Identification method of transposon insertion site

Abstract

The invention belongs to the technical field of biomolecular diagnosis, particularly relates to an identification method of a transposon insertion site, and aims to solve the problem that an existing method cannot provide accurate and comprehensive information of the transposon insertion site. The method comprises the following steps: transferring an MTD artificial transposon with specific DNA Barcode, gRNA and CRISPR / Cas system gene editing tool enzyme to a target cell, carrying out gene editing on the target cell, the MTD artificial transposon comprising a sequence represented by SEQ ID NO: 1; and identifying the position information of the specific DNA Barcode through PCR (Polymerase Chain Reaction) amplification and sequencing or probe hybridization so as to obtain the insertion position of the transposon. The specific DNA Barcode is marked on the MTD transposon, and the accurate insertion position of the MTD transposon can be obtained by detecting the DNA Barcode.

Description

Technical Field

[0001] The present invention relates to the technical field of biomolecular diagnosis, and in particular to a method for identifying a transposon insertion site. Background Art

[0002] Transposons are a class of DNA sequences that can move in the genome and are widely present in a variety of organisms. They play an important role in genome recombination, gene expression regulation, and genetic diversity. In recent years, transposon technology has been widely used in the fields of genome editing and gene therapy. Although traditional gene editing technology can achieve precise gene editing, it is often difficult to determine the insertion site when used in vivo, which limits its wide application in clinical applications and achieves accurate understanding of its functions and applications.

[0003] In the field of gene therapy and genetic disease diagnosis, accurate identification of transposon insertion sites is important for understanding treatment effects, monitoring potential side effects, and evaluating long-term safety. Traditional detection methods, such as PCR-based detection and DNA sequencing, although able to provide certain information, often have problems such as low sensitivity, complex operation, and high cost. In addition, these methods are usually unable to provide accurate and comprehensive information about the insertion site, especially in a complex genomic context. Hybridization chain reaction (HCR) technology has the characteristics of isothermal, enzyme-free, high sensitivity, and high specificity, and is suitable for in situ detection of a variety of biological samples.

[0004] In view of this, the present invention is proposed. Summary of the invention The object of the present invention is to provide a method for identifying a transposon insertion site, a corresponding MTD transposon and a gene editing kit. The present invention transforms the MTD transposon, and the transformed MTD transposon carries a specific DNA Barcode. By detecting the Barcode, the insertion site of the transposon can be accurately obtained. In a first aspect, the present invention provides a method for identifying an MTD transposon insertion site, the method comprising: (1) delivering an MTD artificial transposon with a specific DNA Barcode, gRNA and a CRISPR / Cas system gene editing tool enzyme to a target cell to perform gene editing on the target cell, wherein the MTD artificial transposon includes a sequence shown in SEQ ID NO: 1; (2) Identifying the position information of the specific DNA Barcode by PCR amplification and sequencing or probe hybridization to obtain the insertion position of the transposon. In some specific embodiments, the target gene for gene editing is selected from the group consisting of CEBPB, ILZF3, STAT1, PU.1 and KIF4; preferably, the gRNA includes a sequence selected from any one of SEQ ID NOs: 2-16. In some specific embodiments, the probe includes a start probe and a signal probe labeled with a fluorescent group, the start probe is used to specifically bind to the MTD artificial transposon, and the signal probe is used to bind to the start probe and amplify the signal of the start probe. In some specific embodiments, the start probe has a sequence as shown in any one of SEQ ID NOs:17, 20-22, and the signal probe has a sequence as shown in SEQ ID NO:18. In some specific embodiments, the CRISPR / Cas system gene editing tool enzyme is selected from Cas9, Cas12, Cas13, Cas14, APOBEC1, APOBEC2, APOBEC3 and APOBEC4; preferably, the CRISPR / Cas system gene editing tool enzyme is Cas9. In a second aspect, the present invention provides an MTD artificial transposon, wherein the MTD artificial transposon comprises a sequence shown in SEQ ID NO:1. In a third aspect, the present invention provides a gene editing kit, comprising the MTD artificial transposon of the present invention, gRNA and a CRISPR / Cas system gene editing tool enzyme. In some specific embodiments, the gRNA includes a sequence selected from any one of SEQ ID NOs: 2-16. In some specific embodiments, the gene editing kit further includes reagents for detecting the transposon insertion site; preferably, including: PCR amplification reagents and DNA sequencing reagents, or hybridization probes.

