Application of psoralen in preparation of medicine for treating sepsis

Abstract

The invention discloses an application of psoralen in preparation of a medicine for treating sepsis. As a natural product, psoralen has high safety and good tolerance, and can intervene in the pathological process of sepsis through various action mechanisms such as inflammatory reaction inhibition, immune reaction regulation and tissue repair promotion; the psoralen is applied to treatment of sepsis, inflammatory response of sepsis can be effectively controlled, tissue damage is relieved, and the case fatality rate is reduced, so that the survival rate and life quality of sepsis patients can be improved.

Description

Technical Field

[0001] The invention belongs to the field of medical technology, relates to a new use of psoralen, and specifically relates to the use of psoralen in preparing a medicine for treating sepsis. Background Art

[0002] Sepsis is a serious infectious disease, often caused by bacteria, viruses or other pathogenic microorganisms, characterized by systemic inflammatory response syndrome and multiple organ dysfunction. Although there are many treatments available, there are still problems such as poor efficacy and large side effects. Therefore, it is of great significance to find more effective and safer treatments.

[0003] Psoralen is a furanocoumarin compound derived from Psoralea corylifolia L. It is also widely found in Chinese medicines such as Adenophora australis, Saposhnikovia divaricata and Angelica dahurica. It has multiple pharmacological effects such as anti-osteoporosis, neuroprotection, anti-tumor, antioxidant, and anti-inflammatory. It can be used to treat rheumatoid arthritis, leukemia, Alzheimer's disease and other diseases. The molecular formula of psoralen is C 11 H6O3, molecular weight 186.163, CAS registration number 66-97-7, structural formula:

[0004] Summary of the invention

[0005] The object of the present invention is to provide a new use of psoralen, specifically, to provide the use of psoralen in the preparation of a drug for treating sepsis.

[0006] According to one aspect of the present invention, there is provided a use of psoralen in the preparation of a medicament for treating sepsis.

[0007] In some embodiments, psoralen can be used as a single active ingredient or together with other pharmaceutically acceptable one or more active ingredients that have no antagonistic effect with psoralen to prepare a drug for treating sepsis.

[0008] In some embodiments, the composition of the drug for treating sepsis may further include one or more pharmaceutically acceptable excipients.

[0009] In some embodiments, pharmaceutically acceptable excipients include, but are not limited to, fillers, binders, disintegrants, lubricants, thickeners, pigments, flavoring agents, solvents, surfactants, preservatives, antioxidants, coating agents, and the like.

[0010] The filler can be one or more of starch, sucrose, maltodextrin, resistant dextrin, lactose, microcrystalline cellulose, pregelatinized starch, sorbitol, xylitol, and erythritol; the binder can be one or more of starch slurry, sodium carboxymethyl cellulose, hydroxypropyl methylcellulose, hydroxypropyl cellulose, methyl cellulose, ethyl cellulose, povidone, gelatin, polyethylene glycol, ethanol, and water; the disintegrant can be one or more of dry starch, sodium carboxymethyl starch, low-substituted hydroxypropyl cellulose, cross-linked One or more of polyvinyl pyrrolidone, cross-linked sodium carboxymethyl cellulose, and effervescent disintegrants (sodium bicarbonate, citric acid); the lubricant can be one or more of magnesium stearate, silicon dioxide, talc, and polyethylene glycol; the thickener can be one or more of hydrogenated castor oil, glyceryl monostearate, and aluminum stearate; the pigment can be one or more of hematoxylin, beetroot red, cochineal red, curcumin, carotene, amaranth, lemon yellow, carmine, carmine blue, and sunset yellow.

[0011] In some embodiments, the dosage form of the drug for treating sepsis can be an oral preparation, an injection or an external preparation. The relevant dosage forms can be prepared according to conventional processes in the field of pharmaceutical preparations.

