A chemotherapy resistance marker RAD51AP1 for diagnosing ovarian cancer resistance or evaluating prognosis in the treatment of ovarian cancer with platinum drugs and its application
By detecting the expression level of RAD51AP1 in ovarian cancer patients and using RAD51AP1 as a chemotherapy resistance marker, the problems of diagnosis and prognosis evaluation of chemotherapy resistance in ovarian cancer were solved, and personalized treatment plans were adjusted and chemotherapy effects were improved.
Patent Information
- Application Number
- CN202510204169.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-24
- Publication Date
- 2025-09-09
- Estimated Expiration
- 2045-02-24
AI Technical Summary
In the existing technology, chemotherapy resistance of ovarian cancer is a major problem in the treatment of ovarian cancer. The lack of effective diagnostic and prognostic assessment methods makes it difficult to implement personalized treatment plans for patients.
RAD51AP1 protein or its encoding gene is used as a chemotherapy resistance marker. The drug resistance of ovarian cancer is diagnosed by detecting its expression level. The chemotherapy effect is improved by inhibiting RAD51AP1 expression and combined with cisplatin treatment to enhance the efficacy.
High expression of RAD51AP1 is closely related to chemotherapy resistance in ovarian cancer. Inhibiting RAD51AP1 can enhance the efficacy of cisplatin and significantly inhibit tumor growth, providing a new diagnostic tool and treatment strategy.
Smart Images

Figure CN119804866B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biomedicine technology, and in particular to a chemotherapy resistance marker RAD51AP1 for diagnosing ovarian cancer resistance or evaluating prognosis in the treatment of ovarian cancer with platinum drugs, and applications thereof. Background Art
[0002] Ovarian cancer is one of the common malignant tumors in my country. As one of the top three gynecological malignant tumors in terms of incidence and mortality, ovarian cancer brings a huge medical burden to patients.
[0003] Currently, ovarian cancer treatments primarily include surgery and standardized chemoradiotherapy. Platinum-based drugs are the standard chemotherapy for ovarian cancer. Approximately two-thirds of patients may develop resistance to platinum-based chemotherapy after receiving standard chemotherapy, making chemotherapy resistance a significant challenge in ovarian cancer treatment.
[0004] In this regard, the inventors believe that it is necessary to screen and identify markers that may become chemotherapy-resistant in ovarian cancer, so as to better predict the response of ovarian cancer patients to platinum-based drug treatment and evaluate the prognosis of patients treated with platinum-based drugs, thereby achieving the adjustment of personalized treatment plans for patients.
[0005] The information disclosed in this background technology section is only intended to enhance understanding of the overall background of the invention and should not be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art. Summary of the Invention
[0006] In response to the above technical problems, the embodiments of the present invention provide a chemotherapy resistance marker RAD51AP1 and its application for ovarian cancer resistance diagnosis or prognosis evaluation in the treatment of ovarian cancer with platinum drugs, so as to solve the problems raised in the above background technology.
[0007] A reagent for detecting RAD51AP1 protein or its encoding gene is used in the preparation of a product for diagnosing drug resistance or evaluating the prognosis of ovarian cancer treated with platinum drugs.
[0008] A chemotherapy resistance marker for diagnosing ovarian cancer resistance or evaluating prognosis during platinum-based drug treatment of ovarian cancer, wherein the marker comprises RAD51AP1 protein or a gene encoding the protein.
[0009] A reagent for detecting RAD51AP1 protein or its encoding gene is used in the preparation of a product for diagnosing drug resistance or evaluating the prognosis of ovarian cancer treated with platinum drugs.
[0010] Preferably, the RAD51AP1 protein or its encoding gene is used as a drug resistance marker in the treatment of ovarian cancer with platinum drugs.
[0011] Preferably, the expression of RAD51AP1 protein is upregulated in ovarian cancer patients.
[0012] Preferably, the expression level of RAD51AP1 protein in ovarian cancer patients is negatively correlated with the prognosis of platinum-based drug treatment.
[0013] Preferably, inhibiting the expression of RAD51AP1 protein in ovarian cancer patients can improve the therapeutic effect of platinum drugs.
