Preparation method and application of sericin calcium phosphate nano tumor vaccine

Abstract

The invention discloses a preparation method and application of a sericin calcium phosphate nano tumor vaccine, and belongs to the technical field of tumor drugs. The preparation method comprises the following steps: (1) preparing CP / OVA-CpG; and (2) preparing the SZCP / OVA-CpG. The prepared nano tumor vaccine can effectively solve the problems of insufficient response and low killing efficiency of tumor immunotherapy, the antigen and the adjuvant are co-delivered to dendritic cells (DC) in lymph nodes by the vaccine, T cell activation induced by released zinc ions is coordinated, and strong and lasting antigen-specific T cell immune response is induced. The strategy can efficiently deliver tumor antigens, and is an efficient and multifunctional nano vaccine platform.

Description

Technical Field

[0001] The invention belongs to the technical field of tumor drugs, and in particular relates to a preparation method of a sericin calcium phosphate nano tumor vaccine and an application thereof. Background Art

[0002] Cancer is a global public health problem that has always threatened human health. Traditional treatment options such as surgery and radiotherapy and chemotherapy have been unable to further improve the prognosis of cancer patients, especially postoperative recurrence and metastasis and chemotherapy resistance often lead to the death of patients. Therefore, it is urgent to develop new tumor treatment methods. Immunotherapy has brought new hope for tumor treatment and has made remarkable progress in recent years. Tumor immunotherapy includes immune checkpoint inhibitors (ICIs), chimeric antigen receptor-T cell therapy (CAR-Ts), oncolytic viruses and cancer vaccines. Although tumor immunotherapy has achieved great success in clinical practice, there are still defects such as insufficient immune response and low induction rate of antigen-specific cytotoxic T lymphocyte (CTL) response. For example, the immunosuppressive microenvironment of solid tumors greatly impairs the antigen-specific anti-tumor immune response.

[0003] Among them, tumor vaccines, as an emerging immunotherapy, are one of the most attractive immunotherapy strategies. Tumor vaccines are mainly composed of tumor antigens, suitable adjuvants, and effective delivery vectors. Tumor vaccines can stimulate systemic antigen-specific anti-tumor immune responses and long-term immune memory.

[0004] Nano tumor vaccine is a new type of tumor vaccine that has the dual advantages of nanomaterials and tumor vaccines. It uses nanomaterials as carriers to transport specific tumor antigens and immune adjuvants to treat or prevent the occurrence and development of tumors. Nano tumor vaccine can be efficiently taken up by dendritic cells, achieving efficient release of tumor antigens and adjuvants, and inducing a strong immune response.

[0005] Various metal ions play a key role in many immune regulation. For example, cell membrane Ca in T lymphocytes 2+ Signaling is closely related to the regulation of T cell activation, maturation and cytokine secretion. 2+ It is a potent agonist of cyclic GMP-AMP synthase (cGAS) and stimulator of interferon genes (STING). 2+ cGAS can also be activated by promoting cGAS-DNA phase separation. Therefore, metal ion-mediated immune modulation is becoming an effective approach to promote cancer immunotherapy.

[0006] Calcium phosphate nanoparticles are widely used in medical treatment and diagnosis due to their good safety and biological properties. They are biomaterials approved by the U.S. Food and Drug Administration (FDA) for use in the human body. They have high biocompatibility and biodegradability, pH responsiveness and drug release properties.

[0007] Sericin, a highly hydrophilic silk structural protein, has been widely used as a drug delivery carrier in our previous studies to effectively improve the colloidal stability of nanoparticles and prevent their aggregation.

