Transcription factor gene pagbes1 for regulating poplar wood yield and wood fiber length and application thereof

Abstract

The present application relates to a kind of gene PagBES1 for regulating poplar wood yield and wood fiber length and its application, belong to plant genetic engineering technical field;Its nucleotide sequence is as shown in sequence 3 in sequence table, its amino acid sequence is as shown in sequence 4 in sequence table.The present application is transferred into poplar PagBES1 gene, compared with wild type, the height of transgenic poplar of PagBES1 activation expression is significantly improved, ground stem is significantly thickened, the cell layer of stem vascular tissue is significantly increased, and wood fiber length and width are significantly increased, secondary cell wall is significantly deposited thickening, and the phenotype of transgenic poplar of PagBES1 inhibition expression is contrary to this, it is described that PagBES1 gene is the key regulation gene for regulating poplar wood formation, has important application value in the field of forest genetic engineering and clone forestry.

Description

Technical Field

[0001] This invention relates to a key transcription factor gene in the brassinolide signaling pathway and its application, particularly to PagBES1, a gene that regulates poplar wood yield and wood fiber length, and its application, belonging to the field of bioengineering technology. Background Technology

[0002] Trees are a core component of terrestrial ecosystems. They convert and store large quantities of photosynthetic products in their wood, making them a vital renewable resource for human society. As a key link in the global carbon cycle, wood plays a crucial role as a carbon sink in terrestrial ecosystems, significantly contributing to maintaining global carbon balance. Severe shortages of wood resources and heavy reliance on imports have limited the development of my country's papermaking industry. Industrially, high-quality paper is obtained by plasticizing and dissolving lignin in wood fiber cells, re-interweaving cellulose and hemicellulose. Improving wood fiber raw materials has significant biological implications for the papermaking industry. Longer fibers, higher aspect ratios, higher fiber content, better flexibility and elasticity, and lower lignin and higher cellulose content are more advantageous as raw materials for production.

[0003] Poplar is an economically important tree species widely distributed globally. Its timber is used not only in the processing industry but is also a crucial raw material for plywood, fiberboard, papermaking, disposable chopsticks, and packaging. It offers significant economic, ecological, and social benefits. Therefore, there is an urgent need to develop new poplar varieties that increase timber yield and improve timber quality. Utilizing molecular biology and genetic engineering techniques to enhance poplar timber yield and improve its quality has significant theoretical and practical value.

[0004] Timber yield and quality are jointly determined by the proliferative activity and xylem differentiation activity of vascular cambium meristem cells. Previous studies have shown that the proliferative activity and xylem differentiation activity of poplar vascular cambium are regulated by brassinolide hormone signaling; increased brassinolide content promotes wood formation and significantly increases the biomass of wood tissue.

[0005] Brassinolide transmits signals to the downstream transcription factor BES1 through a series of signal cascade reactions, thereby regulating the transcription of BR-responsive genes. Therefore, studying the role of BES1 in plant development can further reveal the molecular mechanism by which brassinolide regulates wood formation, which is beneficial for creating new poplar varieties with high-quality timber.

[0006] Therefore, this study provides a gene PagBES1 that regulates poplar wood yield and fiber length, and its application. Based on molecular biology and genetic engineering techniques, and using poplar as the research object, this study offers new insights into the molecular mechanism by which brassinolide regulates poplar wood formation, which is of great significance for forest tree breeding and improvement. Summary of the Invention

[0007] To address the shortcomings of existing technologies, one objective of this invention is to provide PagBES1, a key transcription factor gene in the brassinolide signaling pathway that regulates the development of vascular tissue and wood formation in poplar trees.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] The nucleotide sequence of PagBES1, a gene that regulates poplar wood yield and wood fiber length, is shown in Sequence 3 of Table 3.

[0010] Another objective of this invention is to provide the expression protein of the gene PagBES1, which regulates poplar timber yield and wood fiber length.

[0011] The above-mentioned objective of this invention is achieved through the following technical solution:

[0012] The amino acid sequence of the expression protein of PagBES1, a gene that regulates poplar timber yield and wood fiber length, is shown in Sequence 4 of Table 4.

