Electrotransfection method of chicken primordial germ cells
The transfection efficiency of chicken primitive germ cells is improved through electrotransfection methods, and the problem of low transfection efficiency in the prior art is solved, and the efficient expression of genes in these cells is achieved, which supports more effective gene research and editing.
Patent Information
- Application Number
- CN202510106048.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-23
- Publication Date
- 2025-04-11
AI Technical Summary
In the prior art, the transfection efficiency of chicken primitive germ cells (PGCs) is low, which affects the research efficiency of gene overexpression and knockdown expression.
An electrotransfection method is adopted, including the culture and counting of chicken primitive germ cells, mixing electrotransfection buffer and material to be transfected, forming an electrotransfection system, and transfection is performed using an electrotransfection meter. Specific steps include cell culture, counting, mixing with electroconversion buffer and material to be transfected, and use of electroconversion meter.
Through this method, miRNA inhibitors, miRNA mimics or DNA are successfully expressed in primitive germ cells, and the expression level is significantly improved, helping to study cell self-renewal and proliferation characteristics and meeting the needs of in vitro cell experiments and gene editing technology.
Smart Images
Figure CN119799797A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the field of biotechnology, and more particularly to an electrotransfection method for chicken primordial germ cells. Background Art
[0002] Transfection is an important method for studying gene expression and combining gene editing technology in cells. Currently, the main transfection methods for primordial germ cells (PGCs) include biochemical transfection, viral infection, and physical methods, and each transfection method has its own advantages and disadvantages.
[0003] The biochemical transfection method is to form a complex between the transfection reagent and the nucleic acid and present it into the cell through membrane fusion or endocytosis. Taking the most common liposome transfection method as an example, liposomes are vesicles composed of lipid bilayers, which can simulate the cell membrane structure. Neutral liposomes wrap DNA through lipid membranes and introduce DNA into the cell membrane with the help of lipid membranes. Cationic liposomes carry positive charges and combine with negatively charged DNA through electrostatic effects to form DNA-cationic liposome complexes, which enter cells through membrane fusion or endocytosis. However, due to the differences in cell membrane structure and function and the contact characteristics of suspended cells, the transfection effect of liposome transfection in primary cells and suspended cells is not very ideal.
[0004] The viral infection method is a transfection method that uses viral vectors to introduce foreign genes into host cells. The basic principle is to use the natural ability of viruses to infect cells, replace the genetic material of the virus with foreign genes, and then deliver the foreign genes to the host cells through the interaction between the virus and the host cells. Due to the high infectivity of the virus, the use of viral transfection methods can often achieve better transfection effects. However, the steps for preparing high-titer viruses are complicated and cumbersome, and the viral transfection method has certain biosafety risks and cannot be promoted on a large scale.
[0005] Physical methods are divided into two methods: microinjection and electroporation transfection. The fertilized egg is the largest single cell in mammals, so an extremely fine glass microinjection needle is often used to directly inject exogenous gene fragments into pronuclear embryos or cultured cells to prepare transgenic animals. However, this method is not suitable for birds. The principle of electroporation transfection is to form temporary pores on the cell membrane through electric pulses, so that exogenous molecules, especially DNA and RNA, can enter the cell. After the electric pulse ends, the pores on the cell membrane will close and the cell membrane will return to integrity. The electroporation method is suitable for various cell types, including mammalian cell lines, plant cell lines, etc., as well as primary cells and stem cells that are difficult to transfect. Moreover, electroporation is simple to operate and can quickly and easily transfect a large number of cells. However, high voltage may cause certain damage to cells or even cause cell death. The program parameters of the electric pulse need to be optimized to balance transfection efficiency and cell viability.
[0006] At present, the transfection efficiency of chicken PGCs is very low. The transfection efficiency of liposomes used in most laboratories is 1-30%, which affects the efficiency of using PGCs to study gene overexpression and knockdown expression. If a stably transfected PGCs cell line is to be obtained, the efficiency will be further reduced.
[0007] In summary, how to improve the transfection efficiency of chicken PGCs is an urgent problem that technicians in this field need to solve. Summary of the invention
[0008] In view of this, the present invention provides an electrotransfection method for chicken primordial germ cells.
[0009] In order to achieve the above object, the present invention adopts the following technical solution:
[0010] An electrotransfection method for chicken primordial germ cells comprises the following steps:
[0011] (1) Cultivation and counting of chicken primordial germ cells;
[0012] (2) mixing the counted chicken primordial germ cells with an electrotransfection buffer and a material to be transfected to obtain an electrotransfection system;
[0013] The material to be transfected is a miRNA inhibitor, a miRNA mimic or DNA;
[0014] (3) Transfer the electro-transfection system to an electrode cup and perform transfection using an electroporator.
[0015] Furthermore, the specific operation of step (1) is: culturing the chicken primordial germ cells using a complete culture medium, then centrifuging, resuspending with PBS, and counting the cells.