[0008] The nano-tumor vaccine prepared as described above can deliver tumor-specific antigens and synergistic immune adjuvants to dendritic cells in a targeted manner, promote the activation of cytotoxic T cells and the production of effector molecules, and enhance specific anti-tumor immunity, but there have been no similar public reports so far. Summary of the invention

[0009] In view of the above situation, in order to solve the defects of the prior art, the present invention provides a method for preparing a sericin calcium phosphate nano tumor vaccine and its application, which can effectively solve the problems of insufficient activation of dendritic cells and defective cytotoxic T cell response. The specific scheme is as follows:

[0010] A method for preparing a sericin calcium phosphate nano tumor vaccine, the preparation method comprising the following steps:

[0011] (1) Preparation of CP / OVA-CpG

[0012] ① Dissolve 25-32 mg of anhydrous calcium chloride, 450-550 μg of OVA peptide and 180-220 μg of CpG-ODN in 4-6 mL of Tris-HCl buffer solution;

[0013] ②Dissolve 8-12mg Na2HPO4﹒12H2O in 4-6mL Tris-HCl buffer solution;

[0014] ③ Add the solution of step ② to the solution of step ① while stirring;

[0015] ④ After stirring evenly, centrifuge and collect to obtain CP / OVA-CpG;

[0016] The sequence of the OVA peptide is SIINFEKL;

[0017] (2) Preparation of SZCP / OVA-CpG

[0018] ① Redisperse CP / OVA-CpG in 8-12 mL methanol;

[0019] ②Add 25-35 μL of 180-220 mM soluble zinc salt aqueous solution and mix well;

[0020] ③ Collect metal ion modified CP / OVA-CpG nanoparticles by centrifugation;

[0021] ④ Re-dispersing the obtained metal ion-decorated CP / OVA-CpG nanoparticles in 4-6 mL of sericin solution;

[0022] ⑤ Collect the precipitate by centrifugation to obtain SZCP / OVA-CpG.

[0023] Preferably, in step (1)①, the amount of anhydrous calcium chloride used is 28 mg, the amount of OVA peptide used is 500 μg, and the amount of CpG-ODN used is 200 μg.

[0024] More preferably, the amount of Na2HPO4﹒12H2O used in step (1)② is 10 mg.

[0025] More preferably, the stirring speed in step (1) ③ is 900 rpm.

[0026] More preferably, in step (1)④, the centrifugal speed is 12000 rpm and the time is 10 min.

[0027] More preferably, the soluble zinc salt in step (2)② is zinc sulfate.

[0028] More preferably, the concentration of the zinc sulfate aqueous solution in step (2)② is 200 mM and the volume is 30 μL.

[0029] More preferably, the volume of the sericin solution in step (2)④ is 5 mL.

[0030] The sericin calcium phosphate nano tumor vaccine is prepared by the above preparation method.

[0031] The application of the sericin calcium phosphate nano tumor vaccine in the preparation of a product for treating or preventing tumors, wherein the tumor is melanoma.

[0032] Compared with the prior art, the present invention has the following beneficial effects:

[0033] The nano tumor vaccine prepared by the present invention can effectively solve the problems of insufficient response and low killing efficiency of tumor immunotherapy. The vaccine co-delivers antigens and adjuvants to dendritic cells (DCs) in lymph nodes, and coordinates the T cell activation induced by the released zinc ions to induce a strong and lasting antigen-specific T cell immune response. This strategy can efficiently deliver tumor antigens and is an efficient and multifunctional nano vaccine platform. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1The synthetic route of the sericin calcium phosphate nano tumor vaccine of the present invention is shown, wherein APs is OVA peptide 257-280, and M is a divalent metal ion.

[0035] Figure 2 The experimental process and results in Example 2, wherein A is the experimental process and B is the statistical results of specific killing of each group.

[0036] Figure 3 This is the activation status of BMDCs corresponding to the 6 groups in Example 3.

[0037] Figure 4 The figure shows the tumor volume growth curve and anatomical diagram of the B16-OVA tumor-bearing mice in Example 4.

[0038] Figure 5 This is the B16-OVA lung metastasis in Example 5.

[0039] Figure 6 is the number of B16-OVA lung metastases in Example 5.

[0040] Figure 7 is the area of ​​B16-OVA lung metastasis in Example 5. DETAILED DESCRIPTION

[0041] Example 1

[0042] The OVA257-264 peptide sequence used in this example is: SIINFEKL;

[0043] The CpG (ODN1826) DNA sequence is:

[0044] d(P-thio) (SEQ ID NO.1: TCCATGACGTTCCTGACGTT); sericin (from silkworm cocoon variety Baiyu) was extracted by alkaline degumming method, and sericin aqueous solution was prepared with a final concentration of 1 mg / mL.

