High-temperature-resistant xylanase mutant and application thereof

Abstract

The invention relates to the technical field of genetic engineering and protein modification, in particular to a high-temperature-resistant xylanase mutant and application thereof. The invention provides a mutant comprising mutation sites selected from I24T, G25N, V27Y, T41V, S65N / Q and N160A / M / R on the basis of wild type xylanase PT. The heat resistance of the xylanase mutant is remarkably improved, and after the xylanase mutant is treated at 95 DEG C for 5 min, the enzyme activity residual rate is improved by 13.1%-23.2% compared with that of a wild type; wherein the xylanase single-point mutant containing S65N single-point mutation has the strongest heat resistance, the enzyme activity residual rate is as high as 82.9%, and an unexpected technical effect is achieved.

Description

Technical Field

[0001] The invention relates to the technical field of gene engineering and protein engineering, and in particular to a thermostable acid xylanase mutant and application thereof. Background Art

[0002] Xylan is a polypentose and an important component of plant hemicellulose. It accounts for one-third of the total carbohydrates in plants and is the second most abundant renewable resource in nature after cellulose. It exists in the cell walls and almost all parts of plants.

[0003] Xylanase is a general term for a class of enzymes that can degrade xylan into oligosaccharides or xylose. The complete enzymatic hydrolysis of a xylan molecule requires several steps of enzymatic reactions. There are two enzymes acting on the main chain: β-1,4-xylanase (l,4-β-D-xylanohydrolase: EC3.1.2.8) and β-xylosidase (1,4-β-D-xylanxylohydrolase: EC3.2.1.37). Generally speaking, the former acts on the xylosidic bond from the inside of the main chain to decompose xylan into oligosaccharides, while the latter acts on the end of the oligoxylose to release xylose.

[0004] Many microorganisms can produce xylanases. The biochemical properties of xylanases are mainly obtained from the study of bacterial and fungal xylanases. Bacterial xylanases can be roughly divided into two categories: high molecular weight acid-resistant xylanases and low molecular weight alkali-resistant xylanases. However, there is no such difference in fungi, but the alkali resistance of low molecular weight xylanases is common.

[0005] Xylan in feed is difficult to be digested by monogastric animals. It also combines with a large amount of water, which increases the volume and viscosity of chyme in the digestive tract of the feeding animal, reduces the interaction between nutrients and endogenous enzymes in the digestive tract, and thus hinders the digestion and absorption of nutrients, especially fat and protein, and reduces the utilization rate of feed. Research results show that if xylanase is added to the feed, the molecular size of arabinoxylan can be significantly reduced, breaking it down into oligoxylose with a smaller degree of polymerization, thereby improving feed performance and eliminating or reducing the anti-nutritional effect caused by increased viscosity.

[0006] There have been studies on the application of xylanase in the production of wine and Japanese barley shochu. Japanese researchers applied acid-resistant xylanase Xy1C to the brewing of Japanese barley shochu and found that the enzyme helped improve fermentation efficiency and increase alcohol yield.

[0007] The application value of xylanase in the fields of papermaking, food, energy, feed and environment has been confirmed. However, due to the low expression level in natural materials, it is difficult to produce on a large scale, the product is difficult to purify, and some properties of xylan cannot fully meet the application requirements. With the development of genetic engineering technology, it has become a hot topic to improve its expression level by using bioreactors and modify xylanase genes at the molecular level to solve some defects of xylanase activity (such as specific enzyme activity, stress resistance, pH value, thermal stability, etc.) through genetic engineering. Summary of the invention

[0008] The purpose of the present invention is to provide a thermostable xylanase mutant and its application. The heat resistance of the mutant is significantly improved compared with the wild type, thus facilitating the wide application of xylanase in the feed field.

[0009] The present invention relates to a xylanase mutant comprising an amino acid sequence having at least 90% identity with SEQ ID NO: 1 and comprising an amino acid substitution at at least one position selected from the group consisting of 24, 25, 27, 41, 65, 160 compared to SEQ ID NO: 1.

[0010] In some embodiments of the invention, the amino acid sequence of the mutant is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identical to SEQ ID NO:1.

[0011] In some more specific embodiments, the amino acid sequence of the mutant is at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identical to SEQ ID NO:1.

