Fusarium venenatum strain with high protein conversion and use thereof in increasing satiety of mycelial protein
By knocking out the chitin synthase and thiamine diphosphate-binding protein genes of Fusarium venetum, the protein conversion rate and oil content were improved, solving the problems of low protein conversion rate and short gastric emptying time in the existing technology, and realizing the efficient production of mycelial protein with high protein and high oil content.
Patent Information
- Application Number
- CN202510026877.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-08
- Publication Date
- 2026-01-27
- Estimated Expiration
- 2045-01-08
AI Technical Summary
The existing Fusarium viniferum has a low protein conversion rate, high glucose consumption, low fat content, poor chewiness, and short gastric emptying time, making it difficult to meet the requirements of high protein, high fat and long gastric emptying.
By knocking out the chitin synthase gene FvChs and the thiamine diphosphate binding protein gene Pdc in Fusarium venetum using CRISPR-Cas9 technology, the conversion rate of the substrate glucose was improved, the glucose consumption was reduced, and the oil content of the mycelium and the gastric emptying time were increased.
It significantly improved the protein conversion rate and oil content of Fusarium venetum, reduced glucose consumption, prolonged gastric emptying time, improved the production efficiency and nutritional quality of mycelial protein, and reduced production costs.
Smart Images

Figure CN119823882B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a strain of Fusarium vesicatoria with high protein conversion rate and its application in improving the satiety of mycelial protein, belonging to the fields of genetic engineering and food biotechnology. Background Technology
[0002] As various alternative proteins are used worldwide to replace animal protein, the proportion of novel alternative protein foods in consumers' diets is gradually increasing. Among them, fungal protein is a multicellular mycelial protein produced by filamentous fungi through fermentation. It contains essential dietary amino acids, including lysine, which is often lacking in plant proteins, giving it excellent nutritional value. Furthermore, fungal protein has advantages such as wide bioavailability, short growth time, and high production efficiency. Because the mycelium of filamentous fungi naturally mimics the fibrous texture of meat, it has good chewiness and a meaty feel. Moreover, fungal mycelial protein typically accounts for 30%-40% of dry matter, making it a potential high-quality protein source for next-generation alternative protein foods. The UK-based Quorn Foods has already developed a variety of commercial fungal meat products using Fusarium venenatum for consumers to choose from.
[0003] However, the production cost of *Fusarium venetum* remains high, particularly due to the low conversion rate of glucose to bacterial protein synthesis, resulting in significant glucose consumption. While existing technologies and reported metabolic modifications to *Fusarium venetum* have improved bacterial protein content, they haven't significantly increased protein conversion rates. Improving protein conversion rates would help reduce substrate consumption and costs, leading to better production efficiency and economic benefits. Furthermore, *Fusarium venetum* mycelium has a low oil content and poor chewiness, resulting in a less desirable texture compared to animal meat. Additionally, fungal mycelium typically possesses unique digestive properties, believed to slow down protein release kinetics during digestion, thus increasing satiety and making it suitable for people trying to lose weight and those with diabetes. Patent CN118421487A discloses that knocking out the chitinase gene helps increase the protein content of *Fusarium venetum*, but this reduces gastric emptying time, making it difficult to achieve the desired satiety effect. Therefore, there is an urgent need to provide a new strain that can improve protein conversion rate and oil content, significantly reduce glucose consumption during fermentation, and has a long gastric emptying time and high satiety. Summary of the Invention
[0004] In view of this, the present invention provides a strain of *Fusarium venenatum* with high protein conversion rate and its application in improving the satiety of mycelial protein. The *Fusarium venenatum* FCPD strain of the present invention is obtained by knocking out the chitin synthase gene *FvChs* and the thiamine diphosphate-binding protein gene in wild-type *Fusarium venenatum*. This strain not only improves the conversion rate of substrate glucose, significantly reduces glucose consumption and ethanol production in the fermentation broth, but also possesses high oil content and a significantly slowed gastric emptying rate.
[0005] This invention is achieved through the following technical solution:
[0006] The first objective of this invention is to provide a strain of Fusarium venenatum, named Fusarium venenatum FCPD, which was deposited at the China Center for Type Culture Collection on December 6, 2024, with accession number CCTCC NO: M 20242752.
[0007] A second objective of this invention is to provide a product containing the Venetian Fusarium FCPD.