[0045] 1. Preparation of OVA-CpG

[0046] An aqueous solution of 5 mg / ml OVA257-264 and an aqueous solution of 100 μmol / L CpG (ODN1826) were mixed in equal volumes.

[0047] 2. Preparation of CP / OVA-CpG;

[0048] (1) First, anhydrous calcium chloride (28 mg), OVA peptide (500 μg) and CpG-ODN (200 μg) were dissolved in 5 mL of Tris-HCl buffer solution (0.1 mol / L, pH 8.0) and stirred at 900 rpm for 30 min.

[0049] (2) Na2HPO4﹒12H2O (10 mg) was dissolved in 5 mL of Tris-HCl buffer solution (0.1 mol / L, pH 8.0) and stirred for 30 min.

[0050] (3) Add the solution of step (2) to the solution of step (1) under rapid stirring (900 rpm).

[0051] (4) After stirring at room temperature for 2 hours, the CP / OVA-CpG nanoparticles were collected by centrifugation (12000 rpm, 10 min), then washed with distilled water, and finally ultrasonically dispersed in 1000 μL water.

[0052] 3. Preparation of SZCP / OVA

[0053] (1) First, anhydrous calcium chloride (28 mg) and OVA peptide (500 μg) were dissolved in 5 mL of Tris-HCl buffer solution (0.1 mol / L, pH 8.0) and stirred at 900 rpm for 30 min.

[0054] (2) Na2HPO4﹒12H2O (10 mg) was dissolved in 5 mL of Tris-HCl buffer solution (0.1 mol / L, pH 8.0) and stirred for 30 min.

[0055] (3) Add the solution of step (2) to the solution of step (1) under rapid stirring (900 rpm).

[0056] (4) After stirring at room temperature for 2 hours, the obtained CP / OVA nanoparticles were collected by centrifugation (12000 rpm, 10 min) and then washed with distilled water.

[0057] (5) Centrifuge at 4°C (12000 rpm, 10 min) to collect CP / OVA nanoparticles.

[0058] (6) The obtained product was redispersed in 10 mL of methanol by ultrasound.

[0059] (7) Then, 30 μL of metal ion solution (200 mM aqueous zinc sulfate solution) was added to the solution and mixed at room temperature for 5 min.

[0060] (8) The metal ion-modified CP / OVA nanoparticles were collected by centrifugation at 12000 rpm for 10 min and washed with distilled water.

[0061] (9) The obtained metal ion-decorated CP / OVA nanoparticles were redispersed in 5 mL of sericin solution by ultrasound in an ice bath.

[0062] (10) The mixture was centrifuged at 12000 rpm for 15 min at 4°C and washed twice with distilled water. Finally, 1000 μL of water was added for ultrasonic dispersion.

[0063] 4. Preparation of SCP / OVA-CpG

[0064] After preparing CP / OVA-CpG in step 2, the CP / OVA-CpG nanoparticles were redispersed in 5 mL of sericin solution, centrifuged at 12000 rpm for 15 min at 4°C, washed twice with distilled water, and finally dispersed by ultrasonication in 1000 μL of water.

[0065] Example 2

[0066] Zinc sulfate aqueous solution 200 mM, manganese chloride aqueous solution 200 mM, copper sulfate aqueous solution 200 mM, cobalt chloride aqueous solution 200 mM.

[0067] 1. Preparation of Zn / SCP / OVA-CpG (i.e. SZCP / OVA-CpG)

[0068] (1) After preparing CP / OVA-CpG in step 2 of Example 1, the obtained product was redispersed in 10 mL of methanol by ultrasound.

[0069] (2) Then, 30 μL of metal ion solution (200 mM zinc sulfate aqueous solution) was added to the solution and mixed at room temperature for 5 min.

[0070] (3) The metal ion-modified CP / OVA-CpG nanoparticles were collected by centrifugation at 12000 rpm for 10 min and washed with distilled water.

