

[0026] In the above-mentioned biological materials, the nucleic acid molecule of B1) can include the following b11) or b12):

[0027] b11) a DNA molecule containing the coding sequence shown in SEQ ID No. 3 or SEQ ID No. 1;

[0028] b12) a DNA molecule having 75% or more identity with the nucleotide sequence defined in b11) and encoding the protein.

[0029] b11) can be a DNA molecule whose sequence contains SEQ ID No. 3.

[0030] The term "identity" as used herein refers to sequence similarity to a native nucleic acid sequence. "Identity" includes a nucleotide sequence having 75% or more, or 85% or more, or 90% or more, or 95% or more identity to a nucleotide sequence of a protein consisting of the amino acid sequence shown in SEQ ID No. 4 or SEQ ID No. 2 of the present application. Identity can be assessed by eye or by computer software. Using computer software, identity between two or more sequences can be expressed as a percentage (%) which can be used to assess identity between related sequences.

[0031] The 75% or more identity described above can be 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

[0032] b12) can be a DNA molecule shown in SEQ ID No. 1.

[0033] B1) The nucleic acid molecule can be a DNA molecule shown in SEQ ID No. 3, or a DNA molecule shown in SEQ ID No. 1.

[0034] The expression cassette (gene expression cassette of the protein) containing a nucleic acid molecule encoding the protein described in B2) above refers to a DNA capable of expressing the above-mentioned protein in a host cell. The DNA can include not only a promoter that initiates transcription of the gene of the protein, but also a terminator that terminates transcription of the gene of the protein. Further, the expression cassette can include an enhancer sequence.

[0035] The promoter in the expression cassette described in B2) above can contain or be b21) or b22) below:

[0036] b21) a DNA molecule shown in positions 21-80 of SEQ ID No. 7 in the sequence listing;

[0037] b22) a DNA molecule having 75% or more identity to the nucleotide sequence defined in b21) and having a promoter function.

[0038] In one embodiment of the present application, the expression cassette described in B2) above can be as shown in positions 21-2231 of SEQ ID No. 7 or positions 21-2231 of SEQ ID No. 8.

[0039] A recombinant vector containing a gene expression cassette of the protein can be constructed using an existing expression vector.

[0040] In the above biological material, the vector can be a plasmid, cosmid, bacteriophage or viral vector. The plasmid can be specifically a pK18mobsacB vector or a pXMJ19 vector.

[0041] B3) the recombinant vector can be a recombinant vector pK18-NCgl0674 A182T pK18-NCgl0674 A182T is a recombinant vector obtained by replacing the fragment (small fragment) between the Xbal I and BamHI recognition sites of the pK18mobsacB vector with the DNA fragment shown in SEQ ID No. 5, positions 37-1236, while keeping other sequences of the pK18mobsacB vector unchanged.

[0042] B3) the recombinant vector can be a recombinant vector pXMJ19-NCgl0674 or pXMJ19-NCgl0674 A182T pXMJ19-NCgl0674 is a recombinant vector obtained by inserting the gene expression cassette of the protein shown in SEQ ID No. 10, positions 37-2247, in the pXMJ19 vector, and pXMJ19-NCgl0674 A182T is a recombinant vector obtained by inserting the gene expression cassette of the protein shown in SEQ ID No. 11, positions 37-2247, in the pXMJ19 vector.

[0043] In the above biological material, the microorganism can be at least a bacterium, and can also be a yeast, algae or fungus. Among them, the bacterium can be at least Corynebacterium glutamicum. The bacterium can also be Escherichia coli, Pantoea ananatis, Bacillus brevis or Brevis lactobacillus.

[0044] In an embodiment of the present application, the Corynebacterium glutamicum is Corynebacterium glutamicum CGMCC 20437 or Corynebacterium glutamicum ATCC 13032.

[0045] B4) the recombinant microorganism can be a recombinant microorganism obtained by replacing the gene encoding the protein shown as SEQ ID No. 4 (such as the gene shown as SEQ ID No. 3) in the starting microorganism with the gene encoding the protein shown as SEQ ID No. 2 (such as the gene shown as SEQ ID No. 1), and can also be a recombinant microorganism obtained by expressing the protein in the starting microorganism, or increasing the content or activity of the protein in the starting microorganism.