[0012] In some embodiments, the oral preparation can be a tablet, granule, capsule, pill, emulsion or powder. When psoralen is used as the single active ingredient in the oral preparation, the oral dosage of the oral preparation can be 5 to 6 mg / kg·d according to the content of psoralen. Preferably, when psoralen is used as the single active ingredient in the oral preparation, the oral dosage of the oral preparation is 5.5 mg / kg·d according to the content of psoralen, and the treatment course is preferably one month.

[0013] In some embodiments, the topical preparation can be a gel patch or a viscose dispersion patch. When psoralen is used as the single active ingredient in the topical preparation, the dosage of the topical preparation is 5 to 6 mg / kg·d, preferably 5.5 mg / kg·d, based on the content of psoralen, and the treatment course is preferably 1 to 2 weeks.

[0014] The beneficial effects of the present invention include:

[0015] (1) Psoralen can intervene in the pathological process of sepsis through multiple mechanisms such as inhibiting inflammatory response, regulating immune response, and promoting tissue repair. The application of psoralen in the treatment of sepsis can effectively control the inflammatory response of sepsis, reduce tissue damage and reduce mortality, thereby improving the survival rate and quality of life of sepsis patients, and has a good therapeutic effect in the treatment of sepsis.

[0016] (2) As a natural product, psoralen has high safety and good tolerability. Compared with traditional therapeutic drugs, it has fewer side effects and a wider range of applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Figure 2 is the phenotypic changes of lung tissues of mice in each group;

[0018] Figure 2 is the lung coefficient of mice in each group;

[0019] Figure 3 The HE staining results of the lung tissues of mice in each group are shown in Figure 1. The magnification of the microscope is 20 times, and the scale is 50 μm.

[0020] Figures 4-5 The following are the results of the expression of inflammatory factors IL-1β and IL-6 in the serum of each group of mice detected by ELISA method;

[0021] Figures 6 to 8 The results of the expression of inflammatory factors TNF-α, IL-6, and IL-1β in the lung tissues of each group of mice detected by RT-qPCR are shown in order;

[0022] Figures 9-10 The results of flow cytometry detection of the proportion of M1 and M2 macrophages in the lung tissues of each group of mice are shown in order;

[0023] Fig.11 This is the result of flow cytometry detection of neutrophil infiltration in the lung tissue of each group of mice. DETAILED DESCRIPTION

[0024] The present invention is further described in detail below in conjunction with the embodiments. The examples are only for explanation and are not intended to limit the present invention in any way. Unless otherwise specified, the raw materials and reagents used in the examples are conventional products that can be obtained commercially; the experimental methods in the examples where specific conditions are not specified are usually carried out according to conventional conditions in the art or according to the conditions recommended by the manufacturer.

[0025] Example 1

[0026] A septic mouse model was established by intraperitoneal injection of lipopolysaccharides (LPS) to evaluate the therapeutic effect of psoralen on septic mice.

[0027] 1. Experimental Materials

[0028] 1.1 Materials

[0029] Table 1 Materials and manufacturers

[0030]

[0031]

[0032] 1.2 Experimental instruments

[0033] Electronic analytical balance, centrifuge, pipette, beaker, measuring cylinder, -80℃ refrigerator, ultrapure water machine, Beckman flow cytometer, panoramic scanner, ultra-micro volume UV-visible spectrophotometer, real-time fluorescence quantitative PCR instrument, high-speed homogenizer, etc.

[0034] 1.3 Experimental animals

[0035] SPF male C57BL / 6 mice, 6-8 weeks old, weighing 21-23g, were purchased from Guangdong Weitong Lihua Experimental Animal Technology Co., Ltd. The experimental animals were housed in separate cages and adapted for one week. The animal breeding environment adopted a 12-hour cycle lighting mode simulating natural light, with an ambient temperature of 22-25℃ and a humidity of 45%-55%. The animals were allowed to drink water and eat freely, and all items used in the breeding environment were sterilized.