[0071] (4) The obtained metal ion-decorated CP / OVA-CpG nanoparticles were redispersed in 5 mL of sericin solution by ultrasound in an ice bath.

[0072] (5) Centrifuge at 12000 rpm at 4°C for 15 min, wash twice with distilled water, and finally add 1000 μL of water for ultrasonic dispersion.

[0073] 2. Preparation of Cu / SCP / OVA-CpG

[0074] (1) After preparing CP / OVA-CpG in step 2 of Example 1, the obtained product was redispersed in 10 mL of methanol by ultrasound.

[0075] (2) Then, 30 μL of metal ion solution (200 mM copper sulfate aqueous solution) was added to the solution and mixed at room temperature for 5 min.

[0076] (3) The metal ion-modified CP / OVA-CpG nanoparticles were collected by centrifugation at 12000 rpm for 10 min and washed with distilled water.

[0077] (4) The obtained metal ion-decorated CP / OVA-CpG nanoparticles were redispersed in 5 mL of sericin solution by ultrasound in an ice bath.

[0078] (5) Centrifuge at 12000 rpm at 4°C for 15 min, wash twice with distilled water, and finally add 1000 μL of water for ultrasonic dispersion.

[0079] 3. Preparation of Mn / SCP / OVA-CpG

[0080] (1) After preparing CP / OVA-CpG in step 2 of Example 1, the obtained product was redispersed in 10 mL of methanol by ultrasound.

[0081] (2) Then, 30 μL of metal ion solution (200 mM manganese chloride aqueous solution) was added to the solution and mixed at room temperature for 5 min.

[0082] (3) The metal ion-modified CP / OVA-CpG nanoparticles were collected by centrifugation at 12000 rpm for 10 min and washed with distilled water.

[0083] (4) The obtained metal ion-decorated CP / OVA-CpG nanoparticles were redispersed in 5 mL of sericin solution by ultrasound in an ice bath.

[0084] (5) Centrifuge at 12000 rpm at 4°C for 15 min, wash twice with distilled water, and finally add 1000 μL of water for ultrasonic dispersion.

[0085] 4. Preparation of Co / SCP / OVA-CpG

[0086] (1) After preparing CP / OVA-CpG in step 2 of Example 1, the obtained product was redispersed in 10 mL of methanol by ultrasound.

[0087] (2) Then, 30 μL of metal ion solution (200 mM aqueous cobalt chloride solution) was added to the solution and mixed at room temperature for 5 min.

[0088] (3) The metal ion-modified CP / OVA-CpG nanoparticles were collected by centrifugation at 12000 rpm for 10 min and washed with distilled water.

[0089] (4) The obtained metal ion-decorated CP / OVA-CpG nanoparticles were redispersed in 5 mL of sericin solution by ultrasound in an ice bath.

[0090] (5) Centrifuge at 12000 rpm at 4°C for 15 min, wash twice with distilled water, and finally add 1000 μL of water for ultrasonic dispersion.

[0091] Next, we performed in vivo screening assays with four SMCP / OVA-CpG nanoparticles (Zn / SCP / OVA-CpG, Co / SCP / OVA-CpG, Mn / SCP / OVA-CpG, and Cu / SCP / OVA-CpG) to quantify their ability to generate antigen-specific CTL responses ( Figure 2 A and 2B). The experiment was divided into 7 groups, PBS group, free OVA-CpG group, CP / OVA-CpG group, Zn / SCP / OVA-CpG group, Co / SCP / OVA-CpG group, Mn / SCP / OVA-CpG group and Cu / SCP / OVA-CpG group. The indicated materials were injected subcutaneously at the base of the tail of C57BL / 6 mice (except the PBS group, the other groups were CpG: 20μg, OVA peptide: 25μg / mouse). One week later, spleen cells were collected from untreated C57BL / 6 mice, resuspended in 1640 complete medium (10 million / mL), and divided into two parts. One part was added with OVA257-264 peptide (10μg / mL), cultured in a cell culture incubator for 2 hours, and then labeled with CFSE with a final concentration of 0.5μM for 15 minutes in serum-free medium (CFSE low Lymphocytes not incubated with OVA were labeled with 5 μM CFSE for 15 min in serum-free medium (CFSE high ). Equal amounts of CFSE low (OVA257-264 incubation) and CFSE high The (unincubated) spleen cells were mixed together, washed three times to remove residual dye, and then infused back into the immunized mice via the tail vein at 200 μL / mouse (2×10 7 cells). After 16 hours, the mice were killed and spleen cells were collected for flow cytometry analysis. The specific killing was calculated as follows:

[0092] Specific killing percentage = 1-CFSE low / CFSE high .

