A non-denaturing mass spectrometry method for determining interactions between aptamers and small molecule targets

Abstract

The application discloses a non-denaturing mass spectrometry detection method for determining interaction between aptamer and small molecule target, comprising a spray needle coated with conductive coating; preparation of aptamer and target molecule stock solution; first mass spectrometry analysis of mixed solution, obtaining combination ratio of both; analysis on stability of complex ion in tandem mass spectrometry mode; in the detection method, on one hand, a nano-sized electrospray emission spray needle is used, for sample solution containing high concentration of non-volatile salt, which significantly reduces adduct and ion cluster of complex formation, improves resolution and signal-to-noise ratio, and is simple in operation and small in sample consumption; on the other hand, through non-denaturing mass spectrometry detection, stoichiometric relationship of combination and stability change of aptamer before and after combination can be directly obtained; the method can quickly and accurately identify interaction between nucleic acid aptamer and target molecule, and is expected to be further applied to rapid screening and sequence optimization of nucleic acid aptamer.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological analysis detection, in particular to a non-denaturing mass spectrometry detection method for determining the interaction between aptamer and small molecule target. BACKGROUND

[0002] As an artificially screened oligonucleotide sequence, aptamer has high affinity and good selectivity to target molecules, and has wide application in cell imaging, drug delivery, disease treatment and microorganism detection. At present, the research methods for the interaction between nucleic acid aptamer and small molecule target include fluorescence polarization / anisotropy, surface plasmon resonance, micro heat convection, etc., but these methods need sample labeling or surface immobilization, which may affect the spatial structure of aptamer and further change the binding process of aptamer and small molecule target. Although isothermal titration calorimetry does not need sample labeling, it needs large amount of sample; nuclear magnetic resonance method needs milligram level of sample amount and the process of data analysis is complex, and x-ray crystallography can provide atomic resolution structure data, but the sample needs to have certain crystal structure, which limits the wide application of this method in the field of research on the interaction between aptamer and small molecule target.

[0003] As a rapid and sensitive analysis method, non-denaturing mass spectrometry develops rapidly in the fields of characterizing non-covalent biomolecular interaction and researching high-order structure of biomolecular complex, and has the following advantages in rapid evaluation of the interaction between aptamer and small molecule target: small sample volume (10-100 μL), low sample concentration (as low as μM), no need for chemical labeling of sample, and completion of sample measurement in a short time (5-10 s); and non-denaturing mass spectrometry can introduce aptamer and its complex into gas phase for mass spectrometry analysis through electrospray ionization under near physiological conditions, so as to retain the structure and functional characteristics, and more accurately and completely characterize the interaction between aptamer and small molecule target.

[0004] Due to the multi-anion property of nucleic acid, relatively high concentration of monovalent and divalent cations is needed in the solution to effectively inhibit the electrostatic repulsion between backbone phosphate groups, so as to allow the folding into three-dimensional conformation, thereby specifically recognizing and combining small molecule target. Aptamer sample usually has high concentration of non-volatile salt to maintain the spatial structure of nucleic acid aptamer, but it reduces the sensitivity and signal-to-noise ratio of mass spectrometry detection, so that the non-covalent complex is difficult to distinguish. The mass spectrometry device used in the present application uses a spray needle with a narrow tip diameter in the electrospray ion source, which significantly reduces the addition of salt ions to the complex of aptamer and small molecule target, and can effectively improve the signal-to-noise ratio. SUMMARY

[0005] The present application aims to provide a non-denaturing mass spectrometry detection method for determining the interaction between aptamer and small molecule target, so as to solve the problems in the background art. By using a spray needle with a small inner diameter, the interaction between aptamer and small molecule target is studied in a non-denaturing state, the charge state distribution of the aptamer and the aptamer-small molecule target complex formed by a high salt concentration buffer is distinguished, and the binding stoichiometry of the aptamer and the small molecule target is obtained; the stability of the non-covalent complex ion is studied by using a high-energy collision dissociation mode of a tandem mass spectrometer. The device and the detection method can significantly reduce the degree of internal combination of salt and non-volatile molecules on the aptamer complex ion, reduce the formation of salt adducts and salt clusters, reduce the sample usage, speed up the signal acquisition, and the result is accurate.