[0036] 2. Experimental methods

[0037] 2.1 Experimental groups and specific steps

[0038] Sixty SPF C57BL / 6J male mice were randomly divided into a normal group, a model group, a positive drug group, and psoralen high, medium, and low dose groups (PSO-high, PSO-mid, and PSO-Low), with 10 mice in each group. The psoralen group was given corresponding doses (50 mg / kg, 25 mg / kg, 12.5 mg / kg) by oral gavage once a day for 7 days; the normal group and the model group were given the same amount of 0.9% saline at the same dose; the positive drug group was given dexamethasone acetate (1.5 mg / kg) by oral gavage; the model was established immediately after the 7th day of administration, the model group, the positive drug group, and the psoralen group were injected with LPS (25 mg / kg) intraperitoneally, and the normal group was injected with the same dose of 0.9% saline intraperitoneally, and the survival status of the mice was observed every 12 hours since the modeling; the mice were euthanized 24 hours after the modeling, blood was collected from the eyeballs, the serum was separated and packaged for testing, and the contents of the lungs and cecum were taken for inspection.

[0039] 2.2 Pathological observation of mouse lung tissue

[0040] Lung tissue was dissected and photographed to record the overall morphology of the lung tissue.

[0041] The lung coefficient was calculated according to “lung coefficient = lung wet weight (mg) / body weight (g)”.

[0042] The left half of the lung was fixed with 4% paraformaldehyde, embedded in paraffin, and used for later use. HE staining was used to observe the pathological changes of lung tissue.

[0043] 2.3 Determination of inflammatory factors in mouse serum

[0044] The expression of IL-1β and IL-6 in the serum of each group of mice was measured using an enzyme-linked immunosorbent assay (ELISA) kit.

[0045] 2.4 RT-qPCR determination of mRNA expression levels of inflammatory factors in mouse lung tissue

[0046] Lung tissues of mice were obtained and the mRNA expression levels of IL-6, IL-1β and TNF-α were determined.

[0047] 2.4.1 Total RNA extraction from lung tissue

[0048] Before the experiment, the scissors and tweezers were sterilized by high pressure and dried in an oven.

[0049] Use sterile scissors to cut an appropriate amount of lung tissue (about 50 mg) and place it in a homogenization tube. Add 1 mL TRIzol was used to lyse the tissue, and then the tissue was homogenized using a homogenizer, centrifuged at 12,000 rpm for 15 min, and the supernatant was added with chloroform and isopropanol, and finally centrifuged to obtain the total RNA in the aqueous phase.

[0050] 2.4.1.1 Determination of total RNA sample concentration

[0051] The concentration of RNA samples was determined using NanoDrop 2000 UV spectrophotometer software.

[0052] The measurement result of A260 / A280 between 1.8 and 2.0 is the total RNA concentration of the sample.

[0053] 2.4.1.2 Reverse transcription and cDNA synthesis

[0054] Operate on ice, add 2μL gDNA Remover to the eight tubes, add the corresponding volume of RNA, mix with a pipette, react at room temperature for five minutes, and place on ice after five minutes. Add the corresponding volume of ddH2O and 4×RTmix 5μL to the eight tubes in turn, and gently pipette for 10s. Cover the lid tightly and centrifuge briefly. Reverse transcription conditions are: 42℃15min; 95℃30s, and cDNA is obtained.

[0055] 2.4.1.3qRT-PCR

[0056] ① According to the instructions of fluorescent quantitative PCR reagent ( Sybr Green qPCR Master Mix) was used for the operation. The total reaction system was 10 μL and each reactant in the table was added in sequence.

