Construction method of zebra fish elovl61 gene mutant

Abstract

The invention provides a construction method of zebra fish elovl61 gene mutants, and relates to the technical field of gene engineering. The sgRNA is targeted to an elovl61 gene of the zebra fish; comprising a nucleotide sequence as shown in SEQ ID NO.1. The sgRNA provided by the invention provides an accurate gene editing tool, and can guide Cas9 enzyme to accurately target and edit a specific gene elovl61 in a zebra fish genome, which is crucial for constructing a zebra fish model for simulating human diseases. The model not only can enhance the understanding of the effect of a specific gene in early embryonic development, but also is helpful for researching human disease mechanisms and testing potential treatment methods, so that the cost is reduced and the research efficiency is improved in pharmacological experiments and drug screening.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and in particular to a method for constructing a zebrafish elovl6l gene mutant. Background Art

[0002] The development of genetic engineering technology has greatly promoted the progress of life sciences, especially in the study of gene function and the construction of disease models. Genetic engineering technology allows scientists to precisely modify the genome of an organism to study the function of a specific gene or simulate human diseases. These technologies not only deepen our understanding of the life development process, but also provide important tools for new drug development and disease treatment.

[0003] In the field of model organism research, zebrafish has become an ideal model for studying vertebrate development due to its high homology with human genes and similarity in early embryonic development. Zebrafish are small in size, easy to raise, have strong fertility, and their embryos are transparent and easy to observe. These characteristics have made them widely used in toxicology, pharmacology, pathology, and new drug screening. The zebrafish gene is 87% similar to the human gene, which makes the research results obtained through the zebrafish model have a high potential for transformation.

[0004] Although the zebrafish model has obvious advantages in biomedical research, existing technologies still have limitations in terms of gene editing efficiency and accuracy. CRISPR / Cas9 technology is currently the mainstream gene editing tool. Although it has been successful in many species, its editing efficiency and specificity in zebrafish still need to be improved. In addition, there is insufficient research on abnormal embryonic development after gene editing, which limits the ability to deeply understand gene function and disease mechanisms.

[0005] The application of existing technologies in zebrafish gene editing also faces other challenges. For example, the embryo screening and verification process after gene editing is complicated and time-consuming, which increases research costs and time. In addition, off-target effects caused by gene editing may lead to unexpected gene mutations, which not only affects the accuracy of research results, but may also have adverse effects on the health and development of zebrafish.

[0006] In terms of specific gene function research, existing technologies have not fully explored the function of the elovl6l gene in zebrafish. The elovl6l gene is related to fatty acid synthesis and may play an important role in embryonic development and disease occurrence. However, there is currently a lack of knockout studies on this gene, which limits the understanding of its function in zebrafish. In addition, existing technologies have failed to directly link elovl6l gene mutations to abnormal embryonic development, which limits the study of related disease mechanisms and the development of new therapies.

[0007] In summary, existing technologies have limitations in efficiency, accuracy, and scope of application in zebrafish gene editing and disease model construction. These challenges not only affect the depth and breadth of gene function research, but also limit the application potential of zebrafish models in new drug development and disease treatment research. Therefore, the development of more efficient and accurate gene editing technologies, as well as improved embryo screening and verification methods after gene editing, are crucial to promoting the application of zebrafish models in biomedical research.

[0008] In view of this, the present invention is proposed. Summary of the invention

[0009] The purpose of the present invention is to provide a method for constructing a zebrafish elovl6l gene mutant. The sgRNA in this application provides an accurate, efficient and economical method to study gene function and disease mechanism, while promoting the development of new therapies and the diagnosis of pathological characteristics.

[0010] In order to achieve the above-mentioned purpose of the present invention, the following technical solutions are particularly adopted:

[0011] In a first aspect, the present invention provides an sgRNA, which targets the zebrafish elovl6l gene; the sgRNA comprises a nucleotide sequence as shown in SEQ ID NO.1.

[0012] In a second aspect, the present invention provides a primer set, which is used to construct a gRNA in vitro transcription template for synthesizing the sgRNA as described in the above embodiment, comprising a forward primer and a reverse primer;

[0013] The nucleotide sequence of the forward primer is shown in SEQ ID NO.2;

[0014] The nucleotide sequence of the reverse primer is shown in SEQ ID NO.3.

[0015] In a third aspect, the present invention provides a method for constructing a zebrafish elovl6l gene mutant, comprising:

[0016] Using the primer set described in the above embodiment, a PCR reaction is performed with pMD19T-gRNA as a template for the PCR reaction, the PCR product is purified and recovered to obtain a purified product, and the purified product is used as a gRNA in vitro transcription template;

[0017] The gRNA in vitro transcription template is transcribed in vitro using T7 transcriptase to obtain the purified sgRNA as described in the above embodiment;

[0018] Mixing the sgRNA and Cas9 mRNA to obtain a CRISPR / Cas9 injection mixture, and microinjecting the CRISPR / Cas9 injection mixture into a zebrafish one-cell stage fertilized egg;

[0019] Cultivating the fertilized egg injected with the CRISPR / Cas9 injection mixture to develop a target embryo;

[0020] Based on the target embryos, elovl6l deletion mutant zebrafish are obtained as the zebrafish model of abnormal early embryonic development.

[0021] In an optional embodiment, the number of zebrafish one-cell stage fertilized eggs microinjected is 200 to 500.

[0022] In an optional embodiment, the fertilized egg injected with the CRISPR / Cas9 injection mixture is cultured to develop a target embryo, comprising:

[0023] After the microinjection is completed, the fertilized eggs are cultured for the first time to obtain primary cultured embryos;

[0024] collecting the primary cultured embryos and performing a second culture to obtain secondary cultured embryos;

[0025] Extracting genomic DNA from the secondary cultured embryos, and using a screening primer set to perform PCR amplification on the target site sequence of the target site targeted by the sgRNA sequence contained in the genomic DNA, and performing sequencing using a forward screening primer in the screening primer set to obtain a sequencing result;

[0026] According to the sequencing results, the secondary cultured embryos showing chaotic peaks near the target site are screened out as the target embryos.