[0016] Furthermore, in step (2),
[0017] When the material to be transfected is DNA, the ratio of chicken primordial germ cells, electroporation buffer, and DNA is: 1×10 6 pcs: 100μL: 4μg;
[0018] When the material to be transfected is a miRNA inhibitor or a miRNA mimic, the ratio of the chicken primordial germ cells, electroporation buffer, and miRNA inhibitor / miRNA mimic is: 1×10 6 pcs:100μL:400nM.
[0019] Furthermore, the electroporator is a Thermo Neon NxT cell nuclear transfection instrument or a Lonza AAD-1001S cell nuclear transfection instrument.
[0020] Furthermore, in step (3),
[0021] When the electroporator is a Thermo Neon NxT cell nuclear transfection instrument, the transfection parameters are 1300V, 30ms, and the number of pulses is 1 or 1500V, 20ms, and the number of pulses is 1;
[0022] When the electroporator is Lonza AAD-1001S nuclear transfection instrument, the transfection program is A13.
[0023] It can be seen from the above technical solution that, compared with the prior art, the beneficial effects achieved by the present invention are:
[0024] The method of the present invention can successfully express miRNA inhibitors, miRNA mimics or vector DNA in primordial germ cells, and the expression level is significantly improved, which is helpful for studying the self-renewal and proliferation characteristics of primordial germ cells and meets the requirements of in vitro cell experiments and the implementation of gene editing technology. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.
[0026] Figure 1 The results of the electrotransfection method described in Example 2 of the present invention are as follows: A is the result of observation under a fluorescence microscope 48 hours after electrotransfection of 2 μg DNA, and B is the corresponding result of flow analysis; C is the result of observation under a fluorescence microscope 48 hours after electrotransfection of 3 μg DNA, and D is the corresponding result of flow analysis; E is the result of observation under a fluorescence microscope 48 hours after electrotransfection of 4 μg DNA, and F is the corresponding result of flow analysis; G is the result of observation under a fluorescence microscope 48 hours after electrotransfection of 5 μg DNA, and H is the corresponding result of flow analysis;
[0027] Figure 2The results are obtained by electrotransfection for 48 hours using the method described in Example 3 of the present invention, wherein A is the result observed under a fluorescence microscope 48 hours after electrotransfection using the cell nuclear transfection instrument program of 1100V, 40ms, and a pulse number of 1, and B is the corresponding flow analysis result; C is the result observed under a fluorescence microscope 48 hours after electrotransfection using the cell nuclear transfection instrument program of 1300V, 30ms, and a pulse number of 1, and D is the corresponding flow analysis result; E is the result observed under a fluorescence microscope 48 hours after electrotransfection using the cell nuclear transfection instrument program of 1500V, 20ms, and a pulse number of 1, and F is the corresponding flow analysis result;
[0028] Figure 3 The results of the test after 48 hours of electrotransfection by the method described in Example 4 of the present invention, wherein A is the result of observation under a fluorescence microscope 48 hours after electrotransfection by the cell nuclear transfection instrument program A12, and B is the corresponding flow analysis result; C is the result of observation under a fluorescence microscope 48 hours after electrotransfection by the cell nuclear transfection instrument program A13, and D is the corresponding flow analysis result; E is the result of observation under a fluorescence microscope 48 hours after electrotransfection by the cell nuclear transfection instrument program A23, and F is the corresponding flow analysis result;
[0029] Figure 4 The results of miR-17-5p knockdown and overexpression by the electrotransfection method of Example 5 of the present invention, wherein A is the RT-qPCR result after transfection with miR-17-5p inhibitor for 48 hours, and B is the RT-qPCR result after transfection with miR-17-5p mimic for 48 hours;
[0030] Figure 5 The results of miR-17-5p knockdown and overexpression by the electrotransfection method of Example 6 of the present invention, wherein A is the RT-qPCR result after transfection with miR-17-5p inhibitor for 48 hours, and B is the RT-qPCR result after transfection with miR-17-5p mimic for 48 hours;
[0031] Figure 6 The results of the liposome transfection method described in Comparative Example 1 of the present invention after 48 hours, wherein A is the result observed under a fluorescence microscope 48 hours after transfection, and B is the corresponding flow analysis result;