[0006] To achieve the above-mentioned purpose, the present application provides the following technical solutions:

[0007] The present application provides a non-denaturing mass spectrometry detection method for determining the interaction between aptamer and small molecule target, comprising the following steps:

[0008] (1) preparing an aptamer aqueous solution, a small molecule target stock solution, and an ammonium acetate buffer;

[0009] Preparation of the aptamer aqueous solution: dissolve the aptamer in water, vortex oscillate, centrifuge, and determine the concentration of the aptamer aqueous solution by using a micro UV spectrophotometer to obtain the stock solution of the aptamer, which is stored at -20℃.

[0010] Preparation of the small molecule target stock solution: dissolve the small molecule target in deionized water, vortex oscillate to obtain the small molecule target stock solution, and store it at 4℃.

[0011] Preparation of the buffer: dissolve ammonium acetate in deionized water, and adjust the pH of the solution to 6.8-7.4 by using 25% ammonia water to obtain the ammonium acetate buffer;

[0012] (2) add the small molecule target stock solution and the aptamer stock solution to the ammonium acetate buffer and mix uniformly, stand for incubation for 30 min to obtain a complex; perform primary mass spectrometry analysis on the combined sample by using a spray needle to obtain the primary spectrum of the interaction between the aptamer and the target molecule, and calculate the binding stoichiometry ratio of the two according to the charge number and m / z value of the signal peak;

[0013] (3) using tandem mass spectrometry mode, using high-energy collision dissociation technology to analyze the stability of the complex ion: the complex ion formed by the binding of the aptamer and the target molecule in a 1:2 stoichiometric ratio as the parent ion, using the high-energy collision dissociation technology of mass spectrometry to apply a series of energy values E to the parent ion, and recording the change of the relative signal intensity of the parent ion and fragment ion with the energy value in the process; in this, a parameter IRa is introduced, which is defined as the ratio of the complex ion formed by the aptamer and the target molecule to the total amount of all complexed and free aptamers, as shown in formula (1); the corresponding IRa value is obtained at a certain fragmentation energy value, and the obtained data is subjected to Boltzmann nonlinear fitting, as shown in formula (2), to obtain the dissociation curve of the complex, and then obtain the fragmentation energy (E 1 / 2 ) corresponding to the half decrease of IRa value, for judging the stability of the complex ion, the greater the E 1 / 2 value, the stronger the stability of the complex ion.

[0014]

[0015] m = 1-4; x = 5-8

[0016] wherein, ∑Ir[Apt+mL] x- represents the sum of the relative abundance of aptamer-target complex ions, ∑Ir[Apt] x- represents the sum of the relative abundance of free aptamer ions; m represents the number of target molecules bound by the aptamer, and x represents the number of charges carried by the aptamer and the complex ion peak.

[0017] IRa = A1 + A2 / (1 + exp((E-E 1 / 2 ) / A3)) (2);

[0018] wherein, A1, A2, A3 are all constants.

[0019] Further, in step (2), the spray needle used is a borosilicate glass emitter spray needle (BG12-69-2-CE-5, ThermoFisher Scientific) matched with a nanoelectrospray ionization source, with a length of 2 cm; an outer diameter of 1.2 mm, an inner diameter of 0.94 mm, and a needle tip inner diameter of 2 μm.

[0020] Further, in step (1), the selected aptamer is named ABA, and the nucleotide sequence of the ABA is shown in SEQ ID No: 1, and in step (2), the concentration of the aptamer in the complex is 8-15 μmol / L.

[0021] SEQ ID No: 1: ACCTGGGGGAGTATTGCGGAGGAAGGT.