[0027] In an optional embodiment, the target site targeted by the sgRNA sequence is located on exon 2 of the elovl6l gene.

[0028] In an optional embodiment, the site sequence of the target site targeted by the sgRNA sequence is shown as SEQ ID No.4.

[0029] In an optional embodiment, the screening primer set includes the forward screening primer and the reverse screening primer;

[0030] The nucleotide sequence of the forward screening primer is shown in SEQ ID NO.5;

[0031] The nucleotide sequence of the reverse screening primer is shown in SEQ ID NO.6.

[0032] In an optional embodiment, obtaining the elovl6l deletion mutant zebrafish according to the target embryo as the zebrafish model of early embryonic developmental abnormalities comprises:

[0033] Raising the target embryos to sexual maturity using a breeding system to obtain mature embryos;

[0034] The next generation of embryos of the mature embryos is screened for embryos with effective mutation types, and the elovl6l deletion mutant zebrafish is cultured to obtain the zebrafish model of abnormal early embryonic development.

[0035] In a fourth aspect, the present invention provides a use of the sgRNA as described in the aforementioned embodiment in constructing a zebrafish model of early embryonic developmental abnormalities.

[0036] In a fifth aspect, the present invention provides an application of the zebrafish elovl6l gene targeted by sgRNA as described in the aforementioned embodiment in preparing a zebrafish model of early embryonic development.

[0037] The sgRNA provided in this application provides a precise gene editing tool that can guide the Cas9 enzyme to accurately target and edit the specific gene elovl6l in the zebrafish genome, which is essential for building a zebrafish model that simulates human diseases. This model can not only enhance the understanding of the role of specific genes in early embryonic development, but also help study the mechanisms of human diseases and test potential treatments, thereby reducing costs and improving research efficiency in pharmacological experiments and drug screening. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0039] Figure 1 Schematic diagram of the process for constructing a zebrafish elov161 gene mutant in the embodiment of the present application;

[0040] Figure 2 A schematic diagram of the sequence of the target site of the elovl6l gene in Example 6 of the present application (including a peak diagram of the sequencing result of the mutation site and a schematic diagram of the wild-type and predicted mutant elovl6l protein structure);

[0041] Figure 3This is a diagram showing the results of analyzing the fatty acid composition of elovl6l using elovl6l gene mutant zebrafish embryos as materials in Example 6 of the present application;

[0042] Figure 4 Schematic diagram of RNA in situ hybridization analysis of elovl6l gene using elovl6l mutant zebrafish embryos as materials in Example 6 of the present application;

[0043] Figure 5 This is a schematic diagram of embryonic development observation using elovl6l mutant zebrafish embryos as materials in Example 6 of the present application;

[0044] Figure 6 Schematic diagram of fluorescence analysis of DAPI and H2A-GFP of elovl6l mutant zebrafish embryos in Example 6 of the present application. DETAILED DESCRIPTION

[0045] The embodiments of the present invention will be described in detail below in conjunction with the examples, but it will be appreciated by those skilled in the art that the following examples are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. If no specific conditions are specified in the examples, the conditions are carried out according to normal conditions or the conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be obtained commercially.

[0046] An sgRNA is provided in an embodiment of the present application, wherein the sgRNA targets the zebrafish elovl6l gene; the sgRNA comprises a nucleotide sequence as shown in SEQ ID NO.1.

[0047] sgRNA, or single guide RNA, is a key component of CRISPR / Cas9 gene editing technology. sgRNA is a man-made RNA molecule that consists of two parts: one is a guide sequence (about 20 base pairs) that can recognize and bind to the target DNA sequence, and the other is a domain that can bind to the Cas9 enzyme.

[0048] In this application, sgRNA (single guide RNA) is an RNA molecule specifically designed to recognize and target a specific sequence of the elovl6l gene in the zebrafish genome. This specific sgRNA sequence is constructed to complementarily pair with a specific DNA sequence on exon 2 of the elovl6l gene, thereby guiding the Cas9 enzyme to precisely cut a specific location of the gene.

[0049] As mentioned above, the nucleotide sequence of sgRNA is shown in SEQ ID NO. 1. Specifically: 5`-GGTGGTATTACATCTCCAAGGGGTTTTAGAGCTAGAAATAGCAAGT TAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCT-3`.

[0050] In the present application, a primer set is provided, which is used to construct a gRNA in vitro transcription template for synthesizing the sgRNA described in the above embodiment, and includes a forward primer and a reverse primer. The specific examples are shown in Table 1.

[0051] Table 1. Nucleotide sequences of primer sets

[0052] name SEQ ID NO. Nucleotide sequence (5`-3`) Forward Primer 2 taatacgactcactataGTGTATGTAGTGCTTGTGTTgttttagagctagaa Reverse primer 3 AAAAAAAGCACCGACTCGGTGCCAC

[0053] refer to Figure 1 The present application provides a method for constructing a zebrafish elov161 gene mutant, comprising:

[0054] Step S1, using the primer set described in the above embodiment, performing a PCR reaction with pMD19T-gRNA as a template for the PCR reaction, purifying and recovering the PCR product to obtain a purified product, and using the purified product as a gRNA in vitro transcription template.

[0055] As mentioned above, pMD19T-gRNA is a plasmid vector used to clone and express single guide RNA (sgRNA) in the CRISPR / Cas9 system.

[0056] In the above, the aforementioned primer set was used to perform a PCR reaction with pMD19T-gRNA as a template. The pMD19T-gRNA plasmid containing the sgRNA sequence was PCR amplified using a forward primer (SEQ ID NO.2) and a reverse primer (SEQ ID NO.3) to obtain a DNA fragment containing the sgRNA sequence.