[0012] In some embodiments of the present invention, the mutant comprises substitution of at least one amino acid in the following group: I24T, G25N, V27Y, T41V, S65N / Q, N160A / M / R.

[0013] In some embodiments of the present invention, the mutant comprises a substitution or a combination of substitutions selected from the following substitutions and combinations of substitutions: I24T; G25N; V27Y; T41V; S65N; S65Q; N160A; N160M; N160R;

[0014] I24T / G25N;

[0015] I24T / V27Y;

[0016] I24T / T41V;

[0017] I24T / S65N;

[0018] I24T / S65Q;

[0019] I24T / N160A;

[0020] I24T / N160M;

[0021] I24T / N160R;

[0022] G25N / V27Y;

[0023] G25N / T41V;

[0024] G25N / S65N;

[0025] G25N / S65Q;

[0026] G25N / N160A;

[0027] G25N / N160M;

[0028] G25N / N160R;

[0029] V27Y / T41V;

[0030] V27Y / S65N;

[0031] V27Y / S65Q;

[0032] V27Y / N160A;

[0033] V27Y / N160M;

[0034] V27Y / N160R;

[0035] T41V / S65N;

[0036] T41V / S65Q;

[0037] T41V / N160A;

[0038] T41V / N160M;

[0039] T41V / N160R;

[0040] S65N / N160A;

[0041] S65N / N160M;

[0042] S65N / N160R;

[0043] S65Q / N160A;

[0044] S65Q / N160M;

[0045] S65Q / N160R;

[0046] I24T / G25N / V27Y;

[0047] I24T / G25N / T41V;

[0048] I24T / G25N / S65N;

[0049] I24T / G25N / S65Q;

[0050] I24T / G25N / N160A;

[0051] I24T / G25N / N160M;

[0052] I24T / G25N / N160R;

[0053] I24T / V27Y / T41V;

[0054] I24T / V27Y / S65N;

[0055] I24T / V27Y / S65Q;

[0056] I24T / V27Y / N160A;

[0057] I24T / V27Y / N160M;

[0058] I24T / V27Y / N160R;

[0059] I24T / T41V / S65N;

[0060] I24T / T41V / S65Q;

[0061] I24T / T41V / N160A;

[0062] I24T / T41V / N160M;

[0063] I24T / T41V / N160R;

[0064] G25N / T41V / S65N;

[0065] G25N / T41V / S65Q;

[0066] G25N / T41V / N160A;

[0067] G25N / T41V / N160M;

[0068] G25N / T41V / N160R;

[0069] I24T / S65N / N160A;

[0070] I24T / S65N / N160M;

[0071] I24T / S65N / N160R;

[0072] I24T / S65Q / N160A;

[0073] I24T / S65Q / N160M;

[0074] I24T / S65Q / N160R;

[0075] G25N / S65N / N160A;

[0076] G25N / S65N / N160M;

[0077] G25N / S65N / N160R;

[0078] G25N / S65Q / N160A;

[0079] G25N / S65Q / N160M;

[0080] G25N / S65Q / N160R;

[0081] T41V / S65N / N160A;

[0082] T41V / S65N / N160M;

[0083] T41V / S65N / N160R;

[0084] T41V / S65Q / N160A;

[0085] T41V / S65Q / N160M;

[0086] T41V / S65Q / N160R;

[0087] I24T / G25N / V27Y / T41V;

[0088] I24T / G25N / V27Y / S65N;

[0089] I24T / G25N / V27Y / S65Q;

[0090] I24T / G25N / V27Y / N160A;

[0091] I24T / G25N / V27Y / N160M;

[0092] I24T / G25N / V27Y / N160R;

[0093] I24T / G25N / T41V / S65N;

[0094] I24T / G25N / T41V / S65Q;

[0095] I24T / G25N / T41V / N160A;

[0096] I24T / G25N / T41V / N160M;

[0097] I24T / G25N / T41V / N160R;

[0098] I24T / V27Y / T41V / S65N;

[0099] I24T / V27Y / T41V / S65Q;

[0100] I24T / V27Y / T41V / N160A;

[0101] I24T / V27Y / T41V / N160M;