[0013] Another objective of this invention is to provide a plant expression vector for the gene PagBES1, which regulates poplar wood yield and wood fiber length.

[0014] The above-mentioned objective of this invention is achieved through the following technical solution:

[0015] A plant expression vector for the gene PagBES1, which regulates poplar wood yield and wood fiber length, is shown in Table 8 (Sequence 8) and Table 12 (Sequence 12), respectively.

[0016] Another objective of this invention is to provide a method for constructing a plant expression vector for the gene PagBES1, which regulates poplar wood yield and wood fiber length.

[0017] The above-mentioned objective of this invention is achieved through the following technical solution:

[0018] A method for constructing a plant expression vector for PagBES1, a gene that regulates poplar timber yield and fiber length, comprising the following steps:

[0019] (1): Cloning the PagBES1 gene

[0020] Using 84K (P. alba × P. glandulosa) silver gland poplar as material, total RNA was extracted from tissue culture seedlings using the RNeasy Plant Mini kit and the RNase-free DNase I kit (Qiagen, Hilden, Germany). 2.0 μg of RNA was taken from each sample, and the first strand of cDNA was synthesized using the SuperScript III first-strand synthesis system (Life Technologies, Carlsbad, CA, USA). Primers (with start and stop codons in the amplicon) were designed using Primer3 software, referencing the published Populus alba genome sequence, to amplify the gene, which was named PagBES1.

[0021] (2): Construction of PagBES1 gene expression vector in plants

[0022] Activation and repression expression vectors of the PagBES1 gene were constructed using cloning technology. Vector-specific PCR primers were designed using Oligo7 software, and PCR amplification was performed using the previously amplified PagBES1 as a template.

[0023] The CDS of the PagBES1 gene was constructed into the target vectors, namely pCAMBIA1300 (SEQ introductory vector pCAMBIA1300: 10177bp) and pCAMBIA3300 (SEQ introductory vector pCAMBIA3300: 8429bp).

[0024] (3) The target vector was digested with HindIII enzyme;

[0025] (4) The target gene with vector-specific primers at both ends was constructed into the plant expression vectors pCAMBIA1300 and pCAMBIA3300 through homologous recombination reaction. The sequences of the final vectors are shown in Sequence 8 in Table 8 and Sequence 12 in Table 12, respectively.

[0026] (5) The final constructed vectors are MASpro-PagBES1-VP16 and PagBES1pro-PagBES1-SRDX.

[0027] Preferably, in step (1), the PagBES1 CDS forward primer is shown as Sequence 1 in Table 1, and the PagBES1 CDS reverse primer is shown as Sequence 2 in Table 2; the high-fidelity PCR reaction system is as follows: TaKaRa high-fidelity amplification enzyme PrimeSTAR 7.5μL, PagBES1 CDS forward primer (10μM) 0.15μL, PagBES1 CDS reverse primer (10μM) 0.15μL, template (84K Yang cDNA) 0.8μL, sterile ddH2O to 15μL, reaction program: 98℃, 1min; (98℃, 10s; 56℃, 15s; 72℃, 2min: 35 cycles); 72℃, 3min.

[0028] Preferably, in step (2), the PagBES1 vector-specific forward primer is shown as sequence 5 in Table 5, and the PagBES1 vector-specific reverse primer is shown as sequence 6 in Table 6.

[0029] Preferably, in step (3), the enzyme digestion system is as follows: 5 ng of target vector pCAMBIA1300 or pCAMBIA3300 (volume converted according to concentration); 3 μL of HindIII enzyme; 3 μL of 10× green buffer; ddH2O, to a final volume of 30 μL; reaction system: 37℃, 30 min.

[0030] Preferably, in step (4), the homologous recombination reaction system consists of 80 ng of pCAMBIA1300 or pCAMBIA3300 digested with HindIII (the default amount of the target vector is 80 ng, and the volume is calculated according to the concentration); 3.75 μL of homologous recombination enzyme; and ddH2O to a final volume of 10 μL. The reaction system is carried out at 37°C for 30 min.