[0046] In an embodiment of the present application, the recombinant microorganism is recombinant bacteria YPI-0674-1, YPI-0674-2, YPI-0674-3, YPI-0674-4, YPI-0674-5, YPI-0674-6, YPI-0674-7, YPI-0674-8, YPI-0674-9, YPI-0674-10.

[0047] The recombinant bacteria YPI-0674-1 is a strain obtained by replacing the gene shown as SEQ ID No. 1 in Corynebacterium glutamicum CGMCC20437 with the gene shown as SEQ ID No. 3.

[0048] The recombinant bacteria YPI-0674-2 is a strain obtained by replacing the gene shown as SEQ ID No. 1 in Corynebacterium glutamicum ATCC13032 with the gene shown as SEQ ID No. 3.

[0049] The recombinant bacteria YPI-0674-3 is a recombinant bacteria obtained by inserting the gene expression cassette shown as positions 21-2231 of SEQ ID No. 7 at the poxB site in the genome of Corynebacterium glutamicum CGMCC20437.

[0050] The recombinant bacteria YPI-0674-4 is a recombinant bacteria obtained by inserting the gene expression cassette shown as positions 21-2231 of SEQ ID No. 8 at the poxB site in the genome of Corynebacterium glutamicum CGMCC20437.

[0051] The recombinant bacteria YPI-0674-5 is a recombinant bacteria obtained by inserting the gene expression cassette shown as positions 21-2231 of SEQ ID No. 7 at the poxB site in the genome of Corynebacterium glutamicum ATCC13032.

[0052] The recombinant bacterium YPI-0674-6 is a recombinant bacterium obtained by inserting a gene expression cassette shown in SEQ ID No. 8 at positions 21-2231 into the poxB site in the genome of Corynebacterium glutamicum ATCC13032.

[0053] The recombinant bacterium YPI-0674-7 is a recombinant bacterium obtained by introducing the recombinant vector pXMJ19-NCgl0674 into Corynebacterium glutamicum CGMCC 20437.

[0054] The recombinant bacterium YPI-0674-8 is a recombinant bacterium obtained by introducing the recombinant vector pXMJ19-NCgl0674 A182T into Corynebacterium glutamicum CGMCC 20437.

[0055] The recombinant bacterium YPI-0674-9 is a recombinant bacterium obtained by introducing the recombinant vector pXMJ19-NCgl0674 into Corynebacterium glutamicum ATCC13032.

[0056] The recombinant bacterium YPI-0674-10 is a recombinant bacterium obtained by introducing the recombinant vector pXMJ19-NCgl0674 A182T into Corynebacterium glutamicum ATCC13032.

[0057] The present application also provides a method for producing isoleucine (such as L-isoleucine), which comprises X1) or X2):

[0058] X1) replacing the coding gene of the protein shown in SEQ ID No. 2 in a starting bacterium with the coding gene of the protein shown in SEQ ID No. 4 to obtain a recombinant bacterium; culturing the recombinant bacterium to obtain isoleucine;

[0059] X2) expressing the protein in a starting biological cell, or increasing the content or activity of the protein in the starting biological cell to obtain a recombinant biological cell; culturing the recombinant biological cell to obtain isoleucine;

[0060] The starting biological cell is a bacterium, yeast, alga or fungus capable of synthesizing isoleucine.

[0061] The starting strain contains a gene encoding the protein shown in SEQ ID No. 2, such as the DNA molecule shown in SEQ ID No. 1.

[0062] The starting strain can be at least a bacterium. The bacterium can be at least Corynebacterium glutamicum, such as Corynebacterium glutamicum CGMCC 20437 or Corynebacterium glutamicum ATCC 13032.

[0063] The bacterium of the present application includes but is not limited to Corynebacterium glutamicum. Any bacterium containing an L-isoleucine synthesis pathway can use the protein of the present application and its related biological materials to produce L-isoleucine. The bacterium can be at least Corynebacterium glutamicum, and can also be Escherichia coli, Pantoea ananatis, Bacillus brevis, or Brevis lactobacillus.