[0102] I24T / V27Y / T41V / N160R;

[0103] G25N / V27Y / T41V / S65N;

[0104] G25N / V27Y / T41V / S65Q;

[0105] G25N / V27Y / T41V / N160A;

[0106] G25N / V27Y / T41V / N160M;

[0107] G25N / V27Y / T41V / N160R;

[0108] I24T / G25N / V27Y / T41V / S65N;

[0109] I24T / G25N / V27Y / T41V / S65Q;

[0110] I24T / G25N / V27Y / T41V / N160A;

[0111] I24T / G25N / V27Y / T41V / N160M;

[0112] I24T / G25N / V27Y / T41V / N160R;

[0113] I24T / G25N / V27Y / S65N / N160A;

[0114] I24T / G25N / V27Y / S65N / N160M;

[0115] I24T / G25N / V27Y / S65N / N160R;

[0116] I24T / G25N / V27Y / S65Q / N160A;

[0117] I24T / G25N / V27Y / S65Q / N160M;

[0118] I24T / G25N / V27Y / S65Q / N160R;I24T / G25N / T41V / S65N / N160A;

[0119] I24T / G25N / T41V / S65N / N160M;

[0120] I24T / G25N / T41V / S65N / N160R;

[0121] I24T / G25N / T41V / S65Q / N160A;

[0122] I24T / G25N / T41V / S65Q / N160M;

[0123] I24T / G25N / T41V / S65Q / N160R;

[0124] I24T / V27Y / T41V / S65N / N160A;

[0125] I24T / V27Y / T41V / S65N / N160M;

[0126] I24T / V27Y / T41V / S65N / N160R;

[0127] I24T / V27Y / T41V / S65Q / N160A;

[0128] I24T / V27Y / T41V / S65Q / N160M;

[0129] I24T / V27Y / T41V / S65Q / N160R;

[0130] G25N / V27Y / T41V / S65N / N160A;

[0131] G25N / V27Y / T41V / S65N / N160M;

[0132] G25N / V27Y / T41V / S65N / N160R;

[0133] G25N / V27Y / T41V / S65Q / N160A;

[0134] G25N / V27Y / T41V / S65Q / N160M;

[0135] G25N / V27Y / T41V / S65Q / N160R;

[0136] I24T / G25N / V27Y / T41V / S65N / N160A;

[0137] I24T / G25N / V27Y / T41V / S65N / N160M;

[0138] I24T / G25N / V27Y / T41V / S65N / N160R;

[0139] I24T / G25N / V27Y / T41V / S65Q / N160A;

[0140] I24T / G25N / V27Y / T41V / S65Q / N160M;

[0141] I24T / G25N / V27Y / T41V / S65Q / N160R.

[0142] The present invention also relates to a DNA molecule encoding the above xylanase mutant.

[0143] The present invention also relates to a recombinant expression vector comprising the above DNA molecule.

[0144] When the above expression vector is transferred into a host cell, the heat resistance of the recombinantly expressed xylanase mutant is significantly improved.

[0145] In some embodiments of the present invention, a host cell is provided, comprising the above-mentioned recombinant expression vector, which is a non-plant cell.

[0146] In some embodiments of the present invention, the host cell is Pichia pastoris.

[0147] In some embodiments of the present invention, the host cell is Trichoderma reesei.

[0148] The present invention also provides application of the xylanase mutant in the field of feed.

[0149] The present invention provides a mutant containing at least one mutation site among I24T, G25N, V27Y, T41V, S65N, S65Q, N160A, N160M and N160R based on the wild-type xylanase PT. Compared with the wild-type xylanase PT, the xylanase single-point mutant provided by the present invention has an enzyme activity residual rate increased by 13.1%-23.2% after being treated at 95°C for 5 minutes; among them, the xylanase mutant containing the S65N single-point mutation has the strongest heat resistance, and the enzyme activity residual rate is as high as 82.9%, achieving an unexpected technical effect.

[0150] In summary, the heat resistance of the xylanase mutant provided by the present invention is significantly improved, which is beneficial to reduce the production cost of xylanase and promote its wide application in the feed field. DETAILED DESCRIPTION

[0151] The present invention discloses a xylanase mutant, a preparation method and application thereof, a DNA molecule encoding the xylanase mutant, a vector, and a host cell. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve the desired effect. The method and application of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the method and application described herein without departing from the content, spirit and scope of the present invention to achieve and apply the technology of the present invention.

