Primer pair, kit and detection method for detecting bombyx mori nuclear polyhedrosis virus

Abstract

The invention provides a primer pair, a kit and a detection method for detecting bombyx mori nuclear polyhedrosis virus, and belongs to the technical field of pathogen detection. A highly conserved gene GP64 of the BmNPV is selected as a detection target, a primer pair qNPVgp64-183F and a primer pair qNPVgp64-183R which can be used for specific detection of the BmNPV are designed, and a specific probe pNPVgp64-183 is designed. The invention also provides a detection method of the bombyx mori nuclear polyhedrosis virus. The BmNPV fluorescent quantitative PCR detection method established on the basis of the primer and the probe is good in specificity, high in sensitivity, simple to operate and few in required instruments, can realize early diagnosis of the bombyx mori nuclear polyhedrosis, reduces economic loss caused by the bombyx mori nuclear polyhedrosis to silkworm cocoon and silkworm egg production, and promotes green and healthy development of the silkworm industry.

Description

Technical Field

[0001] The invention belongs to the technical field of pathogen detection, and in particular relates to a primer pair, a kit and a detection method for detecting silkworm nuclear polyhedrosis virus. Background Art

[0002] Bombyx mori nuclear polyhedrosis, also known as blood-type pus disease, is the most serious viral infectious disease in silkworm production. Its pathogen is Bombyx mori Nuclear Polyhedrosis Virus (BmNPV). BmNPV has two completely different virion phenotypes: budding virus particles (budded virus, BV) and inclusion-derived virus particles (occlusion-derived virus, ODV). Budded virus is mainly formed in the early stage of baculovirus infection, mainly mediating systemic infection between cells, while inclusion virus is mainly formed in the late stage of virus infection, when a large amount of protein wraps the virus particles, which has a very good protective effect on the virus particles embedded therein. Under an optical microscope, it can be clearly observed that its shape is hexagonal and has a certain refractive index. BmNPV is highly contagious and mainly infects larvae through horizontal transmission, with a wide range of impact. After infecting silkworms, the course of the disease is short and the disease spreads rapidly. When obvious symptoms appear, it is already in the late stage of the disease and is difficult to recover. It often causes serious production reduction or even total crop failure in the silkworm industry, seriously affecting the benefits and sustainable development of the sericulture industry. It is reported that the losses caused by silkworm diseases in the national sericulture production process account for 30% of the total output each year, of which 70% is caused by BmNPV infection. There is no effective cure for the silkworm production. The main methods to avoid large-scale outbreaks of silkworm nuclear polyhedrosis are early detection and elimination of diseased silkworms, and disinfecting of silkworm seats, so as to recover some economic losses. Therefore, it is extremely important to establish a sensitive, rapid, stable and easy-to-operate high-throughput detection method to prevent large-scale outbreaks of silkworm nuclear polyhedrosis in the silkworm breeding process and to accurately implement the disinfecting of BmNPV in the silkworm breeding environment.

[0003] At present, the commonly used detection methods of BmNPV include naked eye detection, microscopic examination, enzyme-linked immunosorbent reaction (ELISA) based on immunology, and molecular biological methods based on nucleic acid detection. Naked eye detection is mainly based on the main pathological symptoms of silkworm nuclear polyhedrosis. Microscopic examination is the most widely used detection method in traditional silkworm production. It mainly determines the infection by observing the inclusion bodies of BmNPV under a microscope. The sensitivity and accuracy of these two methods largely depend on the experience of production personnel, and silkworms are often in the late stage of infection when obvious symptoms appear.

[0004] The detection method of loop-mediated isothermal amplification (LAMP) and recombinase polymerase amplification (RPA) technology combined with nucleic acid lateral flow test paper is sensitive and can be amplified at room temperature, but LAMP and RPA are very prone to cross-contamination under non-laboratory conditions, resulting in false positives, and it is difficult to promote them on a large scale in production. CRISPR / Cas13a detection is sensitive and has high specificity, but this method has high requirements for detection personnel and the cost of reagents and consumables is also high. Although the fluorescent quantitative PCR dye method is sensitive and low-cost, it has poor specificity and is prone to false positive results. Summary of the invention

[0005] The present invention provides a primer pair, a kit and a detection method for detecting Bombyx mori nuclear polyhedrosis virus, which provide a reliable method for early diagnosis of BmNPV in the silkworm breeding process and precise disinfection of the silkworm breeding environment.