[0057] Table 2 qPCR reaction system

[0058] Element 10μL system 2*Color SYBR Green qPCR Master Mix 5μL Forward primer (10 μM) 0.2μL Forward primer (10 μM) 0.2μL cDNA 1μL (0.5-2μL) <![CDATA[ddH2O]]> Make up to 10 μL

[0059] Table 3 Related primers

[0060] Gene Forward Primer(5'-3') Reverse Primer(5'-3') Actin GGCTGTATTCCCCTCCATCG CCAGTTGGTAACAATGCCATGT IL-6 TAGTCCTTCCTACCCCAATTTCC TTGGTCCTTAGCCACTCCTTC IL-1β GCAACTGTTCCTGAACTCAACT ATCTTTTGGGGTCCGTCAACT TNF-α ACGGCATGGATCTCAAA AGATAGCAAATCGGCTGAC

[0061] ②After the sample is added, cover the plate with a sealing film and seal it tightly, then centrifuge it at 1000 rpm for 1 minute to centrifuge the liquid to the bottom of the well plate.

[0062] ③Reaction program: qRT-PCR was performed using a real-time fluorescence quantitative PCR instrument, and the specific program settings were as follows:

[0063] The hot start enzyme was activated at 95℃ for 5min, the DNA was melted at 95℃ for 10s, annealed at 60℃ for 30s, and the PCR reaction cycle was 40 cycles. The Ct value corresponding to each sample was read.

[0064] 2.5 Detection of macrophage and neutrophil expression by flow cytometry in mouse lung tissue

[0065] To determine the percentage of macrophages and neutrophils in lung tissue, cut the lung tissue into pieces, grind and filter it, add red blood cell lysis solution to resuspend it, and incubate it at room temperature for 5 minutes; add PBS to stop red blood cell lysis, centrifuge to remove the supernatant, add PBS to resuspend it, count the cells, and centrifuge to remove the supernatant; add antibodies, incubate at room temperature in the dark for 30 minutes; add PBS to stop staining, centrifuge to remove the supernatant, add PBS to resuspend it, and then perform flow cytometry detection. M1 macrophages: CD86+F4 / 80+CD11b+; M2 macrophages: CD206+F4 / 80+CD11b+. Neutrophils: CD45+CD11b+Ly6C+, stained. The samples were analyzed by Beckman flow cytometer.

[0066] 3. Statistical processing

[0067] All data were expressed as mean ± standard error (mean ± SEM), and the graphs were drawn using Graphpad Prism 9.0 software. P < 0.05 was used as the standard to indicate a significant difference. The independent sample T test (Student's test) was used to compare the normal group with the model group. * :P<0.05, ** :P<0.01; *** :P<0.001; compared with the normal group, # :P<0.05, ## :P<0.01, ### :P<0.001.

[0068] 4. Results

[0069] 4.1 Lung phenotype and lung coefficient in septic mice

[0070] like Figure 1 As shown in the figure, the lung tissue of mice in the normal group had normal morphology, smooth surface and pink color; compared with the normal group, the lung tissue of mice in the model group was larger and accompanied by a large number of dark red hemorrhages; there were a small number of dark red hemorrhages in the lung tissue of mice in the positive drug group and psoralen administration group, and the rest was pink in color. This shows that psoralen can alleviate acute lung injury caused by sepsis.

[0071] like Figure 2 As shown, compared with the normal group, the lung coefficient of mice in the model group was significantly increased (P<0.001), indicating the occurrence of pulmonary edema and the successful construction of the model; compared with the model group, the lung coefficient of the psoralen administration group was reduced, among which the low and medium dose groups of psoralen were significantly reduced and the difference was statistically significant (P<0.01).

[0072] 4.2 Pathological changes in lung tissue of septic mice

[0073] like Figure 3 As shown in the figure, 24 hours after modeling, the degree of lung damage in mice was observed by HE staining. Pathological sections of lung tissue were observed under a microscope. Compared with the normal group, the lung tissue of mice in the model group was severely damaged, with congestion of lung tissue, destruction of alveolar structure, obvious thickening of lung septum, and a large number of inflammatory cells infiltrating in the lung interstitium and alveoli. Compared with the model group, the lung tissue damage of mice in the psoralen group was alleviated, the alveolar structure was basically intact, the number of inflammatory cells infiltrating the lung tissue was reduced, and the bleeding was reduced.