[0032] Figure 7The test results after 48 hours of electrotransfection by the method described in Comparative Example 2 of the present invention. Among them, A is the result of observation under a fluorescence microscope 48 hours after electrotransfection by the cell nuclear transfection instrument program 120V, 25ms, pulse number 1, and B is the corresponding flow analysis result; C is the result of observation under a fluorescence microscope 48 hours after electrotransfection by the cell nuclear transfection instrument program 130V, 25ms, pulse number 1, and D is the corresponding flow analysis result; E is the result of observation under a fluorescence microscope 48 hours after electrotransfection by the cell nuclear transfection instrument program 140V, 25ms, pulse number 1, and F is the corresponding flow analysis result; G is the result of observation under a fluorescence microscope 48 hours after electrotransfection by the cell nuclear transfection instrument program 150V, 25ms, pulse number 1, and H is the corresponding flow analysis result;
[0033] Figure 8 The results are the results of the electrotransfection method described in Comparative Example 3 of the present invention after 48 hours, wherein A is the result of observation under a fluorescence microscope 48 hours after electrotransfection with a nuclear transfection instrument program of 1700V, 20ms, and a pulse number of 1, and B is the corresponding flow analysis result; C is the result of observation under a fluorescence microscope 48 hours after electrotransfection with a nuclear transfection instrument program of 1900V, 10ms, and a pulse number of 1, and D is the corresponding flow analysis result;
[0034] Fig. 9 The cell status before and after 48 hours of electrotransfection according to the method described in Comparative Example 4 of the present invention;
[0035] Fig.10 It is the detection result after 48 hours of electrotransfection by the method described in Comparative Example 5 of the present invention, wherein A is the result of observation under a fluorescence microscope 48 hours after electrotransfection with a cell nuclear transfection instrument program of 1100V, 40ms, and a pulse number of 1; B is the result of observation under a fluorescence microscope 48 hours after electrotransfection with a cell nuclear transfection instrument program of 1300V, 30ms, and a pulse number of 1; C is the result of observation under a fluorescence microscope 48 hours after electrotransfection with a cell nuclear transfection instrument program of 1500V, 20ms, and a pulse number of 1. DETAILED DESCRIPTION
[0036] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.
[0037] The materials used in the following examples are as follows:
[0038] Sample source
[0039] Chicken embryos were white Leghorn chickens from the original breeder farm of the Animal Science Institute of Guangdong Academy of Agricultural Sciences. They were incubated in a RcomPRO 50 incubator (Rutoex) at 38.5°C and 60% relative humidity until 6.5 days old.
[0040] Main reagents
[0041] PBS, 0.25% trypsin, DMEM, 10% albumin, NEAA, β-mercaptoethanol, heparin sodium, transferrin, B27, nucleosides, Activin, FGF2, EDTA, KnockOut serum replacement, Lipofectamine TM 3000, Entranster TM -E.
[0042] Instruments and equipment
[0043] Cell culture incubator, Lonza AAD-1001S cell nuclear transfection instrument, Thermo Neon NxT cell nuclear transfection instrument, Bio-Rad Genepluser cell nuclear transfection instrument, electrophoresis instrument, fluorescence microscope, flow cytometry analyzer.
[0044] Example 1
[0045] Plasmid construction
[0046] Using wild-type pEGFP-N1 as the original backbone and replacing it with the PGK promoter, the construction steps are as follows:
[0047] (1) Design PGK promoter amplification primers, which contain 15 bp pEGFP-N1 vector homology sequence and gene homology arm amplification sequence, and the sequence is as follows:
[0048] PGK-F:TCCCTCGAGCCTACCGGGTAGGGGAGGCGCTTTTC, SEQ ID No. 1;
[0049] PGK-R: ATATTGGCTGCAGGTCGAAAGGCCCGGAGATGAGG, SEQ ID No. 2.
[0050] (2) Use the pGL3-U6-sgRNA-PGK-puromycin plasmid as a template to amplify the PGK promoter by qPCR, and recover the PCR product by DNA gel electrophoresis at 120V for 30min. Cut the correct band with a blade, and the correct size of the PGK promoter is about 500bp. The chopped gel blocks are transferred to EP tubes and recovered using the Tiangen Agarose Gel DNA Recovery Kit (DP219). Weigh the gel blocks, add an equal volume of sol solution, dissolve at 55℃ for 10min, cool and add to the adsorption column, wash, elute with 40μL ddH2O, and measure the concentration.
[0051] (3) Use BamHI and SnaBI to linearize pEGFP-N1. The enzyme digestion system is as follows: 5 μg of pEGFP-N1 vector, 5 μL of 10×NEBuffer, 1 μL of BamHI restriction endonuclease, 1 μL of SnaBI restriction endonuclease, and 50 μL of ddH2O. Incubate at 37°C for 1 hour; cut the correct band with a blade: the vector backbone size is about 4200 bp. The chopped gel blocks are transferred to EP tubes and recovered using the Tiangen Agarose Gel DNA Recovery Kit (DP219). Weigh the gel blocks, add an equal volume of sol solution, dissolve at 55°C for 10 minutes, cool and add to the adsorption column, wash, elute with 40 μL ddH2O, obtain the vector backbone DNA, and measure the concentration.
[0052] (4) Use Hieff Plus Multi One Step Cloning Kit clones the donor plasmid by one-step ligation. The ligation system is 2×Hieff MultiS Enzyme Premix 10 μL, vector backbone 0.03 pmol, PGK promoter 0.03 pmol, ddH2O supplemented to 20 μL. Incubate at 50°C for 50 min. The resulting plasmid was named pB-PGK-EGFP.