[0064] The method of X2) above can be achieved by introducing the gene encoding the protein into the starting biological cell and allowing it to be expressed.

[0065] In the above method, the culture of the recombinant biological cell (or the recombinant bacterium) can be carried out using a culture medium that allows the growth of the recombinant biological cell (or the recombinant bacterium);

[0066] And / or, the culture of the recombinant biological cell (or the recombinant bacterium) is carried out under conditions that allow the growth of the recombinant biological cell (or the recombinant bacterium).

[0067] The recombinant biological cell can be a recombinant microorganism as described above. The recombinant bacterium can also be a recombinant microorganism as described above.

[0068] The use of the protein or the biological material in the production of isoleucine, or in the preparation of a product for the production of isoleucine, also falls within the scope of the present application.

[0069] The protein of the present application or the biological material can be used to produce various products, including but not limited to isoleucine (such as L-isoleucine) in the examples, and the produced amino acids can also be glutamic acid, valine, glycine, alanine, leucine, lysine, methionine, proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine, aspartic acid, arginine and histidine, shikimic acid, protocatechuic acid, succinic acid, a-ketoglutaric acid, citric acid, ornithine, citrulline. When producing various target products, the protein of the present application is placed in the synthesis pathway of the target product to achieve the production of the target product.

[0070] The protein of the present application and its biological material can be used to produce isoleucine. Replacing the coding gene of the protein shown in SEQ ID No. 2 with the coding gene of the protein shown in SEQ ID No. 4 in the producing organism, or increasing the content or activity of the protein shown in SEQ ID No. 2 or SEQ ID No. 4 in the producing organism, can all increase the yield of isoleucine.

[0071] The present application will be further described in detail below in conjunction with the specific embodiments. The examples provided below are only for the purpose of illustrating the present application, and are not intended to limit the scope of the present application. The examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not in any way constitute a limitation on the present application.

[0072] Biological material preservation instructions

[0073] Classification name: Corynebacterium glutamicum

[0074] Strain number: YPILE001

[0075] Preservation unit name: China General Microbiological Culture Collection Center

[0076] Abbreviation of the preservation unit: CGMCC

[0077] Address of the preservation unit: No. 3, Beichen West Road, Beijing City, Chaoyang District, 100101

[0078] Preservation date: August 17, 2020

[0079] Preservation center registration number: CGMCC No. 20437 DETAILED DESCRIPTION

[0080] The experimental methods in the following examples are all conventional methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, instruments, etc. used in the following examples can be obtained commercially, unless otherwise specified. The data in the following examples are processed using SPSS 11.5 statistical software, and the experimental results are expressed as the mean value, and One-way ANOVA test is used.

[0081] The Corynebacterium glutamicum CGMCC 20437 in the following examples was deposited at the China General Microbiological Culture Collection Center (CGMCC, located at No. 1, Yikhina Xilu, Chaoyang District, Beijing, China, Institute of Microbiology, Chinese Academy of Sciences) on August 17, 2020, and the deposit accession number is CGMCC No. 20437. The Corynebacterium glutamicum CGMCC 20437 contains an L-isoleucine synthesis pathway.

[0082] The cultivation of the Corynebacterium glutamicum in Examples 1-5 was performed at 32°C.

[0083] Example 1, construction of a recombinant vector containing a fragment of the coding region of the NCgl0674 gene with a point mutation

[0084] According to the Corynebacterium glutamicum ATCC13032 genome sequence published by NCBI, a pair of primers for amplifying the acyltransferase NCgl0674 gene coding region were designed and synthesized. A point mutation was introduced into the NCgl0674 gene coding region (SEQ ID No. 1) of Corynebacterium glutamicum CGMCC 20437 (which was confirmed by sequencing that the wild-type NCgl0674 gene was retained on the chromosome of this strain) in an allelic replacement manner, i.e., the guanine (G) at position 544 in the nucleotide sequence of the NCgl0674 gene (SEQ ID No. 1) was mutated to adenine (A).