[0093] The Zn / SCP / OVA-CpG (i.e. SZCP / OVA-CpG) nanovaccine produced the highest antigen-specific splenocyte killing response (45.5%), which was more than three times stronger than the response caused by free OVA-CpG (14.4%). Figure 2 B).

[0094] Example 3 Nano-tumor vaccine activates DC cell co-stimulatory molecules CD80 and CD86.

[0095] The tibia and femur of c57 mice were separated, and the bone marrow cell suspension was collected. 5 mL of lysate was incubated at room temperature for 5 minutes, and the cell pellet was collected by centrifugation at 1300 rpm for 5 minutes. The cell pellet was resuspended with 10 mL of PBS and centrifuged at 1300 rpm for 5 minutes. The cell pellet was resuspended with 1640 medium containing 10% FBS and transferred to a 9 cm cell culture dish with a total volume of 10 mL. 10 ng / mL IL-4 and 20 ng / mL GM-CSF were added. Half of the culture medium was replaced on the third and fifth days, and cytokines IL-4 and GM-CSF were supplemented. Mature BMDC cells were obtained on the sixth day, and the collected cells were evenly distributed in a 24-well plate with 1 mL of culture medium per well. The cells were divided into 6 groups: Group 1 G1, 10 μL PBS was added to each well; Group 2 G2, 1 μL OVA-CpG was added to each well; Group 3 G3, 10 μL CP / OVA-CpG was added to each well; Group 4 G4, 10 μL SZCP / OVA was added to each well; Group 5 G5, 10 μL SCP / OVA-CpG was added to each well; Group 6 G6, 10 μL SZCP / OVA-CpG was added to each well. After 24 hours of treatment, the cells were collected, washed once with PBS, stained with flow cytometry antibodies anti-CD11c-FITC, anti-CD80-PE, and anti-CD86-APC for 30 minutes, and detected by flow cytometry. The results are shown in Figure 3 ,Depend on Figure 3 It can be seen that the sixth group of SZCP / OVA-CpG treatment led to a significant increase in the expression of co-stimulatory molecules CD80 / 86 in BMDCs, which indicates that SZCP / OVA-CpG can effectively induce DC cell activation.

[0096] Example 4 SZCP / OVA-CpG Nano Tumor Vaccine Effectively Kills Tumors

[0097] A subcutaneous tumor mouse model was constructed using B16-OVA cells. A B16-OVA cell suspension was prepared, and the cell concentration was diluted to 2.5 million / mL. 100 μL, i.e. 250,000 cells, was subcutaneously injected above the thigh of C57 mice (6-8 weeks old). Tumor-bearing mice were subcutaneously immunized three times with three CP-based nanovaccines on the 4th, 8th and 12th days after inoculation with B16-OVA tumor cells, with each mouse injected with 100 μL each time. The experiment was divided into 4 groups: G1, G2, G3, and G4, with 8 tumor-bearing mice in each group. G1, PBS; G2, SZCP / OVA; G3, SCP / OVA-CpG; G4, SZCP / OVA-CpG, each mouse was injected with 100 μL, and this nanovaccine contained 20 μg CpG and 25 μg OVA peptide 257-280. Tumor size was measured regularly. For results, see Figure 4 ,Depend on Figure 4It can be seen that compared with SZCP / OVA, which had no obvious tumor growth inhibition, SCP / OVA-CpG inhibited tumor growth by 66.7%, and SZCP / OVA-CpG treatment could significantly inhibit tumor growth by 93%. This shows that SZCP / OVA-CpG tumor vaccine can strongly kill tumors.