[0014] Preferably, the product for diagnosing drug resistance or prognostic evaluation of ovarian cancer treated with platinum drugs includes primers and probes for identifying the RAD51AP1 protein encoding gene, and antibodies for recognizing the RAD51AP1 protein.
[0015] Among them, the forward primer sequence for identifying the RAD51AP1 protein encoding gene is shown in SEQ ID NO.1, and the rear primer sequence is shown in SEQ ID NO.2; the sequence of SEQ ID NO.1 is GCTACATTGTGAAGTTCCCATAAA; the sequence of SEQ ID NO.2 is TGGGTCCTGTCAAAACCAGT.
[0016] The antibody that recognizes RAD51AP1 protein is an antibody produced by Proteintech, and the product number of this antibody is 11255-1-AP.
[0017] It should be noted that the design of primers and probes is a conventional technique. For example, the principles of primer design generally include: first, searching for the full-length mRNA sequence of the RAD51AP1 gene through gene databases (such as NCBI, Ensembl, etc.); then designing primers and following several principles, such as: the length of the primers is generally 18-24 bases; selecting sequences with strong specificity to avoid large homology with sequences of other genes; avoiding primer dimers and self-complementarity when designing primers; when selecting primer sites, it is best to select the exon region of the gene and avoid the intron region to improve the success rate of PCR amplification, etc.
[0018] According to the above primer design principles, we designed primers as shown in SEQ ID NO.1 and SEQ ID NO.2, and performed gene amplification using PCR amplification technology. After gene amplification, it was verified to be the target gene.
[0019] A method for evaluating platinum drug resistance in the treatment of ovarian cancer, comprising evaluating the expression level of RAD51AP1 protein or its encoding gene in ovarian cancer patients treated with platinum drugs.
[0020] Preferably, the expression level of RAD51AP1 protein or its encoding gene is upregulated in drug-resistant ovarian cancer patients; wherein the threshold value of drug resistance in immunohistochemistry experiment is 0.026; and the threshold value of drug resistance in immunofluorescence experiment is 41.7.
[0021] Disclosed is a use of a drug for inhibiting the expression of RAD51AP1 protein or its encoding gene in the preparation of a drug for treating ovarian cancer.
[0022] The present invention provides a chemotherapy resistance marker RAD51AP1 for diagnosing drug resistance or evaluating prognosis of ovarian cancer in the treatment of ovarian cancer with platinum drugs, and its application, which has the following beneficial effects:
[0023] 1. The present invention has confirmed through a series of experiments that high expression of RAD51AP1 is closely associated with platinum-based chemotherapy resistance in ovarian cancer patients. RAD51AP1 expression levels are significantly upregulated in samples of ovarian cancer resistant to platinum-based chemotherapy. RAD51AP1 is expected to become a clinically useful chemotherapy resistance marker for the diagnosis or prognosis of ovarian cancer resistant to platinum-based chemotherapy.
[0024] 2. RAD51AP1 knockdown can enhance the efficacy of cisplatin and increase the apoptosis rate of cancer cells, showing its potential as a marker of chemotherapy resistance and targeted therapy.
[0025] 3. RAD51AP1 knockout combined with cisplatin treatment can significantly inhibit tumor growth, suggesting that RAD51AP1 may serve as an important target in cisplatin treatment and optimize cancer treatment strategies. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] Figure 1 The results of the experiments using immunohistochemistry and immunofluorescence techniques to detect RAD51AP1 expression;
[0027] Figure 2 The results show the effect of RAD51AP1 gene knockdown on cisplatin-induced apoptosis in ovarian cancer SKOV3 cells;
[0028] Figure 3 These are the results of the effect of cisplatin combined with RAD51AP1 knockout on the subcutaneous tumor-forming ability of nude mice. DETAILED DESCRIPTION
[0029] The following is a clear and complete description of the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without making any creative efforts shall fall within the scope of protection of the present invention.
[0030] In response to the above technical problems, the embodiments of the present invention provide a chemotherapy resistance marker RAD51AP1 and its application for ovarian cancer resistance diagnosis or prognosis evaluation in the treatment of ovarian cancer with platinum drugs, so as to solve the problems raised in the above background technology.