[0053] (5) Add 5 μL of the ligation product to 50 μL of the competent cell suspension, mix well, and place in an ice bath for 30 min. Place in a 42°C water bath for 90 s, then quickly transfer to an ice bath to cool the cells for 2 to 3 min. Add 450 μL of sterile LB medium, shake and culture at 37°C at 180 rpm / min for 1 h. Pipette 100 μL of the transformed competent cells and add to LB solid agar medium containing ampicillin and culture at 37°C for 12 h.
[0054] (6) Single clones were selected and sent to a sequencing company for sequencing. Positive colonies were identified by sequencing and plasmids were extracted in large quantities using the Omega plasmid extraction kit (D6915) according to the instructions.
[0055] Example 2
[0056] Detection of electrotransfection efficiency of PGCs with different DNA dosages
[0057] The PGCs in this embodiment are Bailaihang PGCs, and the acquisition method is as follows:
[0058] Gonads were removed from 6.5-day-old chicken embryos, washed with 100 μL PBS, centrifuged at 500 × g for 5 min, the supernatant was removed, 100 μL 0.25% trypsin was added, digested at 37°C for 7 min, an equal volume of trypsin and complete medium were added to terminate the digestion, the mixture was repeatedly blown with a pipette until the tissue disappeared, centrifuged at 500 × g for 5 min, the supernatant was removed, 400 μL complete medium was added, and cultured at 37°C for 3 h, the suspended cells were transferred to new wells (suspended cells were PGCs, and adherent cells were fibroblasts), and the culture was continued to be expanded.
[0059] This example uses Thermo's NeonNxT electrotransfection kit and NeonNxT electrotransfection system for electrotransfection, including the following steps:
[0060] (1) PGCs were cultured in complete medium without feeder layer and serum, plated in T75 medium at a cell density of 30-50%, and cultured in a 37°C 5% CO2 incubator for 24 h before electroporation assay;
[0061] (2) Transfer the cultured cells to a 10 mL centrifuge tube, centrifuge at 300 × g for 5 min, remove the culture medium, add 5 mL PBS to resuspend the cells, and pipette 10 μL into a cell counting plate for cell counting. Pipet 1×10 cells according to the counting results. 6 The cell resuspension was centrifuged at 300 × g for 5 min, and the supernatant was removed as much as possible;
[0062] (3) Add 100 μL Neon to the cell pellet TM NxT Resuspension R electro-transfection buffer was added with different amounts of pB-PGK-EGFP plasmid DNA (2 / 3 / 4 / 5 μg), and the mixture was mixed by gently pipetting;
[0063] (4) The above transfection system was transferred to an electrode cup and electro-transfected using a NeonNxT electro-transfection system under the conditions of 1100 V, 40 ms, and 1 pulse number;
[0064] (5) After electroporation, the cells were transferred to complete culture medium and cultured at 37°C. The fluorescence signal was observed and detected after 48 h.
[0065] The results are as follows Figure 1As shown in Table 1, the positive rates of PGCs transfected with different DNA dosages (2 / 3 / 4 / 5 μg) based on the Thermo NeonNxT cell nuclear transfection instrument were 30.96±5.40%, 40.67±2.35%, 50.10±1.75% and 35.34±1.66%, respectively.
[0066] Table 1 Statistics of transfection efficiency of different plasmid DNA dosages on the Thermo platform
[0067]
[0068] Example 3
[0069] Detection of electroporation efficiency of PGCs using different electroporation procedures
[0070] The PGCs in this embodiment are Bai Laihang PGCs, and the acquisition method is the same as that in Example 2.
[0071] This example uses Thermo's Neon NxT electrotransfection kit and Neon NxT electrotransfection system for electrotransfection, including the following steps:
[0072] (1) PGCs were cultured in complete medium without feeder layer and serum, plated in T75 medium at a cell density of 30-50%, and cultured in a 37°C 5% CO2 incubator for 24 h before electroporation assay;
[0073] (2) Transfer the cultured cells to a 10 mL centrifuge tube, centrifuge at 300 × g for 5 min, remove the culture medium, add 5 mL PBS to resuspend the cells, and pipette 10 μL into a cell counting plate for cell counting. Pipet 1×10 cells according to the counting results. 6 The cell resuspension was centrifuged at 300 × g for 5 min, and the supernatant was removed as much as possible;
[0074] (3) Add 100 μL Neon to the cell pellet TM NxT Resuspension R electro-transfection buffer was added with 4 μg of pB-PGK-EGFP plasmid DNA and the mixture was mixed by gently pipetting;
[0075] (4) The above transfection system was transferred to an electrode cup and electro-transfected using a Neon NxT electro-transfection system. The electro-transfection conditions were: a. 1100 V, 40 ms, 1 pulse; b. 1300 V, 30 ms, 1 pulse; c. 1500 V, 20 ms, 1 pulse;
[0076] (5) After electroporation, the cells were transferred to complete culture medium and cultured at 37°C. The fluorescence signal was observed and detected after 48 h.