[0006] The invention provides a primer pair for detecting Bombyx mori nuclear polyhedrosis virus. The primer pair is designed for the conservative gene GP64 of Bombyx mori nuclear polyhedrosis virus.

[0007] In a preferred embodiment of the present invention, the upstream primer qNPVgp64-183F having a nucleotide sequence as shown in SEQ ID No.1 and the downstream primer qNPVgp64-183R having a nucleotide sequence as shown in SEQ ID No.2 are included.

[0008] In a preferred embodiment of the present invention, it further comprises a probe having a nucleotide sequence as shown in SEQ ID No.3.

[0009] In a preferred embodiment of the present invention, the 5' end of the probe is labeled with a fluorescent group, and the 3' end is labeled with a quenching group.

[0010] The present invention also provides a kit for detecting Bombyx mori nuclear polyhedrosis virus, comprising the above primer pair and a reagent for qPCR amplification.

[0011] The present invention also provides the use of the primer pair or the kit in detecting Bombyx mori nuclear polyhedrosis virus.

[0012] The present invention also provides a method for detecting Bombyx mori nuclear polyhedrosis virus, comprising the following steps: extracting sample genomic DNA as a template, configuring a qPCR system with the above-mentioned primer pair or the primer pair and probe in the above-mentioned kit, and performing qPCR amplification; when the amplification result of the sample has a specific amplification curve and a Ct value ≤38, it is judged as positive; when the amplification result of the sample has no specific amplification curve or no Ct value, it is judged as negative; when the amplification result of the sample has a specific amplification curve and a Ct value of 38<Ct value ≤40, it is judged as a positive suspicious sample and needs to be re-tested.

[0013] In a preferred embodiment of the present invention, the sample genomic DNA is taken from at least one of the following: diseased pupae, diseased silkworm larvae, diseased eggs and silkworm rearing environment.

[0014] In a preferred embodiment of the present invention, the qPCR system, based on 10 μL, includes: 0.1 μL of probe, 0.2 μL of upstream and downstream primers, 7.5 μL of reaction solution and 2 μL of template.

[0015] In a preferred embodiment of the present invention, the reaction procedure of the qPCR amplification includes: 37°C for 2 min; 95°C for 30 s; 95°C for 10 s, collecting fluorescence at 60°C for 30 s, and 40 cycles.

[0016] Beneficial effects: The present invention selects the highly conserved gene GP64 of BmNPV as the detection target, and designs a primer pair qNPVgp64-183F and qNPVgp64-183R that can be used for specific detection of BmNPV, and the nucleotide sequences thereof are shown in SEQ ID No.1 and SEQ ID No.2.

[0017] The present invention also establishes a BmNPV rapid detection method based on qPCR, and designs a specific probe pNPVgp64-183 with a nucleotide sequence as shown in SEQ ID No.3. The detection method uses common pathogenic genomic DNA in silkworm production as a template. The results show that the primers and probes can only specifically detect BmNPV and can be used for BmNPV specific detection; the detection sensitivity of the positive standard plasmid can reach 0.85 copies / μL, and the detection sensitivity of the BmNPV genome can reach 2fg / μL, with high sensitivity. The BmNPV fluorescent quantitative PCR detection method established by the present invention based on the primers and probes has good specificity, high sensitivity, simple operation, and few instruments required. It can be used for the specific detection of BmNPV in the early stage of silkworm infection and in the silkworm breeding environment. It can not only be quickly promoted and used in the silkworm industry, but also can realize high-sensitivity and high-throughput early detection of BmNPV, and realize early diagnosis of nuclear polyhedrosis, which is of great significance to reducing the economic losses caused by silkworm nuclear polyhedrosis to silkworm cocoon and silkworm seed production, and promoting the green and healthy development of the sericulture industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The figure shows the validation results of different BmNPV primer pairs for detecting different virus samples. In the figure, 1: virus particles in cell culture; 2: infected silkworm blood; 3: infected silkworm midgut; 4: ddH2O is a negative control;