[0152] The present invention uses the conventional techniques and methods used in the field of genetic engineering and molecular biology, such as MOLECΜLAR CLONING: A LABORATORY MANUAL, 3rd Ed. (Sambrook, 2001) and CURRENT PROTOCOLS INMOLECΜLAR BIOLOGY (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can adopt other conventional methods, experimental schemes and reagents in this area on the basis of the technical solutions recorded in the present invention, without being limited to the limitations of the specific embodiments of the present invention. For example, the present invention can select the following experimental materials and reagents:

[0153] Strains and vectors: Escherichia coli DH5α, Pichia pastoris GS115, vectors pPIC9k, Amp, and G418 were purchased from Invitrogen.

[0154] Enzymes and kits: PCR enzyme and ligase were purchased from Takara, restriction endonucleases were purchased from Fermentas, plasmid extraction kit and gel purification recovery kit were purchased from Omega, and GeneMorph II random mutagenesis kit was purchased from Beijing Bomeis Biotechnology Co., Ltd.

[0155] Culture medium formula:

[0156] Escherichia coli culture medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0;

[0157] Yeast medium (YPD medium): 1% yeast extract, 2% peptone, 2% glucose;

[0158] Yeast screening medium (MD medium): 2% peptone, 2% agarose;

[0159] BMGY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 1% glycerol;

[0160] BMMY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 0.5% methanol;

[0161] LB-AMP medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100 μg / mL ampicillin, pH 7.0;

[0162] LB-AMP plates: 0.5% yeast extract, 1% peptone, 1% NaCl, 1.5% agar, 100 μg / mL ampicillin, pH 7.0;

[0163] The present invention will be further described below in conjunction with embodiments:

[0164] Example 1 Construction of recombinant plasmid

[0165] The synthesized xylanase gene (GeneBank MK138894.1) was optimized according to the codon preference of Pichia pastoris, and 6 bases GAATTC (EcoR I restriction site) were added before its start codon ATG, and GCGGCCGC (Not I restriction site) was added after its stop codon TAA. The optimized nucleotide sequence was synthesized by Shanghai Jierui Bioengineering Co., Ltd. The xylanase was named PT, its amino acid sequence is SEQ ID NO: 1, and the encoding nucleotide sequence is SEQ ID NO: 2.

[0166] The xylanase gene was digested with restriction endonucleases EcoR I and Not I (Fermentas); at the same time, the plasmid pPIC9K was digested with restriction endonucleases EcoR I and Not I. The digestion products were purified using a gel purification kit and ligated with T4 DNA ligase (Fermentas). The ligation products were transformed into DH5α Escherichia coli (Invitrogen) and selected with ampicillin. To ensure accuracy, several clones were sequenced (Sangon).

[0167] The plasmid was purified from the E. coli clone with the correct sequencing results using a plasmid miniprep kit (Omega) to obtain a recombinant plasmid, which was named pPIC9K-PT.

[0168] Example 2 Screening of thermotolerant xylanase mutants

[0169] In order to further improve the enzymatic activity of xylanase PT, the applicant analyzed its protein structure. The protein is a GHI1 family xylanase, and its structure is a β-jelly roll structure. The applicant screened a large number of mutations of the enzyme through directed evolution technology.

[0170] 1.1 Design PCR primers PT-F1, PT-R1:

[0171] PT-F1: GGC GAATTC CAAAGTTTCTGTAGTTCAGCTTCTC (the underline indicates the restriction endonuclease EcoRI recognition site);

[0172] PT-R1: ATA GGCGGCCG CTTATCATTAATCACCAATGTAAACCTT (the underline indicates the recognition site of restriction endonuclease NotI).