[0077] The results are as follows Figure 2 As shown in Table 2, the positive rates of PGCs transfected using three electroporation programs of the Neon NxT electroporation system (a. 1100 V, 40 ms, pulse number 1; b. 1300 V, 30 ms, pulse number 1; c. 1500 V, 20 ms, pulse number 1) were 47.30±2.20%, 66.03±0.75% and 64.60±2.66%, respectively.
[0078] Table 2 Statistics of transfection efficiency of different programs on the Thermo platform
[0079]
[0080] Example 4
[0081] PGCs electrotransfection efficiency detection based on Lonza platform
[0082] The PGCs in this embodiment are Bai Laihang PGCs, and the acquisition method is the same as that in Example 2.
[0083] This embodiment uses Entranster TM -E is the electrofection buffer, and the electrofection is performed using the Lonza AAD-1001S cell nuclear transfection instrument, including the following steps:
[0084] (1) PGCs were cultured in complete medium without feeder layer and serum, plated in T75 medium at a cell density of 30-50%, and cultured in a 37°C 5% CO2 incubator for 24 h before electroporation assay;
[0085] (2) Transfer the cultured cells to a 10 mL centrifuge tube, centrifuge at 300 × g for 5 min, remove the culture medium, add 5 mL PBS to resuspend the cells, and pipette 10 μL into a cell counting plate for cell counting. Pipet 1×10 cells according to the counting results. 6 The cell resuspension was centrifuged at 300 × g for 5 min, and the supernatant was removed as much as possible;
[0086] (3) Add 100 μL Entranster to the cell pellet TM -E electrotransfection buffer, add 4 μg pB-PGK-EGFP plasmid DNA, and mix evenly by gently pipetting;
[0087] (4) The above transfection system was transferred to an electrode cup and electro-transfected using the A12, A13 and A23 electro-transfection programs of the Lonza AAD-1001S cell nuclear transfection instrument;
[0088] (5) After electroporation, the cells were transferred to complete culture medium and cultured at 37°C. After 48 h, the fluorescence signal was observed and detected and counted by flow cytometry.
[0089] The results are as follows Figure 3 As shown in Table 3, the positive rates of PGCs transfected using the A12, A13, and A23 electroporation programs of the Lonza AAD-1001S nuclear transfection instrument were 25.15±0.54%, 57.56±1.01%, and 42.33±0.63%, respectively.
[0090] Table 3 Statistics of transfection efficiency of different programs on Lonza platform
[0091]
[0092] Example 5
[0093] Application of PGCs miRNA knockdown and overexpression based on Thermo system
[0094] This example uses Thermo's Neon NxT electrotransfection kit and Neon NxT electrotransfection system for electrotransfection, including the following steps:
[0095] (1) PGCs were cultured in complete medium without feeder layer and serum, plated in T75 medium at a cell density of 30-50%, and cultured in a 37°C 5% CO2 incubator for 24 h before electroporation assay;
[0096] (2) Transfer the cultured cells to a 10 mL centrifuge tube, centrifuge at 300 × g for 5 min, remove the culture medium, add 5 mL PBS to resuspend the cells, and pipette 10 μL into a cell counting plate for cell counting. Pipet 1×10 cells according to the counting results. 6 The cell resuspension was centrifuged at 300 × g for 5 min, and the supernatant was removed as much as possible;
[0097] (3) Add 100 μL Neon to the cell pellet TM NxT Resuspension R electro-transfection buffer was added, and an inhibitor or mimic (target miRNA is miR-17-5p, sequence is CAAAGUGCUUACAGUGCAGGUAGU, SEQ ID No. 3) at a final concentration of 400 nM was added, and the mixture was mixed by gently pipetting;
[0098] (4) The above transfection system was transferred to an electrode cup and electro-transfected using a Neon NxT cell nuclear transfection instrument. The electro-transfection conditions were 1300 V, 30 ms, and 1 pulse number.
[0099] (5) After electroporation, the cells were transferred to complete culture medium and cultured at 37°C. After 48 h, the cells were observed and collected.
[0100] (6) Total RNA was extracted using Takara RNA extraction reagent RNAiso Plus according to the instructions, and miDETECT A Track miRNA qRT-PCR Starter Kit was used for miRNA reverse transcription and quantification.
[0101] The results are as follows Figure 4 As shown, using the Neon NxT cell nuclear transfection instrument's 1300V, 30ms electroporation program, transfection of miR-17-5p inhibitor decreased by 99%, and transfection of miR-17-5p mimic overexpressed by 53 times.