[0022] Further, in step (1), the small molecule target is adenosine; in step (2), the final concentration of the small molecule target in the complex is 80-150 μmol / L.

[0023] Further, in step (1), the pH of the ammonium acetate buffer is 6.8-7.4, and the concentration of the ammonium acetate buffer in the complex is 10-100 mmol / L.

[0024] Further, in step (2), the concentration ratio of the aptamer to the target molecule in the complex is 1:10.

[0025] Further, in step (2), the primary mass spectrometry analysis conditions are: ion source: electrospray ion source; scanning in negative ion mode, electrospray voltage: -1500 V; ion transmission tube temperature: 300℃; primary mass spectrometry resolution: 120000; ion optical radio frequency voltage (RF value): 80%; primary maximum injection time: 100 ms; Normalized AGC Target: 100%.

[0026] Further, in step (3), the tandem mass spectrometry analysis conditions are: secondary mass spectrometry resolution: 120000; secondary maximum injection time: 100 ms; Normalized AGC Target: 100%; ion optical radio frequency voltage RF value: 80%; MS 2 Dissociation mode: high-energy collision-induced dissociation, collision energy: 0%-6%.

[0027] Compared with the prior art, the present application has the following beneficial effects:

[0028] The non-denaturing mass spectrometry detection method for determining the interaction between an aptamer and a small molecule target of the present application overcomes the problems of time-consuming, labor-intensive, large sample consumption and the like existing in other detection methods. Compared with a conventional electrospray ion source, the narrow-tip-diameter spray needle in the method not only effectively overcomes the problems of low signal resolution of low-abundance complexes, serious salt ion adduction effect leading to wide spectral peaks and the like existing in previous nucleic acid mass spectrometry analysis, but also has a sample injection flow rate of only 20-80 nL / min, low sample consumption, improved signal intensity and stable signal. Figure 4 is a spectrum of primary mass spectrometry analysis of the complex of the aptamer ABA and the target adenosine in Example 1 when the narrow-tip-diameter spray needle mentioned in the method is not used, the signal resolution is low, the detectable charge range is reduced, the strong salt ion adduction effect leads to wide spectral peaks, and the signal-to-noise ratio is reduced. On the other hand, the non-denaturing mass spectrometry method retains the structure and functional properties of the aptamer and its complex to a greater extent. The present application can also be used for the study of the interaction between other aptamers and small molecule targets, and can be further applied to the study of the interaction between different hosts and guests. BRIEF DESCRIPTION OF DRAWINGS

[0029] Figure 1 Figure 1 shows the first mass spectrum of the mixture solution of aptamer ABA and small molecule target adenosine in Example 1.

[0030] Figure 2 Figure 2 shows the Boltzmann fitting plot of IRa value and HCD energy of 7-charge 1:1 complex ion of the original sequence ABA and small molecule target adenosine in Example 2.

[0031] Figure 3 Figure 3 shows the Boltzmann fitting plot of IRa value and HCD energy of 7-charge 1:1 complex ion of the optimized sequence and small molecule target adenosine in Example 2.

[0032] Figure 4 Figure 4 shows the first mass spectrum of the mixture solution of aptamer ABA and small molecule target adenosine without using spray needle in Example 3.

[0033] Figure 5 Figure 5 shows the first mass spectrum of the mixture solution of aptamer ABA and small molecule target adenosine under high concentration buffer (100 mmol / L) in Example 4. DETAILED DESCRIPTION

[0034] The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative work fall within the scope of protection of the present application.

[0035] Example 1

[0036] The adenosine stock solution (concentration of 2.0 mmol / L) and the aptamer ABA stock solution (concentration of 1321 μmol / L) were mixed in 20 mmol / L NH4OAc buffer with pH of 7.4 at a concentration ratio of 10:1, and the final concentration of adenosine in the sample was 100 μmol / L, and the final concentration of aptamer was 10 μmol / L. The mixture solution was fully vortexed, and incubated at room temperature for 30 min to ensure equilibrium, to obtain the complex. The complex was subjected to first mass spectrum analysis, and the experimental conditions were as follows: negative ion scanning mode was used, the electrospray voltage was -1500 V; the ion transmission tube temperature was 300 °C; the first mass spectrum resolution was 120000; the ion optical radio frequency voltage (RF value) was 80%; the first maximum injection time was 100 ms; and the Normalized AGC Target was 100%.