[0057] This step can accurately amplify the target sgRNA sequence and provide a template for subsequent in vitro transcription.

[0058] As mentioned above, the PCR product is purified and recovered, that is, a pure DNA fragment containing the sgRNA sequence is extracted from the PCR reaction mixture to obtain a purified sgRNA template DNA. In this step, impurities in the PCR reaction, such as unbound primers, enzymes, and salts, are removed to provide a clean template for in vitro transcription. This step can use a commercial PCR product purification kit such as GeneJET PCR Purification Kit (Thermo Fisher, K0701).

[0059] Step S2, in vitro transcription of the gRNA in vitro transcription template using T7 transcriptase to obtain the purified sgRNA as described in the above embodiment.

[0060] As mentioned above, T7 transcriptase (T7 RNA polymerase), referred to as T7 RNAP or T7 Pols, is an enzyme from Escherichia coli bacteriophage T7. It is a strong and specific RNA polymerase used to synthesize RNA under in vitro conditions.

[0061] As described above, the purified product is used as a template for gRNA in vitro transcription, and T7 transcriptase is used for in vitro transcription. T7 RNA polymerase is used to transcribe sgRNA from the purified DNA template, thereby obtaining a large number of sgRNA molecules. sgRNA is efficiently produced to provide sufficient RNA molecules for gene editing.

[0062] Specifically, you can use an in vitro transcription kit such as the T7 High Yield RNA Transcription Kit (TR101-01) from Novartis, and follow the manufacturer's instructions. The transcribed product is digested with DNase I. The digested product is stained with SigmaSpin TM Sequencing reaction cleanup kit (Sigma, S5059-70EA) was used for purification and recovery, and the operation method was carried out according to the kit instructions;

[0063] Step S3, mixing the sgRNA and Cas9 mRNA to obtain a CRISPR / Cas9 injection mixture, and microinjecting the CRISPR / Cas9 injection mixture into a zebrafish one-cell stage fertilized egg.

[0064] As mentioned above, Cas9 mRNA refers to the messenger RNA that encodes the Cas9 protein. In the CRISPR / Cas9 gene editing system, the Cas9 protein is a nuclease that can recognize and cut specific DNA sequences. The role of Cas9 mRNA is to deliver the genetic information of the Cas9 protein to cells, allowing the cells to translate and produce the Cas9 protein. The mixing of Cas9 mRNA and sgRNA is to quickly form an effective CRISPR / Cas9 gene editing complex in cells, thereby accurately targeting and editing specific gene sequences. This method plays an important role in improving the efficiency and accuracy of gene editing.

[0065] As described above, in this step, sgRNA and Cas9 mRNA are mixed to obtain a CRISPR / Cas9 injection mixture. sgRNA is combined with Cas9 mRNA to form a complex that can be injected into a fertilized egg, thereby obtaining a CRISPR / Cas9 injection mixture.

[0066] This step is used to ensure that the sgRNA and Cas9 enzyme can enter the cell and function at the same time, which can be done by physically mixing the sgRNA and Cas9 mRNA solutions.

[0067] Step S4, culturing the fertilized egg injected with the CRISPR / Cas9 injection mixture to develop a target embryo.

[0068] In the above, the fertilized eggs injected with the CRISPR / Cas9 injection mixture are cultured. The fertilized eggs are cultured under suitable conditions to develop into embryos, thereby obtaining developing embryos. In this step, the gene-edited embryos are allowed to develop normally for subsequent screening and analysis.

[0069] Step S5, obtaining elovl6l deletion mutant zebrafish according to the target embryo as the zebrafish model of early embryonic developmental abnormalities.

[0070] As described above, elovl6l deletion mutant zebrafish were obtained based on the target embryos, and zebrafish with successfully edited elovl6l gene were screened from the cultured embryos, thereby obtaining a zebrafish model with elovl6l gene deletion mutation.

[0071] Specifically, zebrafish carrying specific mutations are screened through molecular biology techniques, such as PCR and sequencing.

[0072] The present application provides a method for constructing a zebrafish model of early embryonic development abnormality caused by elovl6l gene mutation, comprising the following steps: first, designing and synthesizing sgRNA targeting exon 2 of zebrafish elovl6l gene; then, constructing a gRNA in vitro transcription template by PCR method, and performing in vitro transcription and purification to obtain sgRNA; then, mixing the purified sgRNA with Cas9 mRNA to form a CRISPR / Cas9 injection mixture; then, microinjecting the mixture into zebrafish one-cell stage fertilized eggs; then, culturing the fertilized eggs injected with the CRISPR / Cas9 mixture to obtain target embryos; finally, by screening these embryos, obtaining homozygous mutants of elovl6l gene, and constructing a zebrafish model of early embryonic development abnormality. This method allows researchers to accurately study the effects of elovl6l gene mutation on early embryonic development, and provides a valuable model system for related disease research and drug development.

[0073] In the embodiments of the present application, an efficient, low-cost and reliable method is provided to construct an animal model of early embryonic developmental abnormalities, which significantly reduces the cost of pharmacological experiments and drug screening, and promotes in-depth research on the mechanism of early embryonic developmental abnormalities, laying a foundation for the development of new treatment methods. In addition, the present invention establishes a set of systematic pathological feature diagnostic methods, which helps to reveal the occurrence and development rules of early embryonic developmental abnormalities and provides a scientific basis for related medical practices. Using the elovl6l gene deletion mutant zebrafish as an experimental animal model, the present invention can induce a frameshift mutation on exon 2 of the gene, resulting in a variation in the catalytic functional domain of the elovl6l protein and premature termination of translation, thereby simulating a pathological process that is highly similar to human diseases, providing an accurate experimental system for studying disease mechanisms, and has important scientific and clinical value.