[0085] SEQ ID No. 1 encodes the protein of SEQ ID No. 2 (this protein is a wild-type protein, denoted as protein NCgl0674).

[0086] SEQ ID No. 3 encodes the mutant protein of SEQ ID No. 4 (this mutant protein is denoted as NCgl0674 A182T). The mutant protein NCgl0674 A182T The threonine (T) at position 182 in SEQ ID No. 4 is mutated to alanine (A).

[0087] The NEBuilder recombination technology was used for vector construction, and the primers were designed as follows (synthesized by Shanghai Invitrogen Company), and the bold nucleotides are the mutation positions:

[0088] P1: 5'-GTGG GAACGGCGAG AGGGC-3', CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG

[0089]

[0090] P4: 5'-ATACGCACGC ATTCGGGCAG-3'. CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC

[0091] Construction method: The genome of Corynebacterium glutamicum ATCC13032 was used as a template, and primers P1 and P2, P3 and P4 were used for PCR amplification, respectively, to obtain two DNA fragments (NCgl0674 Up and NCgl0674 Down) of the NCgl0674 gene coding region with mutation nucleotides, with sizes of 600 bp and 714 bp, respectively.

[0092] After the two DNA fragments (NCgl0674 Up and NCgl0674 Down) were separated and purified by agarose gel electrophoresis, they were ligated with the pK18mobsacB vector (BioVector Company, containing a kanamycin resistance marker) digested with Xbal I / BamH I and purified at 50°C for 30 min using NEBuilder enzyme (NEB Company). The single colony grown after transformation of the ligation product into DH5α was identified by PCR with M13 primers (M13F: 5'-TGT AAA ACG ACG GCC AGT-3', M13R: 5'-CAG GAA ACA GCT ATG ACC-3') to obtain a positive recombinant vector pK18-NCgl0674 A182T . The recombinant vector pK18-NCgl0674 A182T was digested correctly and sent to a sequencing company for sequencing identification, and the recombinant vector pK18-NCgl0674 A182T containing the correct point mutation (A-C) was preserved for future use.

[0093] The recombinant vector pK18-NCgl0674 A182T ​​The recombinant vector pK18-NCgl0674 is obtained by replacing the fragment (small fragment) between the Xbal I and BamH I recognition sites of the pK18mobsacB vector with the DNA fragment shown as positions 37-1236 of SEQ ID No. 5 in the sequence listing, while keeping other sequences of the pK18mobsacB vector unchanged.

[0094] Recombinant vector pK18-NCgl0674 A182T The mutant gene NCgl0674 shown as SEQ ID No. 3 A182T .

[0095] Example 2, construction of an engineering strain containing the gene NCgl0674 A182T

[0096] Construction method: after the allelic replacement vector (pK18-NCgl0674 A182T ) in Example 1 is transformed into Corynebacterium glutamicum CGMCC 20437 and Corynebacterium glutamicum ATCC13032 by electroporation, culture is carried out in a culture medium, the composition of the culture medium is shown in Table 1, and single colonies produced in the culture are picked and cultured on a culture medium containing 15% sucrose (sucrose concentration is 15 g / L, other components and concentrations are shown in Table 1). The single colonies produced in the culture are cultured on a culture medium containing kanamycin and a culture medium not containing kanamycin, and strains that grow on the culture medium not containing kanamycin but do not grow on the culture medium containing kanamycin are further identified by PCR using the following primers (synthesized by Shanghai Invitrogen Company):

[0097] P5: 5'-TGGGAGCTCG CATCCCAAGG-3',

[0098] P6: 5'-AATGAAATGC CACAGGATTG-3'.

[0099] The PCR amplification product (240 bp) obtained is sequenced, and by sequence alignment, the strain in which the 544th nucleotide of the NCgl0674 gene is mutated (G-A) is a positive strain of successful allelic replacement. The mutant strains obtained from Corynebacterium glutamicum CGMCC 20437 and ATCC13032 are named YPI-0674-1 and YPI-0674-2, respectively.