[0031] Preferably, in step (5), the PagBES1 gene has a 35S small promoter downstream of its own promoter and at the 5' end of the PagBES1 gene, which enables the PagBES1 gene to be expressed efficiently in poplar; a strong terminator NOS is assembled at the 3' end of the PagBES1 gene to effectively terminate the transcription of the PagBES1 gene.

[0032] Another objective of this invention is to provide a genetic transformation of the gene PagBES1, which regulates poplar timber yield and wood fiber length.

[0033] The above-mentioned objective of this invention is achieved through the following technical solution:

[0034] Genetic transformation of PagBES1, a gene that regulates poplar timber yield and fiber length, is carried out through the following steps: The constructed activation expression vector MASpro-PagBES1-VP16 and repression expression vector PagBES1pro-PagBES1-SRDX are transferred into Agrobacterium EHA105 via cold shock. The PagBES1 gene is then transferred into 84K poplar trees via Agrobacterium-mediated leaf disc transformation.

[0035] Another objective of this invention is to provide an application of the gene PagBES1, which regulates poplar wood yield and wood fiber length.

[0036] The above-mentioned objective of this invention is achieved through the following technical solution:

[0037] The application of the gene PagBES1, which regulates poplar wood yield and wood fiber length, in regulating poplar growth and development, particularly in regulating vascular tissue development and wood formation.

[0038] Advantages of this invention: This invention uses 84K silver poplar as material to clone the PagBES1 gene; at the same time, it constructs the activation expression vector MASpro-PagBES1-VP16 and the repression expression vector PagBES1pro-PagBES1-SRDX. The PagBES1 gene has a 35S small promoter downstream of its own promoter and at the 5' end of the PagBES1 gene, which enables the PagBES1 gene to be efficiently expressed in poplar, thereby regulating the development of poplar vascular tissue and wood formation.

[0039] Compared with existing technologies, this invention, by transferring the PagBES1 gene into poplar, shows that compared with the wild type, transgenic poplar with activated PagBES1 expression exhibits significantly increased plant height, thicker stems, a significantly increased number of cell layers in the stem vascular tissue, and significantly increased wood fiber length and width, as well as significantly thickened secondary cell walls. Conversely, the phenotype of transgenic poplar with inhibited PagBES1 expression is the opposite. This indicates that the key transcription factor gene PagBES1 in the brassinolide signaling pathway of poplar is an important regulator controlling the development of poplar vascular tissue. The PagBES1 gene can significantly improve plant growth and promote vascular tissue development and wood formation, and has important application value in the fields of forest tree genetic engineering and forestry engineering.

[0040] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but this does not imply any limitation on the scope of protection of the present invention. Attached Figure Description

[0041] Figure 1 This is a schematic diagram of the structure of the plant activation expression vector MASpro-PagBES1-VP16 in Example 1 of the present invention.

[0042] Figure 2 This is a schematic diagram of the structure of the plant-inhibited expression vector PagBES1pro-PagBES1-SRDX in Example 1 of the present invention.

[0043] Figure 3 This is a comparison diagram of plant height and stem phenotype between transgenic poplar trees with activated and inhibited PagBES1 expression and non-transgenic poplar trees in Example 1 of this invention.

[0044] Figure 4 This is a quantitative real-time PCR (qPCR) image showing the transcriptional levels of transgenic poplar trees with PagBES1 activation and inhibition in Example 1 of this invention.

[0045] Figure 5-1 This is a comparison image of semi-thin sections of vascular tissue from transgenic poplar trees with PagBES1 activation and inhibition expression and non-transgenic poplar trees in Example 1 of this invention.

[0046] Figure 5-2 This is a statistical diagram showing the thickness of the phloem, the number of cambium cell layers, and the number of xylem cell layers in the vascular tissue of transgenic and non-transgenic poplar trees with PagBES1 activation and inhibition expression in Example 1 of this invention.