[0102] Example 6
[0103] Application of miRNA knockdown and overexpression in PGCs based on Lonza system
[0104] This embodiment uses Lonza's Entranster TM -E is the electrofection buffer, and the electrofection is performed using the Lonza AAD-1001S cell nuclear transfection instrument, including the following steps:
[0105] (1) PGCs were cultured in complete medium without feeder layer and serum, plated in T75 medium at a cell density of 30-50%, and cultured in a 37°C 5% CO2 incubator for 24 h before electroporation assay;
[0106] (2) Transfer the cultured cells to a 10 mL centrifuge tube, centrifuge at 300 × g for 5 min, remove the culture medium, add 5 mL PBS to resuspend the cells, and pipette 10 μL into a cell counting plate for cell counting. Pipet 1×10 cells according to the counting results. 6 The cell resuspension was centrifuged at 300 × g for 5 min, and the supernatant was removed as much as possible;
[0107] (3) Add 100 μL Entranster to the cell pellet TM -E electrotransfection buffer, add inhibitor or mimic (target miRNA is miR-17-5p) at a final concentration of 400 nM, and mix evenly by gently pipetting;
[0108] (4) The above transfection system was transferred to an electrode cup and electro-transfected using A13 of the Lonza AAD-1001S cell nuclear transfection instrument;
[0109] (5) After electroporation, the cells were transferred to complete culture medium and cultured at 37°C. After 48 h, the cells were observed and collected.
[0110] (6) Total RNA was extracted using Takara RNA extraction reagent RNAiso Plus according to the instructions, and miDETECT A Track miRNA qRT-PCR Starter Kit was used for miRNA reverse transcription and quantification.
[0111] The results are as follows Figure 5 As shown, the A13 electroporation procedure of the Lonza AAD-1001S nuclear transfection instrument reduced the expression of miR-17-5pin inhibitor by 98% and overexpressed miR-17-5p mimic by 86 times.
[0112] Comparative Example 1
[0113] Detection of PGCs liposome transfection efficiency
[0114] The PGCs in this comparative example are Bailaihang PGCs, and the acquisition method is the same as that in Example 2.
[0115] (1) PGCs were cultured in complete medium without feeder layer and serum, plated in T75 medium at a cell density of 30-50%, and cultured in a 37°C 5% CO2 incubator for 24 h before electroporation assay;
[0116] (2) Transfer the cultured cells to a 10 mL centrifuge tube, centrifuge at 300 × g for 5 min, remove the culture medium, add 5 mL PBS to resuspend the cells, and pipette 10 μL into a cell counting plate for cell counting. Pipet 1×10 cells according to the counting results. 6 The cell resuspension was centrifuged at 300 × g for 5 min, and the supernatant was removed and re-plated in a 6-well plate;
[0117] (3) Add 4 μg pB-PGK-EGFP plasmid DNA and 8 μL P3000 to 125 μL Opti-MEM serum-free medium TM ;
[0118] (4) Dilute 5 μL Lipofectamine using 125 μL Opti-MEM serum-free medium TM 3000;
[0119] (5) Add the mixed system in step (3) to the mixed system in step (4), mix well, and incubate at room temperature for 15 minutes;
[0120] (6) Add the system of step (5) to the cell culture system, mix well, continue to culture at 37° C., and observe and detect the fluorescence signal after 48 hours.
[0121] The results are as follows Figure 6 As shown, Lipofectamine TM The positive rate of PGCs transfected with 3000 liposomes was 0.82%.
[0122] Comparative Example 2
[0123] PGCs transfection efficiency detection based on Bio-Rad electroporator
[0124] The PGCs in this comparative example are Bailaihang PGCs, and the acquisition method is the same as that in Example 2.
[0125] This comparative example uses Entranster TM -E is the electrofection buffer and Bio-Rad Genepluser cell nuclear transfection instrument, including the following steps:
[0126] (1) PGCs were cultured in complete medium without feeder layer and serum, plated in T75 medium at a cell density of 30-50%, and cultured in a 37°C 5% CO2 incubator for 24 h before electroporation assay;
[0127] (2) Transfer the cultured cells to a 10 mL centrifuge tube, centrifuge at 300 × g for 5 min, remove the culture medium, add 5 mL PBS to resuspend the cells, and pipette 10 μL into a cell counting plate for cell counting. Pipet 1×10 cells according to the counting results. 6 The cell resuspension was centrifuged at 300 × g for 5 min, and the supernatant was removed as much as possible;
[0128] (3) Add 100 μL Entranster to the cell pellet TM -E buffer, and add 4 μg pB-PGK-EGFP plasmid DNA, and mix evenly by gently pipetting;
[0129] (4) The above transfection system was transferred to an electrode cup and electro-transfected using a Bio-Rad Genepluser electro-transfection system. The electro-transfection conditions were as follows: a: 150 V, 25 ms, 1 pulse; b: 140 V, 25 ms, 1 pulse; c: 130 V, 25 ms, 1 pulse; d: 120 V, 25 ms, 1 pulse.