[0005] In some specific embodiments, the hybridization probe includes a start probe and a signal probe labeled with a fluorescent group, the start probe is used to specifically bind to the MTD artificial transposon, and the signal probe is used to bind to the start probe and amplify the signal of the start probe; preferably, the start probe has a sequence as shown in any one of SEQ ID NO:17, 20-22, and the signal probe has a sequence as shown in SEQ ID NO:18.

[0006] Based on the above technical solutions, the technical effects that can be achieved by the present invention are:

[0007] The present invention provides a new method for identifying transposon insertion sites, which realizes rapid, accurate and highly sensitive detection of transposon insertion sites through the design of specific artificial DNA Barcode sequences. Compared with traditional detection methods, the present invention improves the accuracy and reliability of gene editing technology. In some schemes, the present invention also combines the application of AB padlock cascade probes to achieve signal amplification and in situ detection. The method of the present invention is not only applicable to mouse models, but can also be extended to the detection of transposons in the human genome, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0008] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0009] Figure 1 It is a flow chart of the method for identifying the transposon insertion site shown in the present invention.

[0010] Figure 2 This is a confocal microscopy image of the MTD transposon in a gene expression site in a 20-micron frozen section of mouse kidney.

[0011] Figure 3 This is a schematic diagram of the structure formed by hybridization of the signal probe and the start probe stem-loop structure. DETAILED DESCRIPTION

[0012] In order to more clearly illustrate the purpose, features and advantages of the present invention, the following will be described in detail with reference to the accompanying drawings and specific embodiments. It should be noted that the various embodiments of the present invention and their features can be combined with each other without conflict. In addition, the present invention may also adopt other embodiments different from those described herein, so the protection scope of the present invention is not limited to the specific embodiments disclosed below. The materials, reagents and detection methods involved in the implementation method, unless otherwise specified, can be obtained through commercial channels. Example 1: Design of specific artificial DNA barcode sequence

[0013] According to the insertion position of mouse MTD transposon in the whole mouse genome, a specific DNA Barcode is designed. The details are as follows.

[0014] Step 1: Match the mouse MTD transposon according to its position in the mouse genome, and search 10 bases before and after its site:

[0015] (1) The MTD transposon is a long terminal repeat sequence that is distributed in mammals and belongs to the LTR transposon superfamily. It is widely present in the mouse genome. The accession of MTD in the DFAM database is DF000001955. The insertion site of the MTD transposon sequence in the GRCm39 mouse genome was obtained from the DFAM database. The GRCm39 mouse genome sequence file (including all sequence data of chr1-chr19 and chrX and chrY) was obtained from the UCSC Genome Browser Home.

[0016] (2) By selecting the chr value in the file and the condition that strand is +, the base sequence of the first ten bits and the last ten bits of the MTD transposon are matched in the chr value sequence corresponding to the whole mouse genome, and the output is a txt file. The corresponding sequence is defined as the output base sequence.