[0037] The nucleotide sequence of ABA is shown in SEQ ID No: 1, SEQ ID No: 1: ACCTGGGGGAGTATTGCGGAGGAAGGT.

[0038] (2) Data processing: three repeated experiments were performed according to the above-mentioned example, the original mass spectrum data was collected using Xcalibur software, and data processing was performed using Origin 2024, and the results are shown in Figure 1 : Within the mass spectrum scanning range (m / z = 1000-2000), ion peaks with charge distribution of 8-~5- (m / z 1059.68, 1211.06, 1413.07, 1695.49, respectively) were detected for the aptamer, among which the ion peak of ABA with charge 6- was the base peak; the binding stoichiometry ratio of the aptamer and adenosine was mainly 1:1, with charge distribution of 8-~5- (m / z 1093.06, 1249.21, 1457.59, 1748.90, respectively), and the relative abundances were 2.12%, 6.23%, 26.97%, and 8.85%, respectively; there were also complex ion peaks with charge distribution of 7-~5- (m / z 1287.37, 1502.10, 1802.32, respectively) with binding stoichiometry ratio of 1:2, and the relative abundances were 4.17%, 21.33%, and 4.93%, respectively.

[0039] Example 2

[0040] (1) The sample is the complex of the aptamer ABA and the small molecule target adenosine in Example 1. The stability of the complex ion was analyzed using tandem mass spectrometry mode: the 1:1 complex ion with 7 charges (m / z = 1249.21) was used as the parent ion, the dissociation mode was high-energy collision-induced dissociation, and the energy value was gradually increased from 0 until the relative signal intensity of the parent ion was less than 10%. In order to compare and illustrate the stability of the complex ion, an aptamer with optimized structure (SEQ ID No: 2: ACCTGGGGGAGTGATTCGCGGAGGAAGGT) was used as a control, and its complex ion with adenosine molecule was analyzed according to the same research method: the parent ion was still the 1:1 complex ion with 7 charges (m / z = 1343.05). The specific conditions are: secondary mass spectrometry resolution: 120000; secondary maximum injection time: 100ms; ion optical radio frequency voltage (RF value): 80%; Normalized AGC Target: 100%.

[0041] (2) Data processing: The mass spectrum at each energy value was scanned three times, and the signal intensity of the parent ion and fragment ion was extracted using Xcalibur software for data acquisition and processing, and the IRa value of the complex ion was calculated. The IRa values obtained from 3 parallel experiments were averaged as the final result, and a series of IRa values of the binding peaks at different energy values were obtained. The data was imported into Origin 2024 for Boltzmann nonlinear fitting to obtain the dissociation curve of the complex, and the E 1 / 2 values of the complex ions of the original sequence and the structure-optimized sequence and the small molecule target adenosine were obtained from the fitting results, respectively, and the fitting results are shown in Figure 2 , 3 . The results show that the E 1 / 2 value of the complex ion of the original sequence ABA and adenosine is 1.31%, and the E 1 / 2 value of the complex ion of the structure-optimized sequence and adenosine is 1.84%, which shows that the complex formed by the aptamer sequence with the structure optimization strategy and adenosine is more stable, and the result is consistent with the result obtained by the researchers through affinity capillary electrophoresis.

[0042] Example 3

[0043] Description: This example can be used as a comparative example without using the narrow tip diameter spray needle mentioned in the method.

[0044] (1) The sample is the complex of the aptamer ABA and the small molecule target adenosine in Example 1. The complex was analyzed by primary mass spectrometry using a common ESI sampling needle (model OPTON-30694), and other experimental conditions were consistent with those in Example 1.