[0074] 4.3 Effects of psoralen on the expression of inflammatory factors in serum and lung tissue of septic mice

[0075] (1) The ELISA method was used to detect the expression of inflammatory factors in mouse serum. Figures 4-5 As shown, compared with the model group, the expression of serum inflammatory factor IL-1β in the psoralen group was significantly decreased (P<0.001), the serum inflammatory factor IL-6 in the low-dose and high-dose psoralen groups was significantly reduced (P<0.05), and the medium-dose group was slightly reduced, indicating that psoralen treatment can reduce the level of inflammatory factors.

[0076] (2) The expression of inflammatory factors TNF-α, IL-6, and IL-1β in lung tissue was detected by RT-qPCR. Figures 6 to 8 The experimental results showed that compared with the normal group, the expression of TNF-α, IL-6, and IL-1β in the model group was significantly increased (P<0.001); compared with the model group, psoralen significantly reduced the expression of these inflammatory factors in the lung (P<0.01).

[0077] 4.4 Effect of psoralen on the number of monocytes, macrophages and neutrophils in lung tissue of septic mice

[0078] Flow cytometry was used to detect the proportion of M1 and M2 macrophages in mouse lung tissue to more directly observe the changes in macrophage phenotype. Figures 9-10 The experimental results showed that compared with the model group, the proportion of M1 macrophages in the psoralen group decreased (P<0.05) ( Fig. 9 ). Compared with the normal group, the content of M2 macrophages in the model group mice was significantly decreased after modeling (P<0.001), while its content in the psoralen group mice was significantly increased (P<0.01) ( Fig.10 ). The above results indicate that psoralen can reduce the proportion of M1 pro-inflammatory macrophages and increase the proportion of M2 anti-inflammatory macrophages in the lungs of septic mice.

[0079] Flow cytometry was used to detect neutrophil infiltration in mouse lung tissue. Fig.11 The results showed that compared with the normal group, the proportion of neutrophil infiltration in the lung tissue of the model group mice was significantly increased, and the statistical results were significantly different (P<0.001). Compared with the model group mice, the proportion of neutrophil in the lung of the psoralen medium-dose group mice was significantly reduced (P<0.01).

[0080] The above are only some embodiments of the present invention. For those skilled in the art, several modifications and improvements can be made without departing from the creative concept of the present invention, which all belong to the protection scope of the present invention.

Claims

1. Application of psoralen in the preparation of drugs for treating sepsis.

2. The use according to claim 1, characterized in that: The psoralen is used as a single active ingredient or together with other pharmaceutically acceptable one or more active pharmaceutical ingredients that have no antagonistic effect with psoralen to prepare a drug for treating sepsis.

3. The use according to claim 1 or 2, characterized in that: The drug for treating sepsis further comprises one or more pharmaceutically acceptable excipients.

4. The use according to claim 3, characterized in that: The drug for treating sepsis is an oral preparation, an injection or an external preparation.

5. The use according to claim 4, characterized in that: The oral preparation is a tablet, granule, capsule, pill, emulsion or powder.

6. The use according to claim 5, characterized in that: When psoralen is used as a single active ingredient, the oral dosage of the oral preparation is 5 to 6 mg / kg·d based on the content of psoralen.

7. The use according to claim 4, characterized in that: The external preparation is a gel patch or an adhesive dispersion patch.

8. The use according to claim 7, characterized in that: When psoralen is used as a single active ingredient, the dosage of the external preparation is 5 to 6 mg / kg·d based on the content of psoralen.

9. The use according to claim 3, characterized in that: The auxiliary material is selected from at least one of fillers, adhesives, disintegrants, lubricants, thickeners, pigments, flavoring agents, solvents, surfactants, preservatives, antioxidants, and coating agents.

Images