[0017] Step 2: Based on the base sequences of the first ten and last ten of the MTD transposon, a highly specific artificial 15-bit DNA Barcode is designed. Its specificity lies in that the artificially inserted MTD sequence can be specifically identified by the nucleic acid probe without being interfered by the sequences before and after the insertion position of the MTD transposon in the genome:

[0018] A 15-bit base sequence is randomly generated and string matched in the output base sequence to check the number of times it appears in the output base sequence. If the number of occurrences does not exceed 1, the sequence is considered to be highly specific. The string matching loop of the randomly generated sequence is traversed up to 1000 times. The base balance calculation is performed on the highly specific 15-bit base sequence obtained by string matching. The calculation indicators are: (1) A, T, G, and C all exist in the 15-bit base sequence. (2) The ratio of A, T, G, and C is average and the deviation does not exceed 10%. The base sequence that meets the requirements after the base balance calculation is used as a specific artificial DNA barcode.

[0019] Step 3, constructing an MTD transposon with an artificial DNA Barcode: by using PCR and genetic engineering techniques, the DNA Barcode sequence is integrated into the 3' non-coding region of the MTD transposon sequence for subsequent specific recognition and insertion site identification. Specifically, the MTD transposon with an artificial DNA Barcode has a sequence as shown in SEQ ID NO: 1. Example 2: In vivo knock-in of a transposon sequence containing a specific artificial DNA barcode

[0020] Step 1. Design sgRNA according to the knock-in sites of target genes CEBPB, ILZF3, STAT1, PU.1 and KIF4: Use the Invitrogen TrueDesign gene editing tool provided by Thermo Fisher to select the upstream position of the target gene site, no more than 2000bp. Select the sgRNA with a score marker color of green. For example, the sgRNA sequence is as follows:

[0021] CEBPB sgRNA sequence 1 is shown in SEQ ID NO. 2;

[0022] CEBPB sgRNA sequence 2 is shown in SEQ ID NO. 3;

[0023] CEBPB sgRNA sequence 3 is shown in SEQ ID NO. 4;

[0024] ILZF3 sgRNA sequence 1 is shown in SEQ ID NO. 5;

[0025] ILZF3 sgRNA sequence 2 is shown in SEQ ID NO.6;

[0026] ILZF3 sgRNA sequence 3 is shown in SEQ ID NO.7;

[0027] STAT1 sgRNA sequence 1 is shown in SEQ ID NO.8;

[0028] STAT1 sgRNA sequence 2 is shown in SEQ ID NO.9;

[0029] STAT1 sgRNA sequence 3 is shown in SEQ ID NO.10;

[0030] PU.1sgRNA sequence 1 is shown in SEQ ID NO.11;

[0031] PU.1sgRNA sequence 2 is shown as SEQ ID NO.12;

[0032] PU.1sgRNA sequence 3 is shown in SEQ ID NO.13;

[0033] KIF4 sgRNA sequence 1 is shown in SEQ ID NO. 14;

[0034] KIF4 sgRNA sequence 2 is shown in SEQ ID NO.15;

[0035] KIF4 sgRNA sequence 3 is shown as SEQ ID NO.16.

[0036] Step 2, using SORT-LNP technology to achieve in vivo knock-in of transposon: (1) 1,2-dioleoyl-3-trimethylammonium propane, ADP-2K, DOPE, and cholesterol are dissolved in ethanol at a ratio of 40%, 15%, 15%, and 3%, respectively. (2) The sgRNA and cas9 protein are mixed at a molar ratio of 1:1.2 to assemble a ribonucleoprotein complex (RNP), and incubated at room temperature for 20 minutes to form an RNP complex. (3) The RNP complex is compounded with the MTD transposon with a specific artificial DNA barcode described in Example 1 at a molar ratio of 1:1. (4) The compounded RNP:MTD transposon solution is diluted with PBS at a ratio of 1:1 at pH 7.5, and the final RNP concentration is 1 μM. (5) The RNP solution is quickly mixed with the lipid solution in ethanol at a volume ratio of 4:1 and a weight ratio of 1:6.5. Incubate at room temperature for 1 hour to form liposomes. (6) The assembled liposomes were injected into the mouse via the tail vein at a dose of 3 mg / kg based on the amount of sgRNA. The injections were repeated every three days for one week. Example 3: PCR amplification of upstream and downstream regions of target genes to detect artificial DNA-barcode