[0008] The third objective of this invention is to provide a method for preparing the *Fusarium venetum* strain, wherein the *Fusarium venetum* strain is obtained by knocking out the chitin synthase gene FvChs (FVRRES_06397) and the thiamine diphosphate binding protein gene Pdc (FVRRES_12865) in the starting bacterial cell using CRISPR-Cas9 knockout technology.
[0009] In one embodiment of the present invention, the nucleotide sequence of the chitin synthase gene FvChs is shown in SEQ ID NO. 1, containing 3155 bp of nucleotides. The nucleotide sequence of the thiamine diphosphate binding protein gene is shown in SEQ ID NO. 2, containing 2272 bp of nucleotides.
[0010] The fourth objective of this invention is to provide a method for improving the protein conversion rate of Fusarium vesicatoria.
[0011] In one embodiment of the present invention, the method is to knock out the chitin synthase gene FvChs and the thiamine diphosphate binding protein gene Pdc in Fusarium vesicae; the nucleotide sequence of the gene FvChs is shown in SEQ ID NO.1, and the nucleotide sequence of the gene Pdc is shown in SEQ ID NO.2.
[0012] The fifth objective of this invention is to provide a method for increasing the oil content of Fusarium venetum.
[0013] In one embodiment of the present invention, the method is to knock out the chitin synthase gene FvChs and the thiamine diphosphate binding protein gene Pdc in Fusarium vesicae; the nucleotide sequence of the gene FvChs is shown in SEQ ID NO.1, and the nucleotide sequence of the gene Pdc is shown in SEQ ID NO.2.
[0014] The sixth objective of this invention is to provide a method for improving the satiety of Fusarium vesicatoria.
[0015] In one embodiment of the present invention, the method is to knock out the chitin synthase gene FvChs and the thiamine diphosphate binding protein gene Pdc in Fusarium vesicae; the nucleotide sequence of the gene FvChs is shown in SEQ ID NO.1, and the nucleotide sequence of the gene Pdc is shown in SEQ ID NO.2.
[0016] In one embodiment of the present invention, the improvement of satiety of Fusarium vesicatoria is achieved by prolonging gastric emptying time.
[0017] The seventh objective of this invention is to provide a method for preparing mycelial protein by culturing the aforementioned Fusarium venetum FCPD.
[0018] In one embodiment of the present invention, the liquid culture medium used for cultivation includes 30 g / L glucose, 1.2 g / L potassium sulfate, 0.5 g / L phosphate, 0.1 g / L magnesium sulfate heptahydrate, 0.03 g / L zinc sulfate heptahydrate, 0.0055 g / L copper sulfate pentahydrate, 0.01 g / L ferrous sulfate heptahydrate, 0.00003 g / L biotin, 0.4 g / L calcium acetate, and 6 g / L ammonia.
[0019] In one embodiment of the present invention, the culture conditions are: culture at 28℃-32℃ for 48h-72h, and rotation speed of 100rpm-250rpm.
[0020] In one embodiment of the invention, the Venetian Fusarium FCPD of the present invention consumes 40-60% less glucose than the wild type when producing the same mass of dry mycelium.
[0021] In one embodiment of the present invention, the oil content, based on dry mycelium, reaches 10%-20%, which is 90%-110% higher than that of the wild type.
[0022] In one embodiment of the present invention, the gastric half-emptying time of the in vitro simulated digestion of the Venetian Fusarium mycelium / cell protein of the present invention is increased by 10%-30% compared with the wild type.
[0023] An eighth objective of this invention is to provide the application of the method in increasing the cell protein content, substrate glucose conversion rate, protein conversion rate, lipid content and / or prolonging gastric emptying time of Fusarium vesicatoria.
[0024] The ninth object of this invention is to provide the use of the Venetian Fusarium FCPD in the preparation of products with high satiety and / or high protein and / or high fat content.