[0047] Figure 6 This is a comparison diagram of the wood fiber length and width between transgenic poplar trees with PagBES1 activation and inhibition expression and non-transgenic poplar trees in Example 1 of this invention.

[0048] Figure 7 This is a comparison diagram of the secondary cell wall thickness of wood fibers in transgenic poplar trees with PagBES1 activation and inhibition expression and non-transgenic poplar trees in Example 1 of this invention. Detailed Implementation

[0049] The present invention will be further described below with reference to specific embodiments. Operations not described in detail in the following embodiments can be performed with reference to molecular cloning and related kit instructions.

[0050] Example 1

[0051] Step (1): Cloning the PagBES1 gene

[0052] Using 84K (P. alba X P. glandulosa) silver gland poplar as material, total RNA was extracted from tissue culture seedlings of 84K using the RNeasy Plant Mini kit and the RNase-free DNase I kit (Qiagen, Hilden, Germany). 2.0 μg of RNA was taken from each sample, and the first strand of cDNA was synthesized using the SuperScript III first-strand synthesis system (Life Technologies, Carlsbad, CA, USA). Primers (with start and stop codons in the amplicon) were designed using Oligo7 software, referencing the published Populus alba genome sequence, to amplify the gene, which was named PagBES1.

[0053] The PagBES1 CDS forward primer is shown in Sequence 1 of Table 1.

[0054] Table 1

[0055] name Sequence 1 PagBES1 CDS forward primer ATGACGTCAGATGGGGCCAC

[0056] The reverse primers for PagBES1 CDS are shown in Sequence 2 in Table 2.

[0057] Table 2

[0058] name Sequence 2 PagBES1 CDS reverse primer ACTCCGAGCCTTGCCACCTC

[0059] The high-fidelity PCR reaction system is as follows: TaKaRa high-fidelity amplification enzyme PrimeSTAR 7.5μL, forward primer (10μM) 0.15μL, reverse primer (10μM) 0.15μL, template (84K saturated cDNA) 0.8μL, sterile ddH2O to a final volume of 15μL. The reaction program is as follows: pre-denaturation 98℃, 1min; (denaturation 98℃, 10s; annealing 56℃, 15s; extension 72℃, 2min) for a total of 35 cycles; final extension 72℃, 3min.

[0060] The final cDNA sequence of the gene was 954 bp, as shown in Sequence 3 of Table 3 (SEQ PagBES1 gene cDNA: 954 bp);

[0061] Table 3

[0062]

[0063] The protein sequence it compiles and expresses is shown in Sequence 4 of Table 4;

[0064] Table 4

[0065]

[0066] Step (2): Construction of the PagBES1 gene plant expression vector

[0067] Activation and repression expression vectors of the PagBES1 gene were constructed using cloning technology. Vector-specific PCR primers were designed using Oligo7 software. PCR amplification was performed using the previously amplified PagBES1 as a template. The specific forward primers for the PagBES1 activation expression vector are shown in Sequence 5 of Table 5.

[0068] Table 5

[0069] name Sequence 5 PagBES1 CDS specific forward primer ATCGATACCGTCGAGATGACGTCAGATGGGGCCACT

[0070] The specific reverse primers for the PagBES1 activation expression vector are shown in Sequence 6 of Table 6.

[0071] Table 6

[0072] name Sequence 6 PagBES1 CDS-specific reverse primer GATTAGCTTTGTTCACTCCGAGCCTTGCCACCTCC

[0073] The CDS of the PagBES1 gene was constructed into the target vector, which was pCAMBIA1300 (SEQ introductory vector pCAMBIA1300: 10177bp); the target vector sequence is shown in Sequence 7 of Table 7.