[0100] ​The recombinant bacteria YPI-0674-1 and YPI-0674-2 are respectively obtained by replacing the wild-type NCgl0674 gene in Corynebacterium glutamicum CGMCC 20437 and Corynebacterium glutamicum ATCC13032 with the NCgl0674 gene shown in SEQ ID No. 3 A182T The mutant gene is obtained by replacing the wild-type NCgl0674 gene in Corynebacterium glutamicum CGMCC 20437 and Corynebacterium glutamicum ATCC13032 with the NCgl0674 gene shown in SEQ ID No. 3

[0101] Table 1, composition of the culture medium (the rest is water)

[0102] Ingredients Formulation Sucrose 10 g / L Polypeptone 10 g / L Beef extract 10 g / L Yeast extract 5 g / L Urea 2 g / L Sodium chloride 2.5 g / L Agar powder 20 g / L pH 7.0

[0103] Example 3, construction of a genome overexpressing NCgl0674 gene and NCgl0674 A182T The mutant gene is obtained by replacing the wild-type NCgl0674 gene in Corynebacterium glutamicum CGMCC 20437 and Corynebacterium glutamicum ATCC13032 with the NCgl0674 gene shown in SEQ ID No. 3

[0104] The NEBuilder recombination technology is used for vector construction. According to the Corynebacterium glutamicum ATCC13032 genome sequence published by NCBI, three pairs of amplification upstream and downstream homologous arm fragments and NCgl0674 or NCgl0674 A182T gene coding region and promoter region are designed and synthesized, and introduced into Corynebacterium glutamicum CGMCC 20437 by homologous recombination. A182T The mutant gene is obtained by replacing the wild-type NCgl0674 gene in Corynebacterium glutamicum CGMCC 20437 and Corynebacterium glutamicum ATCC13032 with the NCgl0674 gene shown in SEQ ID No. 3

[0105] The primers are designed as follows (synthesized by Shanghai Invitrogen Company):

[0106]

[0107] Construction method: Taking the genome of Corynebacterium glutamicum ATCC13032 or YPI-0674-1 of Example 1 as the template, respectively, and taking primers P7 / P8, P9 / P10, P11 / P12 for PCR amplification, respectively, to obtain an upstream homologous arm fragment of 860 bp (the sequence is shown in SEQ ID No. 6), a fragment of 2251 bp containing NCgl0674 gene and its promoter (the sequence is shown in SEQ ID No. 7, the positions 21-80 of SEQ ID No. 7 represent the promoter, the positions 81-2231 represent the NCgl0674 gene, and the positions 21-2231 represent the NCgl0674 A182T gene and its promoter (the sequence is shown in SEQ ID No. 8, the positions 21-80 of SEQ ID No. 8 represent the promoter, and the positions 81-2231 represent the NCgl0674A182T Gene, NCgl0674 shown in 21-2231 A182T Gene expression cassette) and a downstream homologous arm fragment 817bp (sequence shown as SEQ ID No. 9).

[0108] After the PCR reaction, the three fragments amplified from each template were recovered by column type DNA gel recovery kit respectively. The three recovered fragments and the pK18mobsacB vector (containing kanamycin resistance as a screening marker) digested by Xbal I / BamH I and purified were ligated by NEBuilder enzyme (NEB company) at 50℃ for 30min. The positive integrated vectors (recombinant vectors) were obtained by PCR identification using M13 primers (M13F: 5'-TGT AAA ACG ACG GCC AGT-3', M13R: 5'-CAG GAA ACA GCT ATG ACC-3') from the single colonies grown after the transformation of the ligation product into DH5α, which were pK18-NCgl0674OE, pK18-NCgl0674 A182T OE, containing kanamycin resistance marker, and the recombinants of the vector integrated into the genome can be obtained by kanamycin screening.