[0037] The synthetic primers were designed based on the sequence of 30 bases before and after the predetermined insertion site of the target gene by MTD-Barcode. After culturing for 3 weeks after the injection, the peripheral blood of the mice described in Example 2 was collected, and DNA was extracted from the peripheral blood, and PCR amplification was performed with the aforementioned synthetic primers. The PCR-amplified samples were sequenced, and if the sequenced DNA chain included the sequence of the MTD transposon with the artificial DNA Barcode shown in SEQ ID NO: 1, it indicated that the MTD transposon was inserted into the predetermined region of the target gene. Example 4: Visual identification of transposon insertion sites using fluorescent coupled probes

[0038] Step 1: Design and synthesize specific starter probe (probe1) and signal probe (probe2) coupled with fluorescent dye according to MTD sequence and DNA Barcode:

[0039] Probe 1 is a single-stranded DNA probe designed for the target sequence. It contains the following parts: (1) Target complementary sequence: This part of the sequence is complementary to the partial sequence of the MTD transposon and the specific DNA Barcode sequence for specific binding. (2) Stem-loop structure: A stem-loop structure is designed at the 5' end of probe 1. This structure forms a hairpin shape when there is no target sequence, making it temporarily impossible for the fluorescent marker group to bind to the target sequence. (3) Fluorescent marker group: A fluorescent marker group is attached to the 5' end of the stem-loop structure for subsequent signal detection.

[0040] Probe 2 is designed to complementarily bind to the stem-loop structure of probe 1 and trigger signal amplification. It contains the following parts: (1) Complementary sequence: This part of the sequence is complementary to the stem-loop structure of probe 1 and is used to trigger LHCR. (2) Signal amplification sequence: Probe 2 contains a signal amplification sequence. These sequences can bind to the stem-loop structure of probe 1 to form a chain reaction and amplify the signal. (3) Fluorescent labeling group: A fluorescent labeling group is attached to the 3' end of probe 2 for signal detection and amplification.

[0041] Probe 1 specifically binds to the target sequence through its complementary sequence. The stem-loop structure of probe 1 partially folds to form a hairpin structure, and the fluorescent marker group is temporarily unable to bind to the target sequence. Probe 2 binds to the stem-loop structure of probe 1 through its complementary sequence, opens the stem-loop structure, and exposes the fluorescent marker group, ready to trigger LHCR. As described above, probe 1 binds to the target sequence to form HHS.

[0042] After probe 2 binds to HHS, due to its design, it can further trigger more probes 2 to bind to the stem-loop structure of probe 1, forming a chain reaction. As more probes 2 bind to HHS, the fluorescent signal is amplified, thereby achieving highly sensitive detection of the target sequence.

[0043] The specific probe information is as follows:

[0044] CEBPB priming probe probe1 is shown in SEQ ID NO.17;

[0045] IKZF3 start probe probe1 is shown in SEQ ID NO.19;

[0046] STAT1 activating probe probe1 is shown in SEQ ID NO.20;

[0047] PU.1 priming probe probe1 is shown in SEQ ID NO.21;

[0048] The KIF4 initiation probe probe1 is shown as SEQ ID NO.22.

[0049] The signal probe probe2 is shown as SEQ ID NO.18.

[0050] Step 2. Use the designed fluorescent coupling probe to perform in situ hybridization on the peripheral blood samples of the mice described in Example 2, and co-assemble the DNA hairpin structure through the modularly assembled DNA minimum skeleton to achieve signal amplification: (1) Fix the sample on a glass slide. Permeabilize the sample with PBS and 0.1% Triton X-100. (2) Mix the sample with BSA and preheat the DNA probe to 37°C. (3) Add the preheated start probe probe1 and signal probe probe2 to 2xSSC and mix evenly. (4) Cover the sample with the probe-buffer mixture and place the glass slide in a wet box. (5) Place the wet box in a hybridization oven and incubate at 37°C overnight. (6) After incubation, gently wash the glass slide with 0.2xSSC and repeat twice.