[0130] (5) After electroporation, the cells were transferred to complete culture medium and cultured at 37°C. After 48 h, the fluorescence signal was observed and detected and counted by flow cytometry.
[0131] The results are as follows Figure 7 As shown in Table 4, the positive rates of PGCs transfected using four electroporation programs of the Bio-Rad Genepluser electroporation system (a: 150 V, 25 ms, pulse number 1; b: 140 V, 25 ms, pulse number 1; c: 130 V, 25 ms, pulse number 1; d: 120 V, 25 ms, pulse number 1) were 6.13±0.58%, 31.63±1.11%, 35.66±0.90% and 2.53±0.35%, respectively.
[0132] Table 4 Statistics of transfection efficiency of different programs on Bio-rad platform
[0133]
[0134] Comparative Example 3
[0135] PGCs transfection efficiency detection based on Thermo Neon NxT electroporator
[0136] The PGCs in this comparative example are Bailaihang PGCs, and the acquisition method is the same as that in Example 2.
[0137] This comparative example uses Thermo's Neon NxT electrotransfection kit and Neon NxT electrotransfection system for electrotransfection, including the following steps:
[0138] (1) PGCs were cultured in complete medium without feeder layer and serum, plated in T75 medium at a cell density of 30-50%, and cultured in a 37°C 5% CO2 incubator for 24 h before electroporation assay;
[0139] (2) Transfer the cultured cells to a 10 mL centrifuge tube, centrifuge at 300 × g for 5 min, remove the culture medium, add 5 mL PBS to resuspend the cells, and pipette 10 μL into a cell counting plate for cell counting. Pipet 1×10 cells according to the counting results. 6 The cell resuspension was centrifuged at 300 × g for 5 min, and the supernatant was removed as much as possible;
[0140] (3) Add 100 μL Neon to the cell pellet TM NxT Resuspension R electro-transfection buffer was added with 4 μg of pB-PGK-EGFP plasmid DNA and the mixture was mixed by gently pipetting;
[0141] (4) The above transfection system was transferred to an electrode cup and electro-transfected using a Neon NxT electro-transfection system. The electro-transfection conditions were: a. 1700 V, 20 ms, and 1 pulse; b. 1900 V, 10 ms, and 1 pulse.
[0142] (5) After electroporation, the cells were transferred to complete culture medium and cultured at 37°C. The fluorescence signal was observed and detected after 48 h.
[0143] The results are as follows Figure 8 As shown in Table 5, the PGCs transfected using the Neon NxT electrotransfection system with an electroporation program of 1700 V, 20 ms, and a pulse number of 1 had a high transfection efficiency but a low number of viable cells, with a transfection rate of 54.27±3.73%. The electroporation program with 1900 V, 10 ms, and a pulse number of 1 had a low transfection efficiency and a low number of viable cells, with a transfection rate of 21.74±3.87%.
[0144] Table 5 Statistics of transfection efficiency of different programs on Thermo platform
[0145]
[0146] Comparative Example 4
[0147] Application of miRNA overexpression in PGCs based on Thermo Neon NxT electroporator
[0148] This comparative example uses Thermo's Neon NxT electrotransfection kit and Neon NxT electrotransfection system for electrotransfection, including the following steps:
[0149] (1) PGCs were cultured in complete medium without feeder layer and serum, plated in T75 medium at a cell density of 30-50%, and cultured in a 37°C 5% CO2 incubator for 24 h before electroporation assay;
[0150] (2) Transfer the cultured cells to a 10 mL centrifuge tube, centrifuge at 300 × g for 5 min, remove the culture medium, add 5 mL PBS to resuspend the cells, and pipette 10 μL into a cell counting plate for cell counting. Pipet 1×10 cells according to the counting results. 6 The cell resuspension was centrifuged at 300 × g for 5 min, and the supernatant was removed as much as possible;
[0151] (3) Add 100 μL Neon to the cell pellet TM NxT Resuspension R electro-transfection buffer was added, and 20 μL of 40 μM miR-17-5p mimic was added. The mixture was mixed by gently pipetting.
[0152] (4) The above transfection system was transferred to an electrode cup and electro-transfected using a Neon NxT cell nuclear transfection instrument. The electro-transfection conditions were 1300 V, 30 ms, and 3 pulses.
[0153] (5) After electroporation, the cells were transferred to complete culture medium and cultured at 37°C. The cells were observed after 48 h.
[0154] The results are as follows Fig. 9 As shown, when the miR-17-5p mimic cells were transfected with the NeonNxT cell nuclear transfection instrument at 1300V, 30ms, and 3 pulses, a large number of cells died and could not be used for subsequent cell function and molecular experiments.