[0173] The PT gene (SEQ ID NO: 2) was used as a template and PCR amplification was performed using the above primers using a GeneMorph II random mutation PCR kit (Bomais). The PCR product was recovered from the gel, digested with EcoRI and NotI, and ligated with the pET21a vector digested with the same enzymes, transformed into Escherichia coli BL21 (DE3), spread on an LB+Amp plate, and cultured inverted at 37°C. After the transformants appeared, they were picked up one by one with a toothpick into a 96-well plate, 150 μL of LB+Amp medium containing 0.1 mM IPTG was added to each well, and the cells were cultured at 37°C and 220 rpm for about 6 h. The supernatant was discarded after centrifugation, and the cells were resuspended in a buffer solution, and the cells were repeatedly frozen and thawed to break the cell wall to obtain an Escherichia coli cell lysate containing xylanase.

[0174] 30 μL of lysate was taken out to two new 96-well plates, one of which was treated at 95°C for 5 min. 30 μL of substrate was added to both 96-well plates. After reacting at 37°C for 30 min, the reducing sugar generated was determined by DNS method. Different mutants maintained different activities after high temperature treatment.

[0175] The experimental results show that some mutations have no effect on the heat resistance of xylanase, and some mutations even make its heat resistance or enzyme activity worse; some other mutations, although they can improve the temperature tolerance of xylanase, their enzymatic properties have changed significantly after mutation, which do not meet the requirements. Finally, the mutation sites that can significantly improve the heat resistance of xylanase without affecting its enzyme activity and original enzymatic properties were obtained: I24T, G25N, V27Y, T41V, S65N, S65Q, N160A, N160M, N160R.

[0176] Based on the above wild-type xylanase PT, the present invention provides mutants containing single mutation sites of I24T, G25N, V27Y, T41V, S65N, S65Q, N160A, N160M and N160R respectively.

[0177] Example 3 Expression of xylanase in Pichia pastoris 3.1 Construction of expression vector

[0178] The gene sequences of xylanase PT and its mutants were optimized according to the codon preference of Pichia pastoris and synthesized by Shanghai Jierui Bioengineering Co., Ltd., and two restriction sites, EcoRI and NotI, were added to the 5' and 3' ends of the synthetic sequence, respectively.

[0179] According to the method described in Example 1, the gene sequences of the synthesized xylanase PT and its mutants were double-digested with EcoRI and NotI, and then connected with the pPIC-9K vector digested with the same enzymes at 16°C overnight, and transformed into Escherichia coli DH5a, coated on LB+Amp plates, and inverted cultured at 37°C. After the transformants appeared, colony PCR (reaction system: template-picked single clone, rTaqDNA polymerase 0.5μL, 10×Buffer 2.0μL, dNTPs (2.5mM) 2.0μL, 5'AOX primer (10mM): 0.5μL, 3'AOX primer: 0.5μL, ddH2O 14.5μL, reaction procedure: 95°C pre-denaturation 5min, 30 cycles: 94°C 30sec, 55°C 30sec, 72°C 2min, 72°C 10min). The positive clones were verified, and the correct recombinant expression plasmid was obtained after sequencing verification.

[0180] 3.2 Construction of Pichia pastoris engineered strains

[0181] 3.2.1 Preparation of competent yeast

[0182] The Pichia pastoris GS115 strain was activated on a YPD plate and cultured at 30°C for 48 h. After that, the activated GS115 single clone was inoculated into 6 mL YPD liquid medium. After culturing at 30°C and 220 rpm for about 12 h, the bacterial solution was transferred to a 30 mL The cells were cultured in a conical flask of YPD liquid culture medium at 30°C and 220 rpm for about 5 h. The cell density was detected by ultraviolet spectrophotometer. When the OD600 value was in the range of 1.1-1.3, 4 mL of cells were collected into sterilized EP tubes by centrifugation at 4°C and 9000 rpm for 2 min. The remaining supernatant was absorbed with sterilized filter paper, and the cells were resuspended with 1 mL of precooled sterile water. The cells were centrifuged at 4°C and 9000 rpm for 2 min, the supernatant was discarded, and the cells were washed with 1 mL of sterile water repeatedly. The cells were centrifuged at 4°C and 9000 rpm for 2 min, the supernatant was discarded, and the cells were resuspended with 1 mL of precooled sorbitol (1 mol / L); the cells were centrifuged at 4°C and 9000 rpm for 2 min, the supernatant was discarded, and the cells were gently resuspended with 100-150 μL of precooled sorbitol (1 mol / L).