[0019] Figure 2The results of the primer specificity verification of BmNPV are shown in the figure, where M is a nucleic acid marker; 1 is genomic DNA of Bombyx mori microspore; 2 is genomic DNA of BmNPV; 3 is genomic DNA of Bombyx mori dichotomous densovirus; 4 is cDNA of Bombyx mori epidemic malarial virus; 5 is cDNA of Bombyx mori cytoplasmic polyhedrosis virus;

[0020] Figure 3 is the standard curve of qNPVgp64-183;

[0021] Figure 4 This is a diagram showing the sensitivity validation results of qPCR detection of BmNPV genomic DNA. In the figure, 1-8: the results of ten-fold gradient dilution of BmNPV genomic DNA (200 ng / μL to 2 fg / μL); C: ddH2O is a negative control;

[0022] Figure 5 This is the sensitivity result of qPCR detection of standard plasmids. In the figure, 1-9: the standard plasmid was diluted tenfold (3.4×10 8 copies / μL~3.4×10 0 copies / μL); 10: standard plasmid 1.7 copies / μL; 11: standard plasmid 0.85 copies / μL; C: ddH2O is a negative control. DETAILED DESCRIPTION

[0023] The invention provides a primer pair for detecting Bombyx mori nuclear polyhedrosis virus. The primer pair is designed for the conservative gene GP64 of Bombyx mori nuclear polyhedrosis virus.

[0024] The GenBank address of the conserved gene GP64 of BmNPV described in the present invention is KX359332.1.

[0025] The primer pair of the present invention comprises an upstream primer qNPVgp64-183F having a nucleotide sequence as shown in SEQ ID No. 1 and a downstream primer qNPVgp64-183R having a nucleotide sequence as shown in SEQ ID No. 2, and also comprises a probe pNPVgp64-183 having a nucleotide sequence as shown in SEQ ID No. 3. The present invention labels a fluorescent group at the 5' end of the probe, and in one embodiment, the fluorescent group may be FAM; and labels a quenching group at the 3' end, and in one embodiment, the quenching group may be HBQ1.

[0026] qNPVgp64-183F:5'-TGACTGTGGGCAAAGAAGA-3';

[0027] qNPVgp64-183R:5'-GGTACGCAAAGTGATTGTTAT-3';

[0028] pNPVgp64-183: 5'-FAM-TATCAGGCAGCAGTGCGAGGTGGGC-HBQ1-3'.

[0029] The present invention also provides a kit for detecting Bombyx mori nuclear polyhedrosis virus, comprising the above primer pair and a reagent for qPCR amplification.

[0030] The reagent for qPCR amplification described in the present invention can be other reagents for qPCR, such as a reaction solution, which is a premixed solution for fluorescent quantitative PCR (probe method) using DNA or cDNA as a template, and its core components are: antibody-modified hot-start TaqDNA polymerase, dUTP / UDG anti-pollution components (which can effectively control the contamination of amplified products) and a special buffer (which can fully inhibit nonspecific amplification), which is purchased from Qingdao Lijian Biotechnology Co., Ltd. in the embodiment.

[0031] The present invention also provides the use of the primer pair or the kit in detecting Bombyx mori nuclear polyhedrosis virus.

[0032] In the examples of the present invention, various Bombyx mori viruses were used for verification, and it was found that the primers and probes of the present invention have strong specificity and high sensitivity, and can be used for the specific detection of Bombyx mori nuclear polyhedrosis virus.

[0033] The present invention also provides a method for detecting Bombyx mori nuclear polyhedrosis virus, comprising the following steps: extracting sample genomic DNA as a template, configuring a qPCR system with the above-mentioned primer pair or the primer pair and probe in the above-mentioned kit, and performing qPCR amplification; when the amplification result of the sample has a specific amplification curve and a Ct value ≤38, it is judged as positive; when the amplification result of the sample has no specific amplification curve or no Ct value, it is judged as negative; when the amplification result of the sample has a specific amplification curve and a Ct value of 38<Ct value ≤40, it is judged as a positive suspicious sample and needs to be re-tested.