[0074] In addition, it should be noted that before step S1, the method may further include the steps of respectively designing the sgRNA sequence and the primer set. Specifically, the steps may be:

[0075] Step S6, according to the CRISPER / Cas9 knockout principle, design and synthesize the sgRNA sequence of the elovl6l gene target site, wherein the sgRNA has a nucleotide sequence as shown in SEQ ID NO.1;

[0076] Step S7, synthesizing PCR primers for constructing a synthetic sgRNA template, wherein the primer sequence includes a forward primer sequence such as SEQ ID NO.2 and a reverse primer sequence such as SEQ ID NO.3;

[0077] The above two steps can be performed either one at a time or simultaneously.

[0078] In addition, further, after step S5, the embodiment of the present application may further include the following steps:

[0079] Step S8, taking the young zebrafish model with abnormal early embryonic development in step S5 to perform elovl6l gene expression analysis;

[0080] Step S9, taking the embryos of the zebrafish model with abnormal early embryonic development in step S5 to perform fatty acid composition analysis of the elovl6l gene;

[0081] Step S10, taking the embryos of the zebrafish model with abnormal early embryonic development in step S5 and performing RNA in situ hybridization observation;

[0082] Step S11, taking the early embryos of the zebrafish model with abnormal early embryo development in step S5 for immunofluorescence analysis;

[0083] Step S12, describing the early embryonic development of the elovl6l deletion mutant zebrafish by analyzing the data obtained in steps S8-11.

[0084] In some embodiments, the number of microinjected into zebrafish one-cell stage fertilized eggs is 200 to 500. For example, the number can be 200, 300, 400, 500, and so on.

[0085] In the above-mentioned experiment of constructing a zebrafish model, the CRISPR / Cas9 injection mixture was microinjected into 200 to 500 zebrafish one-cell stage fertilized eggs to achieve the purpose of gene editing. This number range can be determined based on the needs of the experimental design and actual operating conditions.

[0086] In some embodiments, the step S4, culturing the fertilized egg injected with the CRISPR / Cas9 injection mixture to develop a target embryo, comprises:

[0087] Step S41, after completing the microinjection, the fertilized eggs are cultured for the first time to obtain primary cultured embryos.

[0088] As mentioned above, after completing the microinjection, the fertilized eggs are cultured for the first time to obtain primary cultured embryos. After the CRISPR / Cas9 injection mixture is injected into the single-cell stage fertilized eggs, these fertilized eggs are placed in a suitable culture environment to allow them to develop. Primary cultured embryos are obtained. This step ensures that the embryos can develop normally after gene editing at the fertilized egg stage.

[0089] Specifically, the culture can be carried out under controlled temperature and culture medium conditions, and the culture time can be, for example, 24 hours.

[0090] Step S42, collecting the primary cultured embryos and performing a second culture to obtain secondary cultured embryos.

[0091] In the above, the embryos of the primary culture are collected and cultured for the second time to obtain secondary culture embryos. Healthy individuals are selected from the embryos of the first culture and cultured further to obtain further developed embryos.

[0092] This step is used to screen out healthy embryos and provide materials for subsequent gene editing effect testing.

[0093] Specifically, the culture may continue in a suitable culture environment, and the culture time may be 24 hours.

[0094] For example, the culture environment in this step is to place some of the one-cell stage zebrafish fertilized eggs after microinjection in 0.3x Danieauˋs buffer.

[0095] As mentioned above, in the embodiments of the present application, two culturing steps (each lasting 24 hours) are performed to ensure that the fertilized eggs have enough time to develop into embryos that can be analyzed for gene editing effects.

[0096] First, the first culture allows the fertilized egg to develop from the single-cell stage to the multi-cell stage, which is a critical period for early embryonic development, and provides enough time for the CRISPR / Cas9 system to work in the cell, including the cutting and repair process of DNA, which may lead to insertion or deletion mutations. The subsequent second culture further ensures that the embryo develops to a stage suitable for genotyping analysis, which is crucial for subsequent PCR amplification and sequencing analysis because sufficient embryonic tissue is required to extract high-quality genomic DNA. In addition, by culturing twice, embryos that may be damaged in early development due to injection pressure or other environmental factors can be screened out, thereby improving the accuracy of subsequent gene editing effect analysis. This culture strategy may also be an optimization in experimental design, aiming to balance the needs of experimental efficiency and embryonic development, based on the optimal culture time determined by experimental data to maximize the success rate of gene editing and embryo survival rate. Ultimately, two cultures help ensure that the data obtained reflect the long-term effects of gene editing, rather than just short-term phenotypic changes, and improve the success rate of the experiment and the reliability of the results.

[0097] Step S43, extracting genomic DNA from the secondary cultured embryos, and using a screening primer set to perform PCR amplification on the target site sequence of the target site targeted by the sgRNA sequence contained in the genomic DNA, and sequencing using the forward screening primer in the screening primer set to obtain a sequencing result.

[0098] As described above, genomic DNA is extracted from the secondary cultured embryos, that is, DNA is extracted from the developing embryos for subsequent gene editing effect detection, thereby obtaining genomic DNA for analysis. In short, this step is used to provide a template for molecular biological verification of gene editing effects.

[0099] Further, the PCR product is sequenced using the forward screening primer in the screening primer set to obtain a sequencing result, that is, the DNA fragment obtained by PCR amplification is sequenced to determine the target site sequence, thereby obtaining sequencing data of the target site sequence. This step is used to provide direct evidence to verify whether the gene editing is successful.

[0100] Specifically, Sanger sequencing or next generation sequencing technology can be used.

[0101] Step S43, based on the sequencing results, the secondary cultured embryos showing chaotic peaks near the target point are screened out as the target embryos.