[0045] (2) Data processing: Three repeated experiments were performed according to the above example, and the original mass spectrum data was collected using Xcalibur software, and the data was processed using Origin 2024, and the results are shown in Figure 4The results show that in the mass spectrometry scanning range (m / z = 1000-2000), the ion peaks with charge distribution of 7-~5- (m / z are 1211.06, 1413.07, and 1695.89, respectively) are detected for the presence of the aptamer, in which the ion peak of ABA with charge 6- is the base peak; the binding stoichiometry ratio of the aptamer and adenosine is mainly 1:1, the charge distribution is 7-~5- (m / z are 1249.21, 1457.75, and 1749.31, respectively), and the relative abundances are 3.54%, 25.62%, and 21.03%, respectively; and the complex ion peaks with charge distribution of 6- and 5- and binding stoichiometry ratio of 1:2 (m / z are 1508.43 and 1810.52, respectively) are also present, and the relative abundances are 20.41% and 19.42%, respectively. According to the experimental spectrum, it can be seen that, as a comparative example, when the narrow-tip-diameter spray needle is not used, the signal resolution is low, the signal intensity is reduced, the detectable charge range is reduced, and the relatively strong salt ion adduct effect leads to a wide spectral peak, and the signal-to-noise ratio is reduced.

[0046] Example 4

[0047] Description: This example is a comparative example for supplementing the important parameters of this experiment, namely the buffer concentration. One of the advantages of the nanoscale electrospray emission spray needle in this patent is that even in a high-concentration non-volatile salt sample solution, the adducts and ion clusters of complex formation can be reduced, so that the spectrum with complete binding information and stable signal can be obtained.

[0048] (1) The sample is the complex of the aptamer ABA and the small molecule target adenosine in Example 1, in which the buffer is 100 mmol / L NH4OAc solution with pH 7.4. Other experimental conditions are consistent with those in Example 1.

[0049] (2) Data processing: three repeated experiments were performed according to the above example, the original mass spectrometry data was collected using Xcalibur software, and data processing was performed using Origin 2024, and the results are as follows Figure 5As shown: in the mass spectrum scanning range (m / z = 1000-2000), the ion peaks with charge distribution of 8-~5- (m / z are 1059.55, 1211.06, 1413.07, 1696.08, respectively) of the aptamer were detected, wherein the ion peak of ABA with charge 7- was the base peak; the aptamer formed a complex ion with adenosine with a binding stoichiometry of 1:1, with charge distribution of 8-~5- (m / z are 1093.18, 1249.21, 1457.58, 1749.30, respectively), and the relative abundances were 6.86%, 27.66%, 54.83%, and 8.47%, respectively; at the same time, there were complex ion peaks with charge distribution of 8-~5- with a binding stoichiometry of 1:2 (m / z are 1126.32, 1287.51, 1508.59, 1810.51, respectively), and the relative abundances were 7.80%, 30.12%, 75.42%, and 9.55%, respectively.

[0050] It should be noted that the relational terms herein such as first and second and the like are used solely to distinguish one entity or action from another, without necessarily requiring or implying any such actual relationship or order between such entities or actions. Moreover, the terms "comprises", "comprising", or any other variations thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but can include other elements not expressly listed or inherent to such process, method, article, or apparatus.

[0051] It should be noted that the above only illustrates the technical idea of the present application, and cannot limit the protection scope of the present application. For those skilled in the art, without departing from the principle of the present application, a number of improvements and refinements can be made, which fall within the protection scope of the claims of the present application.