[0034] The sample genomic DNA of the present invention can be taken from at least one of the following: diseased pupae, diseased silkworm larvae, diseased eggs and silkworm rearing environment. When collecting diseased pupae, diseased silkworm larvae and diseased eggs, grind them into a homogenate for genomic DNA extraction. For environmental samples, a cotton swab is directly placed in CTAB for shaking and washing, and then the cotton swab is removed for genomic DNA extraction. The present invention does not specifically limit the method for extracting the genomic DNA, such as using the CTAB method for extraction.

[0035] The qPCR system of the present invention is based on 10 μL, including: 0.1 μL of probe, 0.2 μL of upstream and downstream primers, 7.5 μL of reaction solution and 2 μL of template, wherein the concentrations of the probe and upstream and downstream primers are both 10 μM; the reaction procedure of the qPCR amplification includes: 37°C for 2 min; 95°C for 30 s; 95°C for 10 s, 60°C for 30 s to collect fluorescence, 40 cycles. In one embodiment of the present invention, under the FAM signal channel, when the amplification result of the sample has a specific amplification curve and the Ct value is ≤38, it can be judged as positive; when the amplification result of the sample has no specific amplification curve or no Ct value, it can be judged as negative; when the amplification result of the sample has a specific amplification curve and 38 < Ct value ≤40, it can be preliminarily judged as a positive suspicious sample; the preliminarily judged suspicious sample is re-examined, if the re-examination Ct value is ≤40, and a specific amplification curve appears, it is finally judged as positive; when the amplification result has no Ct value or no specific amplification curve, it is finally judged as negative.

[0036] To further illustrate the present invention, a primer pair, a kit and a detection method for detecting Bombyx mori nuclear polyhedrosis virus provided by the present invention are described in detail below in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0037] Example 1

[0038] 1. Primer design and screening

[0039] 1.1 Primer design and verification

[0040] The highly conserved gene GP64 of BmNPV was selected as the detection target, and primers were designed and synthesized using PrimerPrimer 5. The primer sequences were:

[0041] qNPVgp64-183F (SEQ ID No. 1): TGACTGTGGGCAAAGAAGA;

[0042] qNPVgp64-183R (SEQ ID No. 2):GGTACGCAAAGTGATTGTTAT;

[0043] qNPVgp64-180F (SEQ ID No. 4): CACCATCGTGGAGACGGACTA;

[0044] qNPVgp64-180R (SEQ ID No. 5): ACCTCGCACTGCTGCCTGA;

[0045] qNPVgp64-103F (SEQ ID No. 6): CAACGGAGGCTCGCTGGAT;

[0046] qNPVgp64-103R (SEQ ID No. 7): GCACTGCTGCCTGATACCC;

[0047] qNPVgp64-288F (SEQ ID No. 8): GGTGGACGAGCGTTTGATT;

[0048] qNPVgp64-288R (SEQ ID No. 9): CAACCGCTGGCATCTTTCC.

[0049] 1.2 Purification of BmNPV inclusion bodies

[0050] (1) The midgut of BmNPV-infected silkworms was collected and fully ground to obtain the inclusion body virus suspension to be isolated.

[0051] (2) Slowly add the pre-prepared 30% (m / v), 45% (m / v), and 60% (m / v) sucrose solutions into the centrifuge tube from high to low concentrations to avoid mixing of sucrose solutions of different concentrations.

[0052] (3) Slowly add the inclusion body virus suspension to be separated to the top layer of the gradient sucrose solution and centrifuge at 3500 rpm at 4°C for 25 min.

[0053] (4) The virus inclusion bodies in the 45% sucrose solution layer were aspirated, washed with phosphate buffered saline (PBS), and centrifuged at 10,000 rpm for 10 min. This process was repeated three times.

[0054] (5) Dissolve the separated inclusion body viruses in an appropriate amount of phosphate buffer, count the number of BmNPV inclusion body viruses, and store them in a refrigerator at 4°C for future use.

[0055] 1.3 Extraction of BmNPV genomic DNA

[0056] (1) Take 1×10 6 The virus was placed in a 1.5 mL centrifuge tube, 600 μL of 2% CTAB and 25 μL of proteinase K were added, mixed and incubated at 56°C for 1 h.