[0183] 3.2.2 Transformation and screening

[0184] The recombinant expression plasmids constructed in 3.1 were linearized with Sac I, and the linearized fragments were purified and recovered and transformed into Pichia pastoris GS115 by electroporation. The recombinant strains of Pichia pastoris were screened on MD plates, and then multi-copy transformants were screened on YPD plates containing different concentrations of geneticin (0.5 mg / mL-8 mg / mL).

[0185] The obtained transformants were transferred to BMGY medium, shaken and cultured at 30°C and 250rpm for 1 day; then transferred to BMMY medium, shaken and cultured at 30°C and 250rpm; 0.5% methanol was added every day to induce expression for 4 days; the bacteria were removed by centrifugation at 9000rpm for 10 minutes to obtain fermentation supernatants containing xylanase PT and xylanase mutants, respectively.

[0186] 1. Xylanase activity determination method

[0187] (1) Definition of xylanase activity unit

[0188] Under the conditions of 37°C and pH 5.5, the amount of enzyme required to release 1 μmol of reducing sugar from a 5 mg / mL xylan solution per minute is one enzyme activity unit U.

[0189] (2) Enzyme activity determination method

[0190] Take 2mL of 1% xylan substrate (prepared with pH5.5 acetic acid-sodium acetate buffer), add it to a colorimetric tube, balance at 37℃ for 10min, then add 2mL of acid xylanase solution appropriately diluted with pH5.5 acetic acid-sodium acetate buffer and balanced at 37℃, mix well at 37℃, and react for 30min. After the reaction is completed, add 5mL of DNS reagent and mix well to terminate the reaction. Then boil in a boiling water bath for 5min, cool to room temperature with tap water, add distilled water to 25mL, mix well, use the standard blank sample as the blank control, and measure the absorbance value A at 540nm E .

[0191] Enzyme activity calculation formula:

[0192] X D =[(A E -A B )×K+C0]×N×1000 / (M×t).

[0193] Where: X D is the activity of xylanase in the diluted enzyme solution, U / mL; A E is the absorbance of the enzyme reaction solution; A B is the absorbance of the enzyme blank solution; K is the slope of the standard curve; C O is the intercept of the standard curve; M is the molar mass of xylose, 150.2 g / mol; t is the enzymatic reaction time, min; N is the enzyme solution dilution multiple; 1000 is the conversion factor, 1 mmol = 1000 μmol.

[0194] (3) Enzyme activity assay results

[0195] The enzyme activity was tested according to the above method, and the results showed that the enzyme activity of the fermentation supernatant of the Pichia pastoris recombinant strain expressing xylanase PT and its mutants constructed above was 330-790 U / mL.

[0196] Example 4 Analysis of the heat resistance of xylanase mutants

[0197] The fermentation supernatant of the Pichia recombinant strain expressing xylanase PT and its mutants described in Example 3 was diluted to about 20 U / mL with acetic acid-sodium acetate buffer at pH 5.5, and the residual enzyme activity was determined after treatment at 95°C for 5 minutes. The enzyme activity of the untreated sample was taken as 100%, and the residual enzyme activity rate was calculated. The specific results are shown in Table 1.

[0198] Table 1 Analysis of thermotolerance of xylanase single point mutants

[0199] Xylanase mutants Residual enzyme activity after 95℃ treatment for 5 min Wild-type PT 67.3％ I24T 80.0％ G25N 82.7％ V27 77.6％ T41V 81.6％ S65N 82.9％ S65Q 82.1％ N160A 76.5％ N160M 77.5％ N160R 76.1％

[0200] From the results in Table 1, it can be seen that compared with the wild-type xylanase PT, the xylanase mutants provided by the present invention, which respectively contain single-point mutations of I24T, G25N, V27Y, T41V, S65N, S65Q, N160A, N160M, and N160R, have an enzyme activity residual rate increased by 13.1%-23.2% after being treated at 95°C for 5 minutes; among them, the xylanase mutant containing the single-point mutation of S65N has the strongest heat resistance, with an enzyme activity residual rate of up to 82.9%. This shows that the I24T, G25N, V27Y, T41V, S65N, S65Q, N160A, N160M, and N160R mutation sites provided by the present invention can significantly improve the heat resistance of xylanase PT, and achieve unexpected technical effects.