[0155] Comparative Example 5
[0156] PGCs transfection efficiency detection based on Thermo Neon
[0157] The PGCs in this embodiment are Bai Laihang PGCs, and the acquisition method is the same as that in Example 2.
[0158] This example uses Thermo's Neon TM Electrolytic Buffer electrofection kit and Neon TM The electrotransfection system performs electrotransfection, including the following steps:
[0159] (1) PGCs were cultured in complete medium without feeder layer and serum, plated in T75 medium at a cell density of 30-50%, and cultured in a 37°C 5% CO2 incubator for 24 h before electroporation assay;
[0160] (2) Transfer the cultured cells to a 10 mL centrifuge tube, centrifuge at 300 × g for 5 min, remove the culture medium, add 5 mL PBS to resuspend the cells, and pipette 10 μL into a cell counting plate for cell counting. Pipet 1×10 cells according to the counting results. 6 The cell resuspension was centrifuged at 300 × g for 5 min, and the supernatant was removed as much as possible;
[0161] (3) Add 100 μL Neon to the cell pellet TM Electrolytic Buffer, add 4 μg pB-PGK-EGFP plasmid DNA, and mix evenly by gently pipetting;
[0162] (4) Transfer the above transfection system to the electrode cup and use Neon TM The electrotransfection system was used for electrotransfection, and the electrotransfection conditions were: a. 1100 V, 40 ms, and the number of pulses was 1; b. 1300 V, 30 ms, and the number of pulses was 1; c. 1500 V, 20 ms, and the number of pulses was 1;
[0163] (5) After electroporation, the cells were transferred to complete culture medium and cultured at 37°C. The fluorescence signal was observed and detected after 48 h.
[0164] The results are as follows Fig.10 As shown, using Neon TM A large number of PGCs cells died when transfected with the three electroporation programs of the electroporation system (a. 1100V, 40ms, pulse number 1; b. 1300V, 30ms, pulse number 1; c. 1500V, 20ms, pulse number 1), and the transfection efficiency was very low.
[0165] In summary, the use of Lipofectamine TM The transfection efficiency of PGCs by liposome 3000 is only about 1%. Obviously, it is difficult to obtain the ideal transfection effect with chemical transfection reagents. At present, there are few reports on the electrotransfection conditions of chicken PGCs. The electrotransfection parameters are crucial to cell survival and transfection efficiency. Therefore, the present invention optimizes the electrotransfection conditions of chicken PGCs. The study used the Neon NxT electrotransfection system of Thermo Company and optimized the plasmid and transfection procedures. 1×10 6 The optimal electrotransfection efficiency (66.03±0.75%) was obtained when 4μg (1pmol) of PGCs was used at 1300V, 30ms, and 1 pulse. The transfection efficiency of miR-17-5p inhibitor decreased by 99%, and the transfection efficiency of miR-17-5pmimic was 53 times higher. The electrotransfection efficiency of 1500V, 20ms, and 1 pulse was 64.60±2.66%. The positive rate of PGCs transfected by the A13 electrotransfection program of Lonza AAD-1001S nuclear transfection instrument was 57.56±1.01%, the transfection efficiency of miR-17-5p inhibitor decreased by 98%, and the transfection efficiency of miR-17-5p mimic was 86 times higher.
[0166] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.
[0167] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. A method for electrotransfection of chicken primordial germ cells, characterized in that: The steps include: (1) Cultivation and counting of chicken primordial germ cells; (2) mixing the counted chicken primordial germ cells with an electrotransfection buffer and a material to be transfected to obtain an electrotransfection system; The material to be transfected is a miRNA inhibitor, a miRNA mimic or DNA; (3) Transfer the electro-transfection system to an electrode cup and perform transfection using an electroporator.
2. The method according to claim 1, characterized in that The specific operation of step (1) is: culturing chicken primordial germ cells using complete culture medium, then centrifuging, resuspending with PBS, and counting cells.
3. The method according to claim 1, characterized in that In step (2), When the material to be transfected is DNA, the ratio of chicken primordial germ cells, electroporation buffer, and DNA is: 1×10 6 pcs: 100μL: 4μg; When the material to be transfected is a miRNA inhibitor or a miRNA mimic, the ratio of the chicken primordial germ cells, electroporation buffer, and miRNA inhibitor / miRNA mimic is: 1×10 6 pcs:100μL:400nM.
4. The method according to claim 1, characterized in that The electroporator is a Thermo Neon NxT cell nuclear transfection instrument or a Lonza AAD-1001S cell nuclear transfection instrument.
5. The method according to claim 4, characterized in that In step (3), When the electroporator is a Thermo Neon NxT cell nuclear transfection instrument, the transfection parameters are 1300V, 30ms, and the number of pulses is 1 or 1500V, 20ms, and the number of pulses is 1; When the electroporator is Lonza AAD-1001S nuclear transfection instrument, the transfection program is A13.