[0109] The integrated vectors (pK18-NCgl0674OE, pK18-NCgl0674 A182T OE) with correct sequencing were respectively electroporated into C. glutamicum CGMCC 20437 and ATCC13032, and cultured in the medium, the composition of which was shown in Table 1. The single colonies produced in the culture were identified by PCR using P13 / P14 primers. The positive strains were those in which a fragment with a size of 1713bp was amplified, and the original strains were those in which no fragment was amplified. The positive strains were cultured in the medium containing 15% sucrose, and the single colonies produced in the culture were further identified by PCR using P15 / P16 primers. The strains in which a fragment with a size of 1758bp was amplified were NCgl0674 or NCgl0674 A182T The positive strains in which the NCgl0674 or NCgl0674

[0110] The recombinant bacteria YPI-0674-003 and YPI-0674-005 contain double copies of the NCgl0674 gene expression cassette; specifically, the recombinant bacteria YPI-0674-006 and YPI-0674-007 are obtained by inserting the NCgl0674 gene expression cassette (21-2231 of SEQ ID No. 7) at the upstream poxB site in the genome of the Corynebacterium glutamicum CGMCC 20437 and ATCC13032, while keeping other nucleotides in the genome of the Corynebacterium glutamicum CGMCC 20437 and ATCC13032 unchanged. The recombinant bacteria containing double copies of the NCgl0674 gene can significantly and stably improve the expression amount of the NCgl0674 gene.

[0111] The recombinant bacteria YPI-0674-004 and YPI-0674-006 contain the mutant NCgl0674 A182T gene shown in SEQ ID No. 3; specifically, the recombinant bacteria YPI-0674-004 and YPI-0674-006 are obtained by inserting the NCgl0674 A182T gene expression cassette (21-2231 of SEQ ID No. 8) at the upstream poxB site in the genome of the Corynebacterium glutamicum CGMCC 20437 and ATCC13032, while keeping other nucleotides in the genome of the Corynebacterium glutamicum CGMCC 20437 and ATCC13032 unchanged.

[0112] The PCR identification primers are as follows:

[0113] P13: 5'-GCCAGAAAAT GGTTGCGTGA-3',

[0114] P14: 5'-TGCGAGTATT GATTTAGTC-3',

[0115] P15: 5'-CAACGAGTCC TCGATACCCA-3',

[0116] P16: 5'-TCAAACGTAA TGCGGATCAG-3'.

[0117] Example 4, Construction of the engineering strain overexpressing the NCgl0674 gene or the NCgl0674 A182T gene on the vector

[0118] The NEBuilder recombination technology is used for vector construction, and a pair of NCgl0674 and NCgl0674 A182TPrimers for the gene coding region and promoter region were designed as follows (synthesized by Shanghai Invitrogen):

[0119] P17: 5′- GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCC ACTT CAAAGGCAAG TGTG-3′ (the underlined nucleotide sequence is the sequence on pXMJ19),

[0120] P18: 5′- ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAAC CTAAGCGACC AGAAGCCTG-3′ (the underlined nucleotide sequence is the sequence on pXMJ19).

[0121] Construction method: The genomes of Corynebacterium glutamicum ATCC13032 and YPI-0674-1 of Example 1 were used as templates, and PCR amplification was performed with primers P17 / P18 to obtain a fragment containing the NCgl0674 gene and its promoter (sequence shown in SEQ ID No. 10) and a fragment containing NCgl0674 A182T The fragment of the gene and its promoter (sequence shown in SEQ ID No. 11) was 2281 bp. The amplified product was subjected to electrophoresis and purified and recovered using a column DNA gel recovery kit. The recovered DNA fragment was ligated with the shuttle vector pXMJ19 (BioVector, which contains chloramphenicol resistance as a selection marker) recovered by EcoR I / KpnI digestion using NEBuilder enzyme (NEB) at 50°C for 30 min. The single clone grown after the ligation product was transformed into DH5α was identified by PCR using M13R(-48)(5′-AGCGGATAAC AATTTCACAC AGGA-3′) / P18 primers to obtain the positive overexpression vectors pXMJ19-NCgl0674 (containing the NCgl0674 gene) and pXMJ19-NCgl0674 with correct sequences. A182T (Contains NCgl0674 A182T Gene), the vector was sent for sequencing. Because the vector contains a chloramphenicol resistance marker, chloramphenicol can be used to screen whether the vector is transformed into the strain. pXMJ19-NCgl0674 is a recombinant vector obtained by inserting the NCgl0674 gene expression cassette shown at positions 37-2247 of SEQ ID No.10 into the pXMJ19 vector. A182T Insert NCgl0674 shown at positions 37-2247 of SEQ ID No. 11 into pXMJ19 vector A182T The recombinant vector obtained by gene expression cassette.