[0102] As mentioned above, in the context of CRISPR / Cas9 gene editing technology, "disordered peaks near the target site" refers to the abnormal peak pattern observed in a specific area when sequencing and analyzing the target DNA sequence. Such abnormal peaks, or "disordered peaks", are usually caused by insertion or deletion mutations caused by gene editing, because these mutations change the normal nucleotide sequence in the target area and its surroundings, resulting in irregular peaks on the sequencing map. These disordered peaks are key indicators for confirming whether gene editing is successful, as they indicate that the expected DNA sequence changes have occurred near the target site. By analyzing these disordered peaks, the editing effects caused by the CRISPR / Cas9 system can be evaluated, including the frequency and type of editing, so that successfully edited samples can be screened for further research and analysis.

[0103] As described above, based on the sequencing results, secondary culture embryos showing random peaks near the target site are screened as target embryos. The sequencing results are analyzed to identify embryos showing insertions or deletions (random peaks), indicating that gene editing may have occurred, and successfully edited embryos are screened.

[0104] This step is used to accurately identify embryos carrying target gene mutations and provide an accurate model for subsequent research.

[0105] In some embodiments, the target site of the sgRNA sequence is located on exon 2 of the elovl6l gene.

[0106] In some embodiments, the site sequence of the target site targeted by the sgRNA sequence is shown as SEQ ID No.4.

[0107] As mentioned above, the site sequence of the target site targeted by the sgRNA sequence is shown in SEQ ID No. 4, specifically: 5`-GTGTATGTAGTGCTTGTGTTTGG-3`.

[0108] In some embodiments, the screening primer set includes the forward screening primer and the reverse screening primer;

[0109] The nucleotide sequence of the forward screening primer is shown in SEQ ID NO.5;

[0110] The nucleotide sequence of the reverse screening primer is shown in SEQ ID NO.6.

[0111] A screening primer set in the embodiment of the present application is a pair of DNA primers used in PCR amplification and sequencing processes, which are used to detect whether CRISPR / Cas9 gene editing has successfully introduced mutations at the target site (exon 2 of the elovl6l gene). The screening primer set includes a forward screening primer and a reverse screening primer, which are respectively bound to the complementary strands of the target DNA sequence and are used to amplify a DNA fragment containing the target site. Specific examples are shown in Table 2.

[0112] Table 2. Nucleotide sequences of screening primer sets

[0113] name SEQ ID NO. Nucleotide sequence (5`-3`) Forward screening primers 5 GCTTCCTTTGACCGAGTA Reverse screening primers 6 AAACTGAGGGACCACATC

[0114] It should be noted that the above-mentioned forward screening primers are not only amplification primers for PCR amplification of genomic DNA, but also primers for Sanger DNA sequencing in step S43 of the method of this embodiment.

[0115] In some embodiments, the step S5, obtaining an elovl6l deletion mutant zebrafish according to the target embryo as the zebrafish model of early embryonic developmental abnormalities, comprises:

[0116] Step S51, raising the target embryos to sexual maturity using a breeding system to obtain mature embryos.

[0117] As mentioned above, the target embryos that have been gene-edited are raised to sexual maturity using a breeding system to obtain mature embryos. That is, after gene editing and preliminary screening, the selected embryos need to mature so that they can reproduce offspring, thereby obtaining sexually mature zebrafish, ensuring that the effects of gene editing can be passed on to the germ cells of zebrafish, so that the effects of the mutation can be observed in the next generation.

[0118] Specifically, zebrafish can be raised under controlled environmental conditions, including suitable temperature, light and nutrition.

[0119] Step S52, screening the next generation of embryos of the mature embryos for embryos with effective mutation types, and culturing the elovl6l deletion mutant zebrafish to serve as the zebrafish model of early embryonic developmental abnormalities.

[0120] As mentioned above, the next generation of embryos from mature embryos were screened for embryos with effective mutation types. Embryos carrying specific gene mutations were screened from the offspring of sexually mature zebrafish to obtain embryos carrying elovl6l deletion mutations, ensuring that the research focus is on embryos with a specific genetic background, which can be used for further biological research.

[0121] The present application provides an application of the sgRNA described in the aforementioned embodiment in constructing a zebrafish model of early embryonic developmental abnormalities.

[0122] The present application also provides an example of an application of the zebrafish elovl6l gene targeted by sgRNA as described in the aforementioned embodiment in preparing a zebrafish model of early embryonic development.

[0123] The present invention is further described below by means of specific examples, but it should be understood that these examples are only used for more detailed description and should not be construed as limiting the present invention in any form.

[0124] Example 1: Design of sgRNA and primer sets

[0125] In this example, a single guide RNA (sgRNA) and its corresponding primer set were designed and constructed, which are specifically used to target exon 2 of the zebrafish elovl6l gene to achieve CRISPR / Cas9-mediated gene knockout.

[0126] 1. Design and synthesize sgRNA:

[0127] (1) sgRNA design: Based on CRISPR / Cas9 gene editing technology, a sgRNA was designed, whose nucleotide sequence is shown in SEQ ID NO.1, which specifically targets a specific target site on exon 2 of the elovl6l gene.

[0128] The target site sequence is SEQ ID NO.4: 5-GTGTATGTAGTGCTTGTGTTTGG-3. Figure 2 , the underlined part in the gene sequence, and the 47 bases in the box (SEQ ID NO.7):

[0129] TGTTTGGTGGACAGCACTTCATGAAGGACAGACAAAGACTTGAT CTC is the expected deletion mutation sequence.

[0130] (2) sgRNA synthesis: sgRNA was synthesized by an in vitro transcription method using an in vitro transcription template with SEQ ID NO.1 sequence as a template.

[0131] 2. Design and synthesize primer sets:

[0132] In order to construct an in vitro transcription template for sgRNA, a pair of PCR primers was synthesized in this example, including a forward primer sequence of SEQ ID NO.2 and a reverse primer sequence of SEQ ID No.3.

[0133] SEQ ID NO.2:

[0134] 5ˋ-taatacgactcactataGTGTATGTAGTGCTTGTGTTgttttagagctagaa-3ˋ;

[0135] SEQ ID NO.3:

[0136] 5ˋ-AAAAAAAGCACCGACTCGGTGCCAC-3ˋ.