Claims

1. A non-denaturing mass spectrometry method for determining the interaction between an aptamer and a small molecule target, characterized in that, The method comprises the following steps: (1) preparing an aptamer aqueous solution, a small molecule target stock solution, and an ammonium acetate buffer solution; (2) mixing the small molecule target stock solution and the aptamer aqueous solution in the ammonium acetate buffer solution, uniformly mixing, and standing for incubation for 30 min to obtain a complex; performing first-order mass spectrometry analysis on the combined sample by using a spray needle to obtain a first-order spectrum of the interaction between the aptamer and the target molecule, and calculating the binding stoichiometry ratio of the two according to the charge number and m / z value of the signal peak; (3) using tandem mass spectrometry mode, with the complex ion formed by the aptamer and the target molecule in a binding stoichiometric ratio of 1:2 as the parent ion, using the high-energy collision dissociation technology of mass spectrometry to apply a series of energy values (E) to the parent ion, and recording the changes in the relative signal intensity of the parent ion and fragment ion during this process; a parameter IRa is introduced here, which is defined as the ratio of the complex ion formed by the aptamer and the target molecule to the total amount of all complexed and free aptamers, as shown in equation (1); the corresponding IRa value is obtained at a specific fragmentation energy value, and the obtained data set is subjected to Boltzmann nonlinear fitting, as shown in equation (2), to obtain the dissociation curve of the complex, and then obtain the fragmentation energy (E 1 / 2 ) corresponding to the IRa value when the IRa value drops to half; m = 1-4; x = 5-8 where, ∑Ir[Apt+mL] x- represents the sum of relative abundances of aptamer-target complex ions, ∑Ir[Apt] x- represents the sum of relative abundances of free aptamer ions; m represents the number of target molecules bound by the aptamer, and x represents the number of charges borne by the aptamer and complex ion peaks; IRa = A1 + A2 / (1 + exp((E - E 1 / 2 ) / A3)) (2); wherein, A1, A2, A3 are all constants; In step (2), the spray needle used is a borosilicate glass emitter needle of a nanoelectrospray ionization source, with a length of 2 cm; an outer diameter of 1.2 mm, an inner diameter of 0.94 mm, and a needle tip inner diameter of 2 μm.

2. The non-denaturing mass spectrometry method for determining the interaction between an aptamer and a small molecule target according to claim 1, characterized in that, In step (1), the selected aptamer is ABA, and the nucleotide sequence of the ABA is SEQ ID No: 1 ACCTGGGGGAGTATTGCGGAGGAAGG. In step (2), the concentration of the aptamer in the complex is 8-15 3. The method of claim 1, wherein the method is characterized by, μmol / L.

4. The non-denaturing mass spectrometry method for determining the interaction between aptamer and small molecule target according to claim 1, characterized in that, In step (1), the small molecule target is adenosine; in step (2), the final concentration of the small molecule target in the complex is 80-150 μmol / L.

5. The method of claim 1, wherein the method is a non-denaturing mass spectrometry method for determining the interaction between an aptamer and a small molecule target. In step (2), the pH of the ammonium acetate buffer solution is 6.8-7.4, and the concentration of the ammonium acetate buffer solution in the complex is 10-100 mmol / L.

6. The non-denaturing mass spectrometry method for determining the interaction between aptamer and small molecule target according to claim 1, characterized in that, In step (2), in the complex, the concentration ratio of the aptamer to the target molecule is 1:

10. In step (2), the first-order mass spectrometry analysis conditions are as follows: ion source: electrospray ion source; scanning in negative ion mode, electrospray voltage: -1500 V; ion transmission tube temperature: 300℃; first-order mass spectrometry resolution: 120000; ion optical radio frequency voltage (RF value): 80%; first-order maximum injection time: 100 ms; Normalized AGC Target: 100%.

7. The method of claim 1, wherein the method is a non-denaturing mass spectrometry method for determining the interaction between an aptamer and a small molecule target. In step (3), the tandem mass spectrometry analysis conditions are: secondary mass spectrometry resolution: 120000; secondary maximum injection time: 100 ms; Normalized AGC Target: 100%; ion optical radio frequency voltage RF value: 80%; MS 2 Dissociation mode: high-energy collision-induced dissociation, collision energy: 0%~6%.

Images