[0201] In summary, the xylanase mutant provided by the present invention has stronger heat resistance and is more suitable for use as a feed additive than the wild type.

Claims

1. A xylanase mutant, characterized in that The mutant is a xylanase having an amino acid sequence of SEQ ID NO: 1, comprising a substitution of amino acid 41: T41V.

2. The xylanase mutant according to claim 1, characterized in that The mutant further comprises substitution of at least one amino acid in the following group: I24T, G25N, V27Y, S65N / Q, N160A / M / R.

3. The xylanase mutant according to claim 2, characterized in that The mutant comprises a substitution combination of at least one amino acid in the following group: I24T / T41V; G25N / T41V; V27Y / T41V; T41V / S65N; T41V / S65Q; T41V / N160A; T41V / N160M; T41V / N160R; I24T / G25N / T41V; I24T / V27Y / T41V; I24T / T41V / S65N; I24T / T41V / S65Q; I24T / T41V / N160A; I24T / T41V / N160M; I24T / T41V / N160R; G25N / T41V / S65N; G25N / T41V / S65Q; G25N / T41V / N160A; G25N / T41V / N160M; G25N / T41V / N160R; T41V / S65N / N160A; T41V / S65N / N160M; T41V / S65N / N160R; T41V / S65Q / N160A; T41V / S65Q / N160M; T41V / S65Q / N160R; I24T / G25N / V27Y / T41V; I24T / G25N / T41V / S65N; I24T / G25N / T41V / S65Q; I24T / G25N / T41V / N160A; I24T / G25N / T41V / N160M; I24T / G25N / T41V / N160R; I24T / V27Y / T41V / S65N; I24T / V27Y / T41V / S65Q; I24T / V27Y / T41V / N160A; I24T / V27Y / T41V / N160M; I24T / V27Y / T41V / N160R; G25N / V27Y / T41V / S65N; G25N / V27Y / T41V / S65Q; G25N / V27Y / T41V / N160A; G25N / V27Y / T41V / N160M; G25N / V27Y / T41V / N160R; I24T / G25N / V27Y / T41V / S65N; I24T / G25N / V27Y / T41V / S65Q; I24T / G25N / V27Y / T41V / N160A; I24T / G25N / V27Y / T41V / N160M; I24T / G25N / V27Y / T41V / N160R; I24T / G25N / T41V / S65Q / N160A; I24T / G25N / T41V / S65Q / N160M; I24T / G25N / T41V / S65Q / N160R; I24T / V27Y / T41V / S65N / N160A; I24T / V27Y / T41V / S65N / N160M; I24T / V27Y / T41V / S65N / N160R; I24T / V27Y / T41V / S65Q / N160A; I24T / V27Y / T41V / S65Q / N160M; I24T / V27Y / T41V / S65Q / N160R; G25N / V27Y / T41V / S65N / N160A; G25N / V27Y / T41V / S65N / N160M; G25N / V27Y / T41V / S65N / N160R; G25N / V27Y / T41V / S65Q / N160A; G25N / V27Y / T41V / S65Q / N160M; G25N / V27Y / T41V / S65Q / N160R; I24T / G25N / V27Y / T41V / S65N / N160A; I24T / G25N / V27Y / T41V / S65N / N160M; I24T / G25N / V27Y / T41V / S65N / N160R; I24T / G25N / V27Y / T41V / S65Q / N160A; I24T / G25N / V27Y / T41V / S65Q / N160M; I24T / G25N / V27Y / T41V / S65Q / N160R.

4. A DNA molecule encoding the xylanase mutant according to any one of claims 1 to 3.

5. A recombinant expression plasmid comprising the DNA molecule of claim 4.

6. A host cell, characterized in that The host cell comprises the recombinant expression plasmid according to claim 5; the host cell is a non-plant cell.

7. The host cell according to claim 6, characterized in that The host cell is Pichia pastoris ( Pichia pastoris ) or Trichoderma reesei ( Trichoderma reesei ).

8. Use of the xylanase mutant according to any one of claims 1 to 3 in the field of feed.