[0137] Through these steps, the sgRNA targeting the zebrafish elovl6l gene and its primer set were successfully designed in this example, providing the necessary tools for subsequent gene knockout experiments. These tools will be used to introduce the CRISPR / Cas9 system into zebrafish fertilized eggs to achieve precise editing of the elovl6l gene, thereby constructing a zebrafish model of early embryonic developmental abnormalities.

[0138] Example 2: Preparation of gRNA in vitro transcription template

[0139] In this example, a gRNA in vitro transcription template was prepared.

[0140] Experimental methods:

[0141] The primer set designed and obtained in Example 1 was used to perform PCR with pMD19T-gRNA as a template for the PCR reaction, and the PCR product was purified and recovered to prepare a gRNA in vitro transcription template.

[0142] 1. PCR amplification:

[0143] (1) Prepare the reaction system:

[0144] Prepare according to the components shown in Table 3.

[0145] Table 3. Reaction system

[0146] NO. Components Dosage μL 1 2x PCR mix 25 2 pMD19T-gRNA (50 ng / μL) 0.5 3 Forward primer (10uM) 2 4 Reverse primer (10uM) 2 5 <![CDATA[H2O]]> 20.5 6 Total 50

[0147] (2) PCR procedure:

[0148] Prepare 200 μL of the above reaction system. The PCR program includes:

[0149] Initial denaturation was at 94°C for 5 min, followed by 30 cycles of 94°C for 30 s, 60°C for 30 s, 72°C for 30 s, and a final extension at 72°C for 10 min.

[0150] Finally, the PCR product is obtained, which is a DNA fragment containing the target sgRNA sequence.

[0151] 2. PCR product purification and recovery:

[0152] The PCR product purification and recovery steps include:

[0153] (1) Column equilibration step: Add 500 μL of equilibration solution BL to the adsorption column CB2 (the adsorption column is placed in the collection tube), centrifuge at 12,000 rpm (~13,400 × g) for 1 min, pour out the waste liquid in the collection tube, and put the adsorption column CB2 back into the collection tube.

[0154] (2) Estimate the volume of the PCR reaction solution or enzyme digestion reaction solution, add 5 times the volume of Binding Buffer PB to it, and mix thoroughly.

[0155] (3) Add the solution obtained in the previous step to an adsorption column CB2 (the adsorption column is placed in a collection tube), leave it at room temperature for 2 minutes, centrifuge it at 12,000 rpm (~13,400×g) for 30-60 seconds, pour out the waste liquid in the collection tube, and place the adsorption column CB2 in the collection tube.

[0156] (4) Add 600 μL of rinse solution PW to the adsorption column CB2 (please check whether anhydrous ethanol has been added before use), centrifuge at 12,000 rpm (~13,400×g) for 30-60 seconds, pour out the waste liquid in the collection tube, and place the adsorption column CB2 in the collection tube.

[0157] (5) Repeat step (4).

[0158] (6) Place the adsorption column CB2 back into the collection tube and centrifuge at 12,000 rpm (~13,400 × g) for 2 min to remove as much rinsing solution as possible. Place the adsorption column CB2 at room temperature for several minutes to dry thoroughly to prevent residual rinsing solution from affecting the next step of the experiment.

[0159] (7) Place the adsorption column CB2 in a clean centrifuge tube, add 30-50 μL of elution buffer EB to the middle of the adsorption membrane, and leave it at room temperature for 2 minutes. Centrifuge at 12,000 rpm (~13,400 × g) for 2 minutes to collect the DNA solution, and obtain the purified gRNA in vitro transcription template.

[0160] Example 3: In vitro transcription

[0161] In this example, gRNA was prepared.

[0162] Experimental methods:

[0163] The gRNA in vitro transcription template prepared in Example 2 was transcribed in vitro using T7 transcriptase, purified and recovered to obtain gRNA.

[0164] 1. Prepare T7 RNA transcription reaction system:

[0165] Prepare the in vitro transcription reaction system according to Table 4.

[0166] Table 4. Reaction system

[0167] NO. Components Dosage 1 2.5 mM NTP 4μL 2 10x Reaction Buffer 2μL 3 gRNA in vitro transcription template 0.5 μg~1 μg 4 T7 RNA polymerase 2μL 5 Enzyme-free water Add to 20 μL

[0168] 2. In vitro transcription:

[0169] The reaction was allowed to react at 37°C for 1 hour, and gRNA was transcribed from the gRNA in vitro transcription template using T7 RNA polymerase.

[0170] In this step, the reaction system prepared in step 1 is used to obtain a newly synthesized gRNA.

[0171] 3. DNase I treatment:

[0172] Removal of DNA template:

[0173] Add 2.5 μL 10X buffer and 2 μL DNase I to the transcription reaction product, and react at 37°C for 15 minutes to remove the DNA template to obtain a gRNA solution excluding the DNA template.

[0174] 4. Purification of synthesized gRNA:

[0175] In this step, SigmaSpin TM Sequencing reaction clean-up kit for purification.

[0176] The purification column was placed in a 2 mL collection tube and centrifuged at 2800 rpm for 15 seconds.

[0177] Twist off the sealing column at the bottom of the tube, discard the tube cap, put the purification column back into the collection tube, and centrifuge at 2800 rpm for 2 minutes.

[0178] Place the purification column in a new RNase-free EP tube and discard the collection tube.

[0179] Add the gRNA synthesis solution to the purification column and centrifuge at 2800 rpm for 4 minutes.

[0180] The column liquid is collected, detected by electrophoresis and the concentration is determined to obtain the purified gRNA for storage.

[0181] 5. Save gRNA:

[0182] The purified gRNA was stored in a -80℃ refrigerator for later use. The stored gRNA can be used for subsequent experiments.