[0122] The correctly sequenced pXMJ19-NCgl0674 and pXMJ19-NCgl0674 wereA182T The vectors were electroporated into Corynebacterium glutamicum CGMCC 20437 and ATCC 13032, respectively, and cultured in a culture medium. The culture medium composition is shown in Table 1. Single colonies produced by the culture were identified by PCR using primers M13R (-48) (5′-AGCGGATAAC AATTTCACAC AGGA-3′) / P18. PCR amplification of a 2320 bp fragment was identified as a positive strain. The transformed strains obtained using Corynebacterium glutamicum CGMCC 20437 as the starting strain were named YPI-0674-7 (without the mutation point) and YPG-0214-8 (with the mutation point); the transformed strains obtained using Corynebacterium glutamicum ATCC 13032 as the starting strain were named YPI-0674-9 (without the mutation point) and YPG-0214-10 (with the mutation point).

[0123] Recombinant bacteria YPI-0674-7 and YPI-0674-9 were obtained by introducing the recombinant vector pXMJ19-NCgl0674 into Corynebacterium glutamicum CGMCC 20437 and ATCC 13032, respectively. Both contain the NCgl0674 gene and its promoter (i.e., the NCgl0674 gene expression cassette).

[0124] The recombinant strains YPI-0674-8 and YPI-0674-10 were respectively transformed with the recombinant vector pXMJ19-NCgl0674 A182T The recombinant bacteria obtained by introducing CGMCC 20437 and ATCC13032 into Corynebacterium glutamicum contain NCgl0674 A182T Gene and its promoter (i.e. NCgl0674 A182T gene expression cassette).

[0125] Example 5: Construction of an engineered strain with a genome-deleted NCgl0674 gene

[0126] Vector construction was performed using NEBuilder recombination technology. Based on the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of primers were synthesized to amplify the fragments at both ends of the coding region of the NCgl0674 gene as upstream and downstream homology arm fragments. The primers were designed as follows (synthesized by Shanghai Invitrogen):

[0127] P19: 5′- CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG CGCA TCGAGGAATT CGCGC-3′,

[0128]

[0129]

[0130] Construction method: the genome of Corynebacterium glutamicum ATCC13032 was used as a template, and primers P19 / P20 and P21 / P22 were used for PCR amplification, respectively, to obtain an upstream homologous arm fragment of 656 bp of NCgl0674 and a downstream homologous arm fragment of 654 bp of NCgl0674.

[0131] The amplified product was electrophoresed and purified by a column type DNA gel recovery kit, the recovered DNA fragment was connected with the pK18mobsacB vector (containing kanamycin resistance as a screening marker) digested by Xbal I / BamHI and purified at 50°C for 30 min using NEBuilder enzyme (NEB company), and the single clone grown after transformation of the connection product was identified by PCR using M13 primers to obtain a positive knockout vector pK18-ΔNCgl0674. The recombinant vector pK18-ΔNCgl0674 contains a Up-Down DNA of 1274 bp of ΔNCgl0674 (the sequence is shown as SEQ ID No. 12).

[0132] The vector was sequenced, and the correct knockout vector pK18-ΔNCgl0674 was electroporated into Corynebacterium glutamicum CGMCC 20437 and Corynebacterium glutamicum ATCC 13032, and cultured in a culture medium. The composition of the culture medium is shown in Table 1. The single colony produced in the culture was identified by PCR using the following primers (synthesized by Shanghai invitrogen company):

[0133] P23: 5'-CGCATCGAGGAATT CGCGC-3',

[0134] P24: 5'-AACAAGGCCA CACTGATCAC-3'.