[0031] Example 1: Immunohistochemistry and immunofluorescence detection of RAD51AP1 expression
[0032] The main purpose of this experiment is to study the expression differences of RAD51AP1 in ovarian cancer, especially the expression differences between samples of sensitive ovarian cancer patients and platinum-resistant ovarian cancer patients, and to explore whether it is associated with platinum-based chemotherapy resistance. By detecting the expression of RAD51AP1, the experiment attempts to clarify whether it can serve as a marker or potential therapeutic target to predict or explain chemotherapy resistance in ovarian cancer.
[0033] Tissue sections were collected from 8 patients with platinum-sensitive ovarian cancer and 8 patients with platinum-resistant ovarian cancer (the acquisition of samples complied with ethical review), and the protein expression levels of RAD51AP1 were verified by immunohistochemistry and immunofluorescence experiments (the RAD51AP1 protein antibody model used in the experiment was Proteintech, 11255-1-AP).
[0034] The results are as follows Figure 1 As shown in Figure 1, the expression level of RAD51AP1 in platinum-resistant ovarian cancer samples was significantly higher than that in platinum-sensitive samples. In Example 1, samples from 8 platinum-sensitive ovarian cancer patients and 8 platinum-resistant ovarian cancer patients were used for clinical validation, and the expression level of RAD51AP1 was detected using immunohistochemistry and immunofluorescence techniques, respectively. The results showed that the expression level of RAD51AP1 was significantly upregulated in platinum-resistant samples.
[0035] It should be noted that Figure 1 The results showed that the average immunohistochemical score of RAD51AP1 in platinum-sensitive ovarian cancer samples was 0.026, and the immunohistochemical score of RAD51AP1 in platinum-resistant samples increased significantly to around 0.065. The immunofluorescence results also found that the immunofluorescence intensity of RAD51AP1 in platinum-sensitive samples was around 41.7., and the immunofluorescence intensity of RAD51AP1 in platinum-resistant samples increased significantly to around 77.1. In summary, the immunohistochemical experiment showed that the threshold for platinum resistance and platinum sensitivity was 0.026, and greater than or equal to 0.026 was considered resistant. The immunofluorescence experiment showed that the threshold for both was 41.7, and greater than or equal to 41.7 was considered resistant.
[0036] This study demonstrates that RAD51AP1 may be an important regulator of platinum-based chemotherapy resistance in ovarian cancer. Its expression is significantly elevated in platinum-resistant ovarian cancer patients, suggesting that RAD51AP1 may be involved in the development of chemotherapy resistance. Therefore, RAD51AP1 has the potential to serve as a marker of chemotherapy resistance and a promising target for future treatment strategies. This provides clinicians with a new diagnostic tool to help assess chemotherapy effectiveness, predict treatment response, and adjust treatment plans.
[0037] Example 2: Effect of RAD51AP1 gene knockdown on cisplatin-induced apoptosis in ovarian cancer SKOV3 cells
[0038] The primary objective of this study was to investigate the impact of RAD51AP1 on cisplatin resistance in human ovarian cancer SKOV3 cells by measuring apoptosis levels in SKOV3 cells under specific treatments. RAD51AP1 expression was knocked down using siRNA interference (siRNA) and then treated with cisplatin. The effect of cisplatin on apoptosis in these cells was observed, thereby evaluating whether RAD51AP1 depletion compromised the cytotoxicity of cisplatin. Specific data were analyzed using an apoptosis detection kit.
[0039] The results are as follows Figure 2 Knockdown of RAD51AP1 enhances the cytotoxic effect of cisplatin on human ovarian cancer SKOV3 cells. We used siRNA to knockdown RAD51AP1 expression in human ovarian cancer SKOV3 cells. Flow cytometry analysis showed that knockdown of RAD51AP1 enhanced cisplatin-induced apoptosis and the cytotoxic effect of cisplatin on SKOV3 cells.
[0040] In summary, Example 2 explored the role of the RAD51AP1 gene in cisplatin resistance in ovarian cancer cells and verified through flow cytometry that RAD51AP1 knockdown could enhance the efficacy of cisplatin and increase the apoptosis rate of cancer cells. The experimental results provide experimental evidence for the role of RAD51AP1 in cisplatin treatment of ovarian cancer and provide new ideas for future exploration of therapeutic strategies targeting RAD51AP1.