[0183] Through the above steps in this example, gRNA was successfully prepared and purified from the gRNA in vitro transcription template, providing a key guide RNA component for the CRISPR / Cas9 gene editing system. Finally, purified gRNA was obtained for use in subsequent gene editing experiments.

[0184] Example 4: Synthesis of Cas9 mRNA

[0185] In this example, a plasmid containing the full-length sequence of zebrafish codon-optimized Cas9 was linearized by restriction endonuclease digestion, and purified and recovered using GeneJET PCR Purification Kit for use as a transcription template.

[0186] 1. Starting from a plasmid containing the full-length zebrafish codon-optimized Cas9 sequence, linearize it using restriction endonucleases to obtain a DNA template for transcription.

[0187] 2. Use GeneJET PCR Purification Kit to purify and recover the plasmid after enzyme digestion to ensure that a pure DNA template is obtained and provide a high-quality template for in vitro transcription.

[0188] The purification process includes the following steps:

[0189] (1) Column equilibration: Add 500 μL of equilibration solution BL to the adsorption column CB2 and centrifuge at 12,000 rpm for 1 minute. Then, discard the waste liquid and put it back into the collection tube.

[0190] (2) Add 5 times the volume of Binding Buffer PB according to the volume of PCR reaction solution or enzyme digestion reaction solution and mix thoroughly.

[0191] (3) Add the mixed solution to the adsorption column CB2, place it at room temperature for 2 minutes, centrifuge it at 12,000 rpm for 30-60 seconds, and discard the waste liquid.

[0192] (4) Add 600 μL of the rinse solution PW to which anhydrous ethanol has been added to the adsorption column CB2, centrifuge again at 12,000 rpm for 30-60 seconds, and discard the waste liquid.

[0193] (5) After repeating this rinsing step, the adsorption column CB2 was placed back into the collection tube and centrifuged at 12,000 rpm for 2 min to remove excess rinsing solution. The adsorption column CB2 was then dried at room temperature to prevent the residual rinsing solution from affecting subsequent experiments.

[0194] (6) Finally, place the adsorption column CB2 in a clean centrifuge tube and add 30 μL to 50 μL of elution buffer EB to the middle of the adsorption membrane. After standing at room temperature for 2 minutes, centrifuge at 12,000 rpm for 2 minutes to collect the purified DNA solution.

[0195] 3. Synthesis: Ambion's mMessage mMachine in vitro transcription kit was used to synthesize Cas9 mRNA. The reaction system is shown in Table 5.

[0196] Table 5. Reaction system

[0197] NO. Components Dosage 1 DNA template 0.5~1 μg 2 2x NTP / CAP 5μL 3 10x reaction buffer 1μL 4 Enzyme mix 1μL 5 Enzyme-free water Add to 10 μL

[0198] The above reaction system was mixed and incubated in a 37°C water bath for 2 hours to obtain Cas9 mRNA.

[0199] 4. Purification and recovery of Cas9 mRNA:

[0200] (1) Add 1 μL of the DNA enzyme included in the kit to the reaction system, mix well, and place in a 37°C water bath for 15 minutes to remove the DNA template.

[0201] (2) Add 20 μL of 5 M ammonium acetate, mix well, and place on ice for 10 minutes to allow mRNA precipitation.

[0202] (3) Centrifuge at 12,000 rpm for 15 minutes at 4°C to collect the mRNA as a white precipitate.

[0203] (4) After discarding the supernatant, wash the precipitate with 75% ethanol and centrifuge at 7,500 rpm for 5 minutes at 4°C.

[0204] (5) Discard the supernatant, dry the precipitate, and add 10 μL of enzyme-free water to dissolve it.

[0205] (6) Take 0.5 μL of RNA and dilute it 20 times to detect the concentration and purity. Then take 10 μL of the dilution and perform agarose gel electrophoresis to detect the degree of mRNA degradation.

[0206] Through the above experimental method in this example, Cas9 mRNA was synthesized from a plasmid containing the zebrafish codon-optimized Cas9 full-length sequence, providing a key RNA component for CRISPR / Cas9 gene editing experiments.

[0207] Example 5: Microinjection

[0208] In this example, the purified gRNA and Cas9 mRNA obtained in Example 3 were mixed and microinjected into single-cell stage zebrafish fertilized eggs, with 1 nL injected into each embryo.

[0209] Experimental methods:

[0210] After the gRNA (Example 3) and Cas9 mRNA (Example 4) were synthesized, the injection sample was prepared according to the following system. The 3 μL injection system is shown in Table 6.

[0211] Table 6. Injection system

[0212] NO. Components Dosage 1 Cas9 mRNA 500ng / μL 2 gRNA 50–100 ng / μL 3 Phenol red 0.5μL 4 Enzyme-free water Add to 2 μL

[0213] The number of injected single-cell stage zebrafish fertilized egg embryos is 200 to 500. In this embodiment, the number of injected embryos is 500.

[0214] Example 6: Obtaining a zebrafish model of early embryonic developmental abnormalities

[0215] In this example, PCR amplification and sequencing were used to verify the gene editing effect introduced by the CRISPR / Cas9 system in zebrafish embryos, and then the successfully edited zebrafish were screened to construct an early embryonic developmental abnormality model.

[0216] Experimental methods:

[0217] 1. After microinjection of the CRISPR / Cas9 injection mixture into zebrafish one-cell stage fertilized eggs, these fertilized eggs were cultured for 24 hours to develop into embryos. At this stage, some embryos were collected and genomic DNA was extracted from them in preparation for the next step of PCR amplification.

[0218] 2. Perform PCR amplification to detect the target site sequence. The PCR reaction system used is shown in Table 7.

[0219] Table 7. PCR reaction system

[0220]

[0221] The PCR program was set as a preliminary denaturation at 94°C for 5 min, followed by 35 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 30 s, and finally an extension at 72°C for 10 min.