[0135] The strains with bands of 1200 bp and 3351 bp amplified by PCR are positive strains, and the strains with only 1200 bp band amplified are original strains. The positive strains are cultured on the medium containing kanamycin and the medium without kanamycin after being screened on the 15% sucrose medium. The strains growing on the medium without kanamycin and not growing on the medium containing kanamycin are further identified by PCR with P23 / P24 primers. The strains with 1200 bp band amplified by PCR are positive strains with the coding region of NCgl0674 gene knocked out. The NCgl0674 fragment of the positive strains is amplified by PCR with P23 / P24 primers, and sequenced. The strains with correct sequencing are named as YPI-0674-11 (NCgl0674 gene on the genome of Corynebacterium glutamicum CGMCC 20437 is knocked out) and YPI-0674-12 (NCgl0674 gene on the genome of Corynebacterium glutamicum ATCC 13032 is knocked out).

[0136] Example 6, L-isoleucine fermentation experiment

[0137] The strains constructed in the above examples and the original strains Corynebacterium glutamicum CGMCC 20437 and Corynebacterium glutamicum ATCC 13032 are verified by shake flask fermentation. The specific medium is as follows, each strain is repeated three times, and the results are shown in Table 3.

[0138] Slope culture: the preserved strain at -80℃ is streaked on an activated slope (see Table 1 for medium composition), and cultured at 30℃ for 24h, and subcultured once;

[0139] Shake flask seed culture: a loop of the slope seed is scraped with a inoculation loop and inoculated into a 500mL flask containing 30mL of seed culture medium (see Table 1 for medium composition, without agar powder), nine layers of gauze are used for sealing, and cultured at 37℃, 200rpm for 7-10h;

[0140] Shake flask fermentation culture: inoculate the 500mL flask containing fermentation medium with the inoculation amount of 10-15% of the volume of the seed culture liquid (the final volume is 30mL), seal with nine layers of gauze, cultivate at 37℃, 200r / min, maintain the pH at 7.0-7.2 by supplementing ammonia water during the fermentation process; supplement 60%(m / v) glucose solution to maintain the fermentation process; the fermentation period is 24h.

[0141] Table 2, shake flask fermentation medium formula (the rest is water)

[0142] Reagent name Concentration (g / L) Glucose 30 Yeast extract 15 Polypeptone 15 Ammonium sulfate 5 Urea 3 KH2PO4 6 K2HPO4 5 Magnesium sulfate 0.2 Calcium pantothenate 0.6 Biotin 0.5 VB1 0.5 pH 6.8-7.2

[0143] The results are shown in Table 3. The NCgl0674 gene is mutated to NCgl0674 A182TThe genes can improve the yield of L-isoleucine, NCgl0674 gene and NCgl0674 A182T The gene overexpression can also improve the yield of L-isoleucine, and the knockout of NCgl0674 gene is not conducive to the accumulation of L-isoleucine.

[0144] Table 3, L-isoleucine fermentation experiment results

[0145]

[0146] The above has been described in detail. For those skilled in the art, without departing from the purpose and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wide range of equivalent parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that the present application can be further improved. In short, according to the principle of the present application, this application intends to include any change, use or improvement of the present application, including the change made by the conventional technology known in the art, which is out of the range disclosed in the present application. Some basic features can be applied according to the scope of the following attached claims.

Claims

1. A protein mutant, characterized in that: The amino acid sequence of the protein mutant is shown in SEQ ID No.

4.

2. A biomaterial, characterized in that: The biological material comprises any one of the following B1) to B4): B1) a nucleic acid molecule encoding the protein mutant according to claim 1; B2) an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) A recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3).

3. The biomaterial according to claim 2, characterized in that: B1) The nucleic acid sequence of the nucleic acid molecule is shown as SEQ ID No.

3.

4. The biomaterial according to claim 2 or 3, characterized in that: The host bacteria of the recombinant microorganism is Corynebacterium glutamicum.

5. A method for producing isoleucine, characterized in that: The method comprises: The acyltransferase coding gene in the starting bacteria is replaced with the coding gene of the protein shown in SEQ ID No. 4 to obtain a recombinant bacteria; the recombinant bacteria is cultured to obtain isoleucine; the starting bacteria is Corynebacterium glutamicum ( Corynebacterium glutamicum ).

6. Use of the protein mutant according to claim 1 or the biomaterial according to any one of claims 2 to 4 in producing isoleucine, or in preparing a product containing isoleucine.

Images