[0057] (2) After the incubation, centrifuge at 12000 rpm for 3 min, transfer the supernatant to a nucleic acid purification column, centrifuge at 12000 rpm for 2 min, and discard the liquid in the collection tube;

[0058] (3) Add 700 μL of 75% alcohol, centrifuge at 12,000 rpm for 2 min, discard the liquid in the collection tube, and repeat once; after discarding the liquid in the collection tube, do not add any liquid to the nucleic acid purification column, and centrifuge directly at 12,000 rpm for 2 min.

[0059] (4) Place the purification column in a new 1.5 mL centrifuge tube, add 30 μL of enzyme-free water to the purification column, and elute the genomic DNA into the 1.5 mL centrifuge tube to complete the genomic DNA extraction.

[0060] 1.4 Extraction of viral genomic DNA from midgut abrasives, blood, and cell cultures infected with BmNPV

[0061] (1) Take 200 μL of midgut grinding fluid, blood and cell cultured virus particles for genomic DNA extraction, add 600 μL of 2% CTAB and 25 μL of proteinase K, mix well, and incubate at 56°C for 1 hour. The subsequent steps are the same as the BmNPV genomic DNA extraction steps.

[0062] (2) PCR amplification was performed using BmNPV midgut grinding fluid, blood, and cell culture viral particle genomic DNA as templates and ddH2O as a negative control to verify the applicability of the primers.

[0063] The reaction system is: 25 μL, mainly including: 12.5 μL 2×MightyAmp BufferVer.3 (Mg 2+ ,dNTPplus), 2.5μL 10×high specificity buffer, 0.5μL TaKaRa DNA polymerase (TaKaRa-bio, Japan), 1 μL each of upstream and downstream primers, 1 μL genomic DNA template, and 6.5 μL ddH2O;

[0064] The reaction program was as follows: pre-denaturation at 98°C for 2 min; denaturation at 98°C for 10 s, annealing at 56°C for 15 s, extension at 68°C for 20 s, 30 cycles; and extension at 68°C for 3 min.

[0065] The results are as follows Figure 1 As shown in the figure, qNPVgp64-183 can specifically amplify the virus signals in different samples infected with BmNPV (including virus particles in cell culture, blood of infected silkworms, and midgut of infected silkworms), and the negative control did not show primer dimer phenomenon. In contrast, although qNPVgp64-180, qNPVgp64-103 and qNPVgp64-288 can amplify the target band, they are accompanied by the formation of primer dimers, so they are not suitable as detection primer pairs. Comprehensive analysis shows that qNPVgp64-183 is suitable for detecting different samples infected with silkworms.

[0066] 1.5 Primer specificity verification

[0067] (1) The extraction method of genomic DNA from Bombyx mori Prospermum nigroviridae and Bombyx mori dichotomous densovirus is the same as that of BmNPV.

[0068] (2) Obtaining cDNA of Bombyx mori Cytoplasmic Polyhedrosis Virus and Bombyx mori Epidemic Malaise Virus

[0069] Take 200 μL of virus suspension, extract RNA using Trizol method, and convert it into cDNA according to conventional methods.

[0070] Using the primers designed and verified in 1.1, PCR amplification was performed with the genomic DNA of BmNPV, Bombyx mori microspore, Bombyx mori dichotomous densovirus, and the cDNA of Bombyx mori cytoplasmic polyhedrosis virus and Bombyx mori epidemic malarial virus as templates. The amplification system and amplification procedure were the same as in 1.4, and primer specificity verification experiments were carried out.

[0071] The results are as follows Figure 2 As shown, qNPVgp64-183 can only amplify BmNPV, but cannot amplify other pathogens of silkworm, indicating that qNPVgp64-183 has strong specificity and can be used for BmNPV specific detection.

[0072] 2. Probe design and verification

[0073] According to the sequence amplified by primer qNPVgp64-183, the probe was designed and synthesized using PrimerPremier 5 software. The probe sequence is:

[0074] pNPVgp64-183: FAM-5'-TATCAGGCAGCAGTGCGAGGTGGGC-3'-HBQ1.