[0222] In this process, the screening primer sets used were:

[0223] The forward screening primer sequence is SEQ ID NO.5 (5'-GCTTCCTTTGACCGAGTA-3'), and the reverse screening primer sequence is SEQ ID NO.6 (5'-AAACTGAGGGACCACATC-3'). The primer of SEQ ID No.5 is also used for Sanger DNA sequencing.

[0224] 3. Sequencing: After PCR amplification, the product is sequenced to verify whether the expected mutation has occurred at the target site. The embryos with random peaks near the target site in the sequencing results are considered to be successfully edited, and these embryos are then placed in a breeding system and raised to sexual maturity.

[0225] 4. For sexually mature zebrafish, the same PCR and sequencing methods were used again to screen the next generation of embryos to detect effective mutation types. Through this screening process, zebrafish with elovl6l gene mutations were finally obtained, thus constructing a zebrafish model of abnormal early embryonic development, which is of great significance for studying gene function and disease mechanism.

[0226] refer to Figure 3 Compared with wild-type zebrafish, the elovl6l gene mutation provided in this embodiment results in decreased DHA and oleic acid content and increased stearic acid content.

[0227] 5. Effects of gene deletion on early embryonic development of zebrafish:

[0228] (1) RNA in situ hybridization observation was performed on elovl6l deletion mutant zebrafish (zebrafish model);

[0229] like Figure 4 As shown, compared with wild-type zebrafish, the signal of the elovl6l gene mutation probe provided in this example is weakened or even absent.

[0230] (2) The fatty acid composition of elovl6l deletion mutant zebrafish (zebrafish model) was analyzed;

[0231] like Figure 5 As shown, compared with the wild-type zebrafish, the early embryonic development process of the elovl6l gene mutation provided by this example is abnormal.

[0232] (3) Take elovl6l deletion mutant zebrafish (zebrafish model) for fluorescence observation;

[0233] like Figure 6 As shown, compared with the wild-type zebrafish, the elovl6l gene mutation provided in this example delayed cell division after male and female pronuclear fusion, but did not cause multinucleation.

[0234] (4) By analyzing the data obtained in steps (1) to (3), the abnormal early embryonic development of elovl6l deletion mutant zebrafish is described.

[0235] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein by equivalents. However, these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A sgRNA, characterized in that The sgRNA targets the zebrafish elovl6l gene; The sgRNA includes the nucleotide sequence shown in SEQ ID NO.

1.

2. A primer set, characterized in that: The primer set is used to construct a gRNA in vitro transcription template for synthesizing the sgRNA according to claim 1, comprising a forward primer and a reverse primer; The nucleotide sequence of the forward primer is shown in SEQ ID NO.2; The nucleotide sequence of the reverse primer is shown in SEQ ID NO.

3.

3. A method for constructing a zebrafish elovl6l gene mutant, characterized in that: include: Using the primer set as claimed in claim 2, a PCR reaction is performed using pMD19T-gRNA as a template for the PCR reaction, purifying and recovering the PCR product to obtain a purified product, and using the purified product as a gRNA in vitro transcription template; The gRNA in vitro transcription template is transcribed in vitro using T7 transcriptase to obtain the purified sgRNA according to claim 1; Mixing the sgRNA and Cas9 mRNA to obtain a CRISPR / Cas9 injection mixture, and microinjecting the CRISPR / Cas9 injection mixture into a zebrafish one-cell stage fertilized egg; Cultivating the fertilized egg injected with the CRISPR / Cas9 injection mixture to develop a target embryo; Based on the target embryos, elovl6l deletion mutant zebrafish are obtained as the zebrafish model of abnormal early embryonic development.

4. The method for constructing a zebrafish elov161 gene mutant as claimed in claim 3, characterized in that: The number of microinjected into zebrafish single-cell stage fertilized eggs is 200 to 500.

5. The method for constructing a zebrafish elov161 gene mutant as claimed in claim 3, characterized in that: Cultivating the fertilized egg injected with the CRISPR / Cas9 injection mixture to develop a target embryo, including: After the microinjection is completed, the fertilized eggs are cultured for the first time to obtain primary cultured embryos; collecting the primary cultured embryos and performing a second culture to obtain secondary cultured embryos; Extracting genomic DNA from the secondary cultured embryos, and using a screening primer set to perform PCR amplification on the target site sequence of the target site targeted by the sgRNA sequence contained in the genomic DNA, and performing sequencing using a forward screening primer in the screening primer set to obtain a sequencing result; According to the sequencing results, the secondary cultured embryos showing chaotic peaks near the target site are screened out as the target embryos.

6. The method for constructing a zebrafish elov161 gene mutant according to claim 3, characterized in that: The target site targeted by the sgRNA sequence is located on exon 2 of the elovl6l gene; Preferably, the site sequence of the target site targeted by the sgRNA sequence is shown as SEQ ID No.

4.

7. The method for constructing a zebrafish elov161 gene mutant according to claim 6, characterized in that: The screening primer set includes the forward screening primer and the reverse screening primer; The nucleotide sequence of the forward screening primer is shown in SEQ ID NO.5; The nucleotide sequence of the reverse screening primer is shown in SEQ ID NO.

6.

8. The method for constructing a zebrafish elov161 gene mutant as claimed in claim 3, characterized in that: The method of obtaining the elovl6l deletion mutant zebrafish according to the target embryo as the zebrafish model of abnormal early embryonic development comprises: Raising the target embryos to sexual maturity using a breeding system to obtain mature embryos; The next generation of embryos of the mature embryos is screened for embryos with effective mutation types, and the elovl6l deletion mutant zebrafish is cultured to obtain the zebrafish model of abnormal early embryonic development.

9. Use of the sgRNA as claimed in claim 1 in constructing a zebrafish model of early embryonic developmental abnormalities.

10. Use of the zebrafish elovl6l gene targeted by the sgRNA as claimed in claim 1 in preparing a zebrafish model of early embryonic development.

Images