[0074] Table 7

[0075]

[0076]

[0077]

[0078]

[0079] The target vector needs to be digested with HindIII enzyme first:

[0080] The enzyme digestion system is as follows: 5 ng of target vector pCAMBIA1300 (volume converted according to concentration); 3 μL of HindIII enzyme; 3 μL of 10x digestion buffer; ddH2O to a final volume of 30 μL; reaction system: 37℃, 30 min; through homologous recombination reaction, the target gene with vector-specific primers at both ends was constructed into the plant expression vector pCAMBIA1300. The sequence of the final vector is shown in Sequence 8 of Table 8; homologous recombination reaction system: 80 ng of pCAMBIA1300 digested with HindIII (the default amount of target vector is 80 ng, volume converted according to concentration); (target fragment mass / number of bases in target fragment) / (target vector volume 80 ng / number of bases in target vector) = 3; the target fragment mass can be obtained, and the target fragment volume can be calculated according to the target fragment concentration; homologous recombination enzyme volume 3.75 μL; ddH2O to a final volume of 10 μL; reaction system: 37℃, 30 min;

[0081] Table 8

[0082]

[0083]

[0084]

[0085]

[0086]

[0087] The specific forward primers for the PagBES1 inhibition expression vector are shown in Table 9.

[0088] Table 9

[0089] name Sequence 9 PagBES1 CDS specific forward primer ACAATTACAATTACCATGACGTCAGATGGGGCCACT

[0090] The specific reverse primers for the PagBES1 activation expression vector are shown in Sequence 10 in Table 10.

[0091] Table 10

[0092] name Sequence 10 PagBES1 CDS-specific reverse primer GAATTCCTGCAGCCCACTCCGAGCCTTGCCACCTCC

[0093] The CDS of the PagBES1 gene was constructed into the target vector, which was pCAMBIA3300 (SEQ introductory vector pCAMBIA3300: 8429bp); the sequence of the target vector is shown in Sequence 11 in Table 11.

[0094] Table 11

[0095]

[0096]

[0097]

[0098] The target vector needs to be digested with HindIII enzyme first:

[0099] The enzyme digestion system is as follows: 5 ng of target vector pCAMBIA3300 (volume converted according to concentration); 3 μL of HindIII enzyme; 3 μL of 10x digestion buffer; ddH2O to a final volume of 30 μL; reaction system: 37℃, 30 min; through homologous recombination reaction, the target gene with vector-specific primers at both ends was constructed into the plant expression vector pCAMBIA3300. The sequence of the final vector is shown in Sequence 12 of Table 12; homologous recombination reaction system: 80 ng of pCAMBIA3300 digested with HindIII (the default amount of target vector is 80 ng, volume converted according to concentration); (target fragment mass / number of bases in target fragment) / (target vector volume 80 ng / number of bases in target vector) = 3; the target fragment mass was obtained, and the volume of the target fragment was calculated according to the target fragment concentration; the amount of homologous recombination enzyme was 3.75 μL; ddH2O to a final volume of 10 μL; reaction system: 37℃, 30 min;

[0100] Table 12

[0101]

[0102]

[0103]

[0104]

[0105] The final constructed vectors are MASpro-PagBES1-VP16 and PagBES1pro-PagBES1-SRDX. The 5' end of the PagBES1 gene contains a constitutive MAS promoter or a 35S small promoter, enabling efficient expression of the PagBES1 gene in poplar. A strong terminator NOS is assembled at the 3' end of the PagBES1 gene, effectively terminating transcription of the PagBES1 gene. Figure 1 The diagram shown is a schematic representation of the structure of the plant activation expression vector MASpro-PagBES1-VP16 in Example 1 of this invention; Figure 2 The diagram shown is a schematic diagram of the structure of the plant repressive expression vector PagBES1pro-PagBES1-SRDX in Example 1 of the present invention.

[0106] The final constructed MASpro-PagBES1-VP16 vector was assembled with hygromycin phosphotransferase (HPT) as a selection marker for transgenic poplar. Hygromycin can be used to screen transgenic poplar. PCR detection and sequencing verification confirmed the successful construction of the activation expression vector, and this type of transgenic poplar was named MASpro-PagBES1-VP16 (Sequence 8). The final constructed PagBES1pro-PagBES1-SRDX vector was assembled with a resistance gene encoding glufosinate acetyltransferase (PAT) as a selection marker for transgenic poplar. Glufosinate can be used to screen transgenic poplar, and PCR detection and sequencing verification confirmed this (SEQ MASpro-PagBES1-VP16: 11296bp). The inhibition expression vector was successfully constructed, and this type of transgenic poplar was named PagBES1pro-PagBES1-SRDX (Sequence 12) (SEQ PagBES1pro-PagBES1-SRDX: 11429bp).