[0075] 2.1 Standard plasmid preparation

[0076] (1) Select qNPVgp64-183 as primer, use the BmNPV genomic DNA mentioned in 1.3 as template, and perform PCR amplification according to the same amplification procedure and amplification system as 1.5;

[0077] (2) Detect the PCR amplification product by nucleic acid gel and recover a single DNA fragment at 183 bp;

[0078] (3) The recovered DNA was connected to the pMD19-T vector, transformed into DH5α competent cells, and then spread on LB solid culture plates containing Amp resistance and cultured inverted at 37°C overnight;

[0079] (4) Pick 8 single colonies and inoculate them into 300 μL LB liquid medium containing Amp resistance;

[0080] (5) After 4 h of culture, perform electrophoresis on the bacterial solution;

[0081] (6) Select the bacterial solution in which the DNA fragment is successfully connected to pMD19-T, perform DNA sequencing, and submit the sequencing results to the NCBI website for comparison;

[0082] (7) The corresponding bacterial solution of the successfully linked qNPVgp64-183 amplification product was cultured in 5 mL of LB liquid culture medium containing Amp at 37°C and 180 rpm for 12 to 16 h.

[0083] 2.2 Standard plasmid extraction

[0084] (1) Take 5.0 mL of bacterial solution and centrifuge at 12000 rpm for 1 min at room temperature to collect bacteria.

[0085] (2) Add 250 μL of Solution I / RNase A mixture and vortex to completely suspend the cells.

[0086] (3) Add 250 μL of Solution II to the resuspended mixture and gently invert 4 to 6 times to mix.

[0087] (4) Add 350 μL Solution III, gently invert several times until a white flocculent precipitate is formed, and centrifuge at 13,000 rpm for 10 min at room temperature.

[0088] (5) Transfer the supernatant to a 2 mL collection tube. Miniprep DNA binding column, centrifuge at 13000 rpm for 1 min, and discard the flow-through.

[0089] (6) Add 500 μL HBC buffer to the binding column, centrifuge at 13,000 rpm for 1 min, and discard the flow-through.

[0090] (7) Add 700 μL DNA Wash Buffer to the binding column, centrifuge at 13,000 rpm for 1 min, discard the flow-through, and spin dry the liquid in the binding column at 13,000 rpm for 2 min.

[0091] (8) Place the binding column in a sterile 1.5 mL centrifuge tube and add 50 μL of Eliution Buffer onto the binding column filter membrane.

[0092] (9) Let stand for 1 min, centrifuge at 13000 rpm for 1 min, and the liquid in the 1.5 mL centrifuge tube is the required standard plasmid. The copy number is 3.4 × 10 9 copies / μL, stored at -20℃.

[0093] 2.3 Establishment of qPCR standard curve

[0094] (1) The standard plasmid was increased from 3.4×10 7 ~3.4×10 2 The plasmids were diluted tenfold and used as templates for qPCR detection.

[0095] qPCR system: 0.1 μL of probe, 0.2 μL of upstream and downstream primers (10 μM), 7.5 μL of reaction solution and 2 μL of template.

[0096] Reaction procedure: 37°C for 2 min; 95°C for 30 s; 95°C for 10 s, fluorescence collection at 60°C for 30 s, 40 cycles.

[0097] Result analysis: Under the FAM signal channel, the amplification result of the sample has a specific amplification curve, and when the Ct value is ≤38, it can be judged as positive;

[0098] When the amplification result of the sample has no specific amplification curve or Ct value, it can be judged as negative;

[0099] When the amplification result of the sample has a specific amplification curve and the Ct value is 38<Ct value≤40, it can be preliminarily determined as a positive suspected sample;

[0100] The samples initially judged suspicious were retested. If the Ct value of the retest was ≤40 and a specific amplification curve appeared, it was finally judged as positive. If the amplification result had no Ct value or no specific amplification curve, it was finally judged as negative.

[0101] like Figure 3 As shown, the qNPVgp64-183 standard curve R 2 =-0.993, slope =-2.85.