[0051] Step 3: Analyze the obtained fluorescence image to determine the presence and precise location of the transposon insertion site: Use a confocal microscope to quantitatively analyze the fluorescence signal to determine the fluorescence intensity and distribution of the transposon insertion site. Turn on the confocal microscope and set the excitation wavelength to 649nm. Set the emission wavelength filter to 670nm. It can be seen that there is a strong fluorescence signal at the insertion site. For example, Figure 2 shown. Example 5. Transposon insertion site identification kit

[0052] Kit composition:

[0053] Artificially synthesized transposon: A target transposon containing a specific DNA barcode sequence (SEQ ID NO.1). This transposon is used as the object to be detected in the experiment, and the barcode sequence it carries is used for specific identification and positioning.

[0054] sgRNA: gRNA designed for preselected target genes (such as CEBPB, ILZF3, STAT1, PU.1, and KIF4), each target gene can be provided with three different gRNA sequences to improve editing efficiency and specificity.

[0055] CRISPR / Cas system gene editing tool enzyme: Provides Cas9 protein, which is preferably used in this kit due to its high editing efficiency and specificity. It plays a key role in the gene editing process and edits the genome of the target cell.

[0056] LNP formulation: A lipid nanoparticle formulation for delivering gRNA and Cas9 protein, comprising the following components: (1) Cationic lipids: such as 1,2-dioleoyl-3-trimethylammonium propane, which helps bind to negatively charged nucleic acid molecules to form a stable complex and promote cellular uptake. (2) Auxiliary lipids: such as 1,2-distearoyl-sn-glycero-3-phosphocholine, which helps maintain the structural stability and function of lipid nanoparticles. (3) Cholesterol: Enhances the stability of the lipid membrane, regulates the fluidity of the membrane, and helps improve the circulation time and stability of lipid nanoparticles in the body. (4) PEG: It can reduce the nonspecific interaction of lipid nanoparticles with plasma proteins, prolong their circulation time in the blood, and improve their delivery efficiency to target tissues.

[0057] In some embodiments, the kit may further include one or more of the following reagents:

[0058] PCR amplification reagents: including high-fidelity DNA polymerase, dNTPs, MgCl2 and optimized buffer for amplifying transposon sequences containing DNA Barcode.

[0059] Sequencing reagents: Provides reagents and primers required for Sanger sequencing to determine the precise insertion site of the transposon.

[0060] Example 4 relates to the start probe and the signal probe.

[0061] Hybridization and Wash Buffers: Include hybridization buffer and wash buffer, and optimize the conditions to enhance probe binding specificity and signal intensity.

[0062] User Manual: Contains detailed operating procedures, experimental design guidance, expected results, and troubleshooting guide.

[0063] Instructions for use of the kit:

[0064] Transposon knock-in in vivo: MTD synthetic transposon, sgRNA and Cas9 protein are mixed in a certain proportion, and delivered into target cells using a suitable delivery system (such as the LNP formula in this kit) for in vivo knock-in operation. In the specific operation, sgRNA and Cas9 protein are first mixed and assembled into a ribonucleoprotein complex (RNP) at a molar ratio of 1:1.2, and incubated at room temperature for 20 minutes. Then the MTD transposon with a specific artificial DNA Barcode is compounded with RNP at a molar ratio of 1:1, and then the compounded RNP:MTD transposon solution is diluted to an appropriate concentration (RNP concentration is 1μM) with PBS, and finally the assembled liposomes are injected into mice through the tail vein at a dose of 3mg / kg, once every three days, and continuously injected for one week to achieve effective knock-in of the transposon in the target cells in vivo.