[0098] Example 5 SZCP / OVA-CpG inhibits tumor metastasis

[0099] A subcutaneous tumor mouse model was constructed using B16-OVA cells. A B16-OVA cell suspension was prepared, and the cell concentration was diluted to 2.5 million / mL. 100 μL, i.e. 250,000 cells, was injected subcutaneously above the thigh of C57 mice (6-8 weeks old). Tumor-bearing mice were subcutaneously immunized three times with three CP-based nanovaccines on days 4, 8, and 12, with 100 μL injected into each mouse each time. The experiment was divided into 4 groups: G1, G2, G3, and G4, with 8 tumor-bearing mice in each group. G1, PBS; G2, SZCP / OVA; G3, SCP / OVA-CpG; G4, SZCP / OVA-CpG, each mouse was injected with 100 μL, this nanovaccine contained 20 μg CpG and 25 μg OVA peptide 257-280, and finally the growth of lung metastases was observed. SZCP / OVA treatment had no significant protective effect on the growth of B16-OVA lung metastases, whereas SCP / OVA-CpG vaccination partially delayed tumor metastasis, and SZCP / OVA-CpG treatment almost eliminated tumor metastasis ( Figure 5 ), the number of B16-OVA metastatic foci in the SZCP / OVA-CpG treatment group was the lowest ( Figure 6 ) and area( Figure 7 ) is the smallest. This indicates that the injection of tumor vaccine SZCP / OVA-CpG can effectively treat cancer metastasis.

[0100] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for preparing a sericin calcium phosphate nano tumor vaccine, characterized in that: The preparation method comprises the following steps: (1) Preparation of CP / OVA-CpG ① Dissolve 25-32 mg of anhydrous calcium chloride, 450-550 μg of OVA peptide and 180-220 μg of CpG-ODN in 4-6 mL of Tris-HCl buffer solution; ②Dissolve 8-12mg Na2HPO4﹒12H2O in 4-6mL Tris-HCl buffer solution; ③ Add the solution of step ② to the solution of step ① while stirring; ④ After stirring evenly, centrifuge and collect to obtain CP / OVA-CpG; The sequence of the OVA peptide is SIINFEKL; (2) Preparation of SZCP / OVA-CpG ① Redisperse CP / OVA-CpG in 8-12 mL methanol; ②Add 25-35 μL of 180-220 mM soluble zinc salt aqueous solution and mix well; ③ Collect metal ion modified CP / OVA-CpG nanoparticles by centrifugation; ④ Re-dispersing the obtained metal ion-decorated CP / OVA-CpG nanoparticles in 4-6 mL of sericin solution; ⑤ Collect the precipitate by centrifugation to obtain SZCP / OVA-CpG.

2. The preparation method according to claim 1, characterized in that: In the step (1)①, the amount of anhydrous calcium chloride used is 28 mg, the amount of OVA peptide used is 500 μg, and the amount of CpG-ODN used is 200 μg.

3. The preparation method according to claim 2, characterized in that: The amount of Na2HPO4﹒12H2O used in step (1)② is 10 mg.

4. The preparation method according to claim 3, characterized in that: The stirring speed in step (1) ③ is 900 rpm.

5. The preparation method according to claim 4, characterized in that: In step (1)④, the centrifugal speed is 12000 rpm and the time is 10 min.

6. The preparation method according to claim 5, characterized in that: The soluble zinc salt in step (2) ② is zinc sulfate.

7. The preparation method according to claim 6, characterized in that: The concentration of the zinc sulfate aqueous solution in step (2) ② is 200 mM and the volume is 30 μL.

8. The preparation method according to claim 7, characterized in that: The volume of the sericin solution in step (2)④ is 5 mL.

9. A sericin calcium phosphate nano tumor vaccine prepared by the preparation method according to any one of claims 1 to 8.

10. Use of the sericin calcium phosphate nano tumor vaccine according to claim 9 in preparing a product for treating or preventing tumors, characterized in that: The tumor is melanoma.

Images