[0041] Example 3: Effect of cisplatin combined with RAD51AP1 knockout on subcutaneous tumorigenesis in nude mice
[0042] The main purpose of this experiment is to use nude mice as experimental animals, transplant tumor cells and combine them with drugs to study the effects of cisplatin and RAD51AP1 gene knockout on tumor growth.
[0043] 40 BALB / c nu / nu nude mice, male, 4-6 weeks old, weighing 18-20 g, raised in a specific pathogen-free (SPF) facility; 1×10 6 After the mice grew for 3 weeks, they were randomly divided into two groups and given intraperitoneal injections of normal saline and cisplatin, respectively, twice a week for 3 consecutive weeks, and the tumor volume of the mice was continuously tracked and measured.
[0044] The experimental results are as follows Figure 3 As shown in Figure 2, cisplatin combined with RAD51AP1 knockout significantly reduced the subcutaneous tumor formation ability of nude mice. Nude mouse tumor formation results showed that both the tumor formation ability of the RAD51AP1 knockout strain and the tumor formation ability of cisplatin treatment were significantly reduced, while the tumor formation ability of nude mice treated with combined RAD51AP1 knockout and cisplatin was the lowest.
[0045] The results of this experiment support the importance of the RAD51AP1 gene in tumorigenesis and suggest that its combination with cisplatin may have potential therapeutic advantages. Regulating the RAD51AP1 gene may help enhance the efficacy of chemotherapy drugs such as cisplatin, providing new insights into cancer treatment.
[0046] The embodiments described above are merely descriptions of preferred implementations of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should fall within the scope of protection determined by the claims of the present invention.
Claims
1. Use of a reagent for detecting RAD51AP1 protein in the preparation of a product for diagnosing drug resistance or evaluating prognosis of ovarian cancer treated with platinum drugs.
2. Use of the reagent for detecting RAD51AP1 protein according to claim 1 in the preparation of a product for diagnosing drug resistance or evaluating prognosis of ovarian cancer treated with platinum drugs, characterized in that: The method for diagnosis or prognosis assessment includes: evaluating the expression of RAD51AP1 protein in ovarian cancer patients treated with platinum-based drugs; Among them, the threshold of drug resistance in immunohistochemistry experiment is 0.026; the threshold of drug resistance in immunofluorescence experiment is 41.
7.
3. Use of the reagent for detecting RAD51AP1 protein according to claim 1 in the preparation of a product for diagnosing drug resistance or evaluating prognosis of ovarian cancer treated with platinum drugs, characterized in that: The RAD51AP1 protein is used as a drug resistance marker during the treatment of ovarian cancer with platinum drugs.
4. Use of the reagent for detecting RAD51AP1 protein according to claim 1 in the preparation of a product for diagnosing drug resistance or evaluating prognosis of ovarian cancer treated with platinum drugs, characterized in that: RAD51AP1 protein expression is upregulated in drug-resistant ovarian cancer patients.
5. Use of the reagent for detecting RAD51AP1 protein according to claim 1 in the preparation of a product for diagnosing drug resistance or evaluating prognosis of ovarian cancer treated with platinum drugs, characterized in that: The expression level of RAD51AP1 protein in ovarian cancer patients is negatively correlated with the prognosis of platinum-based drug treatment.
6. Use of the reagent for detecting RAD51AP1 protein according to claim 1 in the preparation of a product for diagnosing drug resistance or evaluating prognosis of ovarian cancer treated with platinum drugs, characterized in that: Inhibiting RAD51AP1 protein expression in ovarian cancer patients can improve the therapeutic effect of platinum drugs.
7. Use of the reagent for detecting RAD51AP1 protein according to claim 1 in the preparation of a product for diagnosing drug resistance or evaluating prognosis of ovarian cancer treated with platinum drugs, characterized in that: Products for diagnosing or prognosticating resistance to platinum-based drugs in ovarian cancer include primers and probes for identifying the RAD51AP1 protein-encoding gene, and antibodies for identifying the RAD51AP1 protein.
Citation Information
Patent Citations
Application of group of genes related to ovarian cancer prognosis
CN110551819A