[0065] DNA extraction: After the transposon knock-in operation is completed, after a certain period of culture (such as 3 weeks after injection), collect peripheral blood samples from experimental animals (such as mice), and use conventional genomic DNA extraction methods to extract genomic DNA from the peripheral blood to provide a template for subsequent PCR amplification and detection.

[0066] Fluorescence hybridization: (1) Sample preparation: The tissue sample containing the transposon insertion is made into a frozen section with a thickness of 20 microns, and the section is fixed on a glass slide. The sample is permeated with PBS and 0.1% Triton X-100 to increase the permeability of the cell membrane, so that the probe can enter the cell and hybridize with the target sequence. The sample is then mixed with BSA to block nonspecific binding sites and reduce background interference. (2) Probe hybridization: The designed and synthesized starter probe probe1 and signal probe probe2 are preheated to 37°C, and then added to 2xSSC buffer and mixed evenly. The probe-buffer mixture is covered on the sample, the slide is placed in a wet box, and the wet box is placed in a hybridization oven and incubated at 37°C overnight. In this process, the starter probe probe1 specifically binds to the target RNA, and its stem-loop structure folds to form a hairpin shape, and the fluorescent labeling group is temporarily shielded; the signal probe probe2 complementarily binds to the stem-loop structure of probe1 during the incubation process, opens the stem-loop structure, exposes the fluorescent labeling group, and is ready to trigger the HCR reaction. (3) Signal amplification and detection: After the incubation is completed, the slide is gently washed with 0.2xSSC buffer, and repeated twice to remove unbound probes. Then the HCR reaction is performed. After the signal probe probe2 binds to probe1, due to its special design, more probe2 can be triggered to bind to probe1, forming a chain reaction, so that the fluorescence signal is continuously amplified. Finally, the fluorescence signal is detected using a confocal microscope, and the appropriate excitation wavelength (such as 649nm) and emission wavelength filter (such as 670nm) are set to observe and collect fluorescence images. At the transposon insertion site, due to the strong amplification of the fluorescence signal caused by the HCR reaction, obvious fluorescent bright spots can be directly observed by the naked eye, thereby realizing the visual identification of the transposon insertion site. By analyzing the fluorescence intensity and distribution, the precise location and expression level of the transposon insertion site can be further determined.

[0067] Sequencing (used to accurately determine the insertion site, which can be verified by visual detection): If the insertion site of the transposon needs to be determined more accurately, the PCR amplification product can be sequenced. The PCR product is mixed with the sequencing gel loading buffer, loaded into the sequencing gel, and separated by electrophoresis using the ABI 3730xl automated DNA sequencer. The electrophoresis pattern is then analyzed using Sequencher software to read the DNA sequence. By comparing with the known genome sequence, the exact insertion position of the transposon in the genome and the sequence information around the insertion site are determined.

[0068] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

[0069] Sequence Listing

[0070] SEQ ID NO.1:

[0071] TTAGGGTTTCTATTGCTGTGATAAAACACCATGACCA AA

[0072] SEQ ID NO.2:CCGCGTCCGTGGCCATCGCG

[0073] SEQ ID NO.3:CCCGCGATGGCCACGGACG

[0074] SEQ ID NO.4:ACCCGCGTCCGTGGCCATCG

[0075] SEQ ID NO.5:AGATATCTCAAGCCTAGACT

[0076] SEQ ID NO.6:CACATCCTGTTTGTCTTGGCG

[0077] SEQ ID NO.7:AAAGAGGACCTGCCTAGTCT

[0078] SEQ ID NO.8:CACGCCGGGTAGGGAGCGCG

[0079] SEQ ID NO.9:GGGTAGGGAGCGCGGACC

[0080] SEQ ID NO.10:AGGGAGCGCGCGGACCAGGA

[0081] SEQ ID NO.11:GGGCGGTGATGTCACCCCAA

[0082] SEQ ID NO.12:CCAAGGGGACTATCTCCCCAG

[0083] SEQ ID NO.13:ACTGGGAGATAGTCCCCTTG

[0084] SEQ ID NO.14:CAGGCTGTACGCGCTCCGAT

[0085] SEQ ID NO.15:AAACTTGGCGGTTAAAGCTC

[0086] SEQ ID NO.16:CTGTACGCGCTCCGATTGGC

[0087] SEQ ID NO.17:

[0088] TTTTATCACAGCAATAGAAACCCTAACTCGgAggAgggCAgCAAACggAA

[0089] SEQ ID NO.18:

[0090] AGTTAGGTAACCGCGTTTGGTCATTGGTGAAgAgAgTCTTCCTTTACg SEQ ID NO.19:

[0091] TTTTATCACAGCAATAGAAACCCTAAAAGCgAggAgggCAgCAAACggAA

[0092] SEQ ID NO.20:

[0093] TTTTATCACAGCAATAGAAACCCTAAGTCCgAggAgggCAgCAAACggAA

[0094] SEQ ID NO.21:

[0095] TTTTATCACAGCAATAGAAACCCTAAAGCCgAggAgggCAgCAAACggAA SEQ ID NO.22:

[0096] TTTTTATCACAGCAATAGAAACCCTAAAATGgAggAgggCAgCAAACggAA

Claims

1. A method for identifying an MTD transposon insertion site, characterized in that: The method comprises: (1) delivering an MTD artificial transposon with a specific DNA Barcode, gRNA and a CRISPR / Cas system gene editing tool enzyme to a target cell to perform gene editing on the target cell, wherein the MTD artificial transposon includes a sequence shown in SEQ ID NO: 1; (2) Identifying the position information of the specific DNA Barcode by PCR amplification and sequencing or probe hybridization to obtain the insertion position of the transposon.

2. The method according to claim 1, characterized in that The target gene for gene editing is selected from the group consisting of CEBPB, ILZF3, STAT1, PU.1 and KIF4; preferably, the gRNA comprises a sequence selected from any one of SEQ ID NOs: 2-16.

3. The method according to claim 1 or 2, characterized in that: The probes include a start probe and a signal probe marked with a fluorescent group, wherein the start probe is used to specifically bind to the MTD artificial transposon, and the signal probe is used to bind to the start probe and amplify the signal of the start probe.

4. The method according to claim 3, characterized in that The start probe has a sequence as shown in any one of SEQ ID NOs: 17, 20-22, and the signal probe has a sequence as shown in SEQ ID NO:

18.

5. The method according to any one of claims 1 to 4, characterized in that: The CRISPR / Cas system gene editing tool enzyme is selected from Cas9, Cas12, Cas13, Cas14, APOBEC1, APOBEC2, APOBEC3 and APOBEC4; preferably, the CRISPR / Cas system gene editing tool enzyme is Cas9.

6. An MTD artificial transposon, characterized in that: The MTD artificial transposon includes the sequence shown in SEQ ID NO:

1.

7. A gene editing kit, characterized in that: The kit comprises the MTD transposon according to claim 6, gRNA and CRISPR / Cas system gene editing tool enzyme.

8. The gene editing kit according to claim 7, characterized in that The gRNA includes a sequence selected from any one of SEQ ID NOs: 2-16.

9. The gene editing kit according to claim 7, characterized in that The gene editing kit also includes reagents for detecting the transposon insertion site; preferably, including: PCR amplification reagents and DNA sequencing reagents, or hybridization probes.

10. The gene editing kit according to claim 9, characterized in that The hybridization probe includes a start probe and a signal probe labeled with a fluorescent group, the start probe is used to specifically bind to the MTD artificial transposon, and the signal probe is used to bind to the start probe and amplify the signal of the start probe; preferably, the start probe has a sequence as shown in any one of SEQ ID NO:17, 20-22, and the signal probe has a sequence as shown in SEQ ID NO:18.

Images