[0107] Step (3) Genetic transformation of the PagBES1 gene

[0108] The constructed target vector carrying the PagBES1 gene was transferred into Agrobacterium EHA105 via cold shock. The PagBES1 gene was then transferred into 84K poplar trees using the Agrobacterium-mediated leaf disc method. The transformation steps were as follows: 84K tissue culture seedlings used for genetic transformation were cultured at a temperature of 22-25℃, a light intensity of 16 / 8h (day / night), and a light intensity of 50 μmol*m. -2* s -1Under controlled conditions, the target vector carrying the PagBES1 gene was transformed into Agrobacterium EHA105. Agrobacterium infected 84K leaf discs when OD600 = 0.6–0.8. The infected leaf discs were then co-cultured for 2 days in WPMS (Woody Plant Medium Screen) containing 100 μM acetylsylsyringone (AS) at 22 ± 2℃ in the dark. After co-culture, the leaf discs infected with Agrobacterium carrying the activation expression vector were transferred to selection medium (WPMS, supplemented with 1.0 mg / L hygromycin B and 200 mg / L termetin) containing 2 mg / L hygromycin B and 200 mg / L termetin. 2,4-Dichlorophenoxyacetic acid (2,4-D) and 0.1 mg / L kinetin were cultured in the dark for one and a half months. Rice-grain-sized callus tissue was transferred to differentiation medium (WPMD, supplemented with 0.05 mg / L naphthaleneacetic acid (NAA), 0.5 mg / L 6-benzylaminopurine (6-BA)) and 0.05 mg / L thidiazuron (TDZ) containing 2 mg / L hygromycin B and 200 mg / L timentin, until resistant adventitious shoots were induced. These resistant adventitious shoots were then transferred to rooting medium, and DNA was extracted from the leaves of the rooted plants for PCR verification. Leaf discs infected with Agrobacterium carrying the inhibitory expression vector were transferred to selection medium (WPMS, supplemented with 1.0 mg / L glufosinate ammonium and 200 mg / L timentin). The callus tissue, about the size of a grain of rice, was cultured in the dark for one and a half months on 2,4-dichlorophenoxyacetic acid (2,4-D) and 0.1 mg / L kinetin. The callus tissue was then transferred to differentiation medium (WPMD, with the addition of 0.05 mg / L naphthaleneacetic acid (NAA), 0.5 mg / L 6-benzylaminopurine (6-BA)) and 0.05 mg / L thiamethoxam (TDZ) until resistant adventitious shoots were induced. The resistant adventitious shoots were then transferred to rooting medium, and DNA was extracted from the leaves of the rooted plants for PCR verification.

[0109] Step (4): Application of the PagBES1 gene

[0110] Under the same growth conditions, wild-type 84K and transgenic poplar trees were cultured for 60 days. The external growth status of the plants was observed, and the accumulation of wood biomass was observed by taking sections of the stems. The wood separation method was used to compare the length of wood fiber cells.