[0102] 2.4 qPCR sensitivity verification

[0103] The BmNPV genomic DNA was diluted tenfold (200 ng / μL to 2 fg / μL), and the standard plasmid was diluted tenfold (3.4×10 8 copies / μL~3.4×10 0 3.4 copies / μL was then diluted 2-fold to obtain 1.7 copies / μL and 0.85 copies / μL, and qPCR amplification was performed using genomic DNA and standard plasmid as templates, qNPVgp64-183 as primers, and pNPVgp64-183 as probe. The amplification system and procedure were the same as in 2.3.

[0104] The results are as follows Figure 4 and Figure 5As shown, when BmNPV genomic DNA was diluted to 2 fg / μL, it could still be detected, and when the standard plasmid was diluted to 0.85 copies / μL, it could still be detected, indicating that the primers and probes had high sensitivity.

[0105] 3. qPCR detection of diseased silkworms and environmental samples

[0106] Diseased pupae, diseased silkworm larvae, diseased eggs, and silkworm rearing environment samples (swab samples with sterile cotton swabs) were collected for BmNPV detection. The midguts of diseased pupae and diseased silkworms were ground into a homogenate and 200 μL was taken for genomic DNA extraction. The environmental samples were directly placed in 600 μL 2% CTAB for shaking and washing, and then the cotton swabs were removed for genomic DNA extraction. The extraction method was the same as described in 1.3. The extracted genomic DNA was used as a template for qPCR detection, and the reaction system and procedure were the same as in 2.3.

[0107] The results are shown in Table 1. qPCR was able to successfully detect diseased pupae, diseased silkworm larvae, and diseased eggs, and this method can also be applied to the detection of BmNPV in environmental samples, providing a reliable basis for the early diagnosis of BmNPV in silkworm breeding and the precise disinfection of the silkworm breeding environment.

[0108] Table 1 qPCR detection of diseased pupae, diseased silkworms, diseased eggs and silkworm rearing environment

[0109]

[0110] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A primer pair for detecting Bombyx mori nuclear polyhedrosis virus, characterized in that: The primer pair is designed for the conservative gene GP64 of Bombyx mori nuclear polyhedrosis virus.

2. The primer pair according to claim 1, characterized in that: The primer comprises an upstream primer qNPVgp64-183F having a nucleotide sequence as shown in SEQ ID No.1 and a downstream primer qNPVgp64-183R having a nucleotide sequence as shown in SEQ ID No.

2.

3. The primer pair according to claim 1 or 2, characterized in that: Also included is a probe whose nucleotide sequence is shown as SEQ ID No.

3.

4. The primer pair according to claim 3, characterized in that: The probe is labeled with a fluorescent group at the 5' end and a quencher group at the 3' end.

5. A kit for detecting Bombyx mori nuclear polyhedrosis virus, characterized in that: The method comprises the primer pairs according to claims 1 to 4 and reagents for qPCR amplification.

6. Use of the primer pair according to any one of claims 1 to 4 or the kit according to claim 5 in detecting Bombyx mori nuclear polyhedrosis virus.

7. A method for detecting Bombyx mori nuclear polyhedrosis virus, characterized in that: The following steps are involved: Extract the sample genomic DNA as a template, configure a qPCR system with the primer pair described in any one of claims 1 to 4 or the primer pair and probe in the kit described in claim 5, and perform qPCR amplification. When the amplification result of the sample has a specific amplification curve and the Ct value is ≤38, it is judged as positive; when the amplification result of the sample has no specific amplification curve or no Ct value, it is judged as negative; when the amplification result of the sample has a specific amplification curve and the Ct value is 38<Ct value≤40, it is judged as a positive suspected sample and needs to be re-tested.

8. The method according to claim 7, characterized in that: The sample genomic DNA is taken from at least one of the following: diseased pupae, diseased silkworm larvae, diseased eggs and silkworm rearing environment.

9. The method according to claim 7, characterized in that: The qPCR system, based on 10 μL, includes: 0.1 μL of probe, 0.2 μL of upstream and downstream primers, 7.5 μL of reaction solution and 2 μL of template.

10. The method according to claim 7 or 9, characterized in that: The reaction procedure of the qPCR amplification includes: 37°C for 2 min; 95°C for 30 s; 95°C for 10 s, 60°C for 30 s to collect fluorescence, and 40 cycles.

Images