[0111] Experimental results are as follows Figures 3 to 7 As shown, Figure 3The image shown is a comparison of plant height and stem phenotype between transgenic poplar trees with PagBES1 activation and PagBES1 inhibition expression and non-transgenic poplar trees in Example 1 of this invention (taken with a Nikon Z30, 1m distance, 16-50mm focal length). The upper image compares the plant height of transgenic poplar trees with PagBES1 activation and PagBES1 inhibition expression and non-transgenic poplar trees; the lower image compares the stem phenotype of transgenic poplar trees with PagBES1 activation and PagBES1 inhibition expression and non-transgenic poplar trees. The leftmost image shows a non-transgenic poplar tree; one tree was selected for plotting. Statistical data was obtained from three replicates: MAS-BES1-VP16 is the PagBES1 overexpression vector (lines 1, 2, and 3 are three lines); BES1-SRDX is the PagBES1 inhibition expression vector (lines 1, 2, and 3 are three lines). Figure 4 The figure shows the results of transcriptional quantitative PCR experiments on transgenic poplar trees with PagBES1 activation and PagBES1 inhibition in Example 1 of this invention. The bar charts show the expression levels of the PagBES1 gene in wild-type (84K) and transgenic poplar trees, respectively (MAS-BES1-VP16 is the PagBES1 activation expression vector, where 1, 2, and 3 are three lines; BES1-SRDX is the PagBES1 inhibition expression vector, where 1, 2, and 3 are three lines); As shown in Figure 5-1, it is a comparison of semi-thin sections of vascular tissue from transgenic poplar trees with PagBES1 activation and PagBES1 inhibition in Example 1 of this invention and non-transgenic poplar trees (Thermo Fisher EVOS FLAuto2, photographed at 10x). Figure 5-1 In the middle, the leftmost tree is the wild type, and the rightmost tree is the genetically modified poplar; for example... Figure 5-2 The figure shown is a statistical diagram of the phloem thickness, cambium cell layer number, and xylem cell layer number of transgenic and non-transgenic poplar trees with PagBES1 activated and inhibited expression in Example 1 of this invention; Figure 6 The image shown is a comparison of the size of wood fiber cells in transgenic poplar trees with activated and inhibited PagBES1 expression and non-transgenic poplar trees in Example 1 of this invention. In Example 1, A is a comparison of the size of wood fiber cells in transgenic poplar trees with activated and inhibited PagBES1 expression and non-transgenic poplar trees (Thermo Fisher EVOS FLAuto2, photographed at 10x); B is a statistical graph of the length of wood fiber cells in wild-type (84k) and transgenic poplar trees; C is a statistical graph of the width of wood fiber cells in wild-type (84k) and transgenic poplar trees. Figure 7The figure shown is a comparison of the secondary cell wall thickness of wood fibers in transgenic poplar trees with PagBES1 activation and PagBES1 inhibition expression and non-transgenic poplar trees in Example 1 of the present invention. In this figure, A is a comparison of the secondary cell wall thickness of wood fibers in transgenic poplar trees with PagBES1 activation expression and wild-type 84K poplar trees; B is a comparison of the secondary cell wall thickness of wood fibers in transgenic poplar trees with PagBES1 inhibition expression and wild-type 84K poplar trees (JEOL JEM-1230, JAPAN, photographed under 200000× conditions); the left side is wild-type, the right side is transgenic poplar trees, and C is a bar chart showing the statistical diagram of the secondary cell wall thickness of wood fibers in wild-type (84k) and transgenic poplar trees.

[0112] The results showed that, compared with the wild type, transgenic poplar trees with activated PagBES1 expression exhibited significantly increased plant height, thicker stems, a significantly increased number of cell layers in the stem vascular tissue, and significantly increased wood fiber length and width, along with significantly thickened secondary cell walls. Conversely, the phenotype of transgenic poplar trees with inhibited PagBES1 expression was the opposite. This indicates that PagBES1, a key transcription factor gene in the brassinolide signaling pathway of poplar, is an important regulator controlling the development of poplar vascular tissue. The PagBES1 gene can significantly improve plant growth and promote vascular tissue development and wood formation, demonstrating significant application value in forestry genetic engineering and forestry engineering.

[0113] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. A gene for regulating the yield and fiber length of poplar wood PagBES1 In the application of regulating the growth and development of poplar, the specific application is as follows: activating the expression of SEQ ID NO. 3 to increase the plant height of poplar, thicken the stem, increase the number of cell layers of stem vascular tissue, increase the length and width of wood fiber, and deposit and thicken the secondary cell wall. PagBES1 In the application of regulating the growth and development of poplar, the specific application is as follows: activating the expression of SEQ ID NO. 3 to increase the plant height of poplar, thicken the stem, increase the number of cell layers of stem vascular tissue, increase the length and width of wood fiber, and deposit and thicken the secondary cell wall.

Images