[0025] Beneficial effects:
[0026] This invention provides a *Fusarium venenatum* mutant (*Fusarium venenatum* FCPD), which, compared to the wild-type *Fusarium venenatum*, lacks the 3155 bp chitin synthase gene *FvChs* and the 2272 bp thiamine diphosphate-binding protein gene *Pdc* in its genome. The *Fusarium venenatum* FCPD exhibits improved substrate conversion efficiency, a 40%-60% reduction in sugar consumption for producing the same dry weight of mycelium compared to the wild type, a 90%-110% increase in mycelial lipid content, and a 10%-30% increase in mycelial gastric half-emptying time. This significantly improves the production efficiency and nutritional quality of *Fusarium venenatum* mycelial protein and reduces production costs. This *Fusarium venenatum* can be further used for genetic engineering to cultivate *Fusarium* strains with high protein and high lipid content.
[0027] Preservation of biological materials
[0028] The *Fusarium venenatum* FCPD provided by this invention was deposited on December 6, 2024, at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, China, with accession number CCTCC NO: M20242752 and classified as *Fusarium venenatum* FCPD. Attached Figure Description
[0029] Figure 1 This is a reverse image of wild-type Fusarium venenatum (WT) and FCPD grown on a PDA plate for 7 days according to the present invention.
[0030] Figure 2 The image shows the wet substrate mycelium obtained by culturing wild-type WT and FCPD of Fusarium venenatum in PDB medium for 72 h according to the present invention.
[0031] Figure 3 This refers to the biomass yield of the strain of the present invention during liquid culture;
[0032] Figure 4The ethanol yield of the strain of this invention during liquid culture;
[0033] Figure 5 The protein conversion rate of the strain of this invention during 72 hours of liquid culture;
[0034] Figure 6 This refers to the glucose consumption of the strain of this invention during 72 hours of liquid culture.
[0035] Figure 7 The percentage of oil in the mycelium of this invention (%);
[0036] Figure 8 The gastric emptying curves for mycelial digestion of the present invention are shown (A: wild type; B: FCPD). Detailed Implementation
[0037] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.
[0038] It should be noted that, unless otherwise specified, the experimental methods described in the following embodiments are conventional methods, and the reagents and materials described are commercially available.
[0039] The culture media and reagents used in the following embodiments of the present invention are as follows:
[0040] Potato glucose liquid medium (PDB): 10g / L-20g / L glucose, 20g / L-30g / L potato extract;
[0041] Potato glucose solid medium (PDA): 10 g / L-20 g / L glucose, 20 g / L-30 g / L potato extract, 15 g / L agar powder;
[0042] FDB upper tank culture medium: 30 g / L glucose, 1.2 g / L potassium sulfate, 0.5 g / L phosphate, 0.1 g / L magnesium sulfate heptahydrate, 0.03 g / L zinc sulfate heptahydrate, 0.0055 g / L copper sulfate pentahydrate, 0.01 g / L ferrous sulfate heptahydrate, 0.00003 g / L biotin, 0.4 g / L calcium acetate, 6 g / L ammonia water;
[0043] RM: 1g / L-5g / L yeast powder, 1g / L-5g / L peptone, 250g / L-300g / L sucrose, 20g agar;
[0044] SMC solution: 0.8M-1.2M sorbitol, 50mM-100mM CaCl2, 10mM-20mM Mes / NaOH;
[0045] STC solution: 0.8M-1.2M sorbitol, 50mM-100mM CaCl2, 10mM-50mM Tris–HCl;
[0046] SPTC solution: 20-40% PEG6000 dissolved in STC;
[0047] Mycelial lysis buffer: 2 mg / mL-5 mg / mL driselase; 2 mg / mL-5 mg / mL snailase.
[0048] Example 1: Preparation of Fusarium venetum FCPD strain
[0049] *Fusarium venenatum* FCPD is a gene knockout mutant created using CRISPR / Cas9 gene editing technology, starting with wild-type *Fusarium venenatum* strain BNCC362640. Online tools (http: / / crispor.tefor.net / ) were used to predict in situ proximity motifs for gene editing site localization. The 5S rRNA promoter, probers, and sgRNA scaffold were inserted into plasmid pUC57 to generate pTarget-Chs. To knock out Chs, two pairs of primers, Chsup-F and Chsup-R, and Chsdown-F and Chsdown-R, were used to amplify the upstream and downstream homologous arms of Chs from the *Fusarium venenatum* genome. The upstream and downstream homologous arm fragments of Chs were ligated into the linear pUC57 vector using a one-step cloning method to obtain the recombinant plasmid. Before transformation, linear sgRNA and the target homologous arm fragment were amplified from the corresponding plasmid by PCR. The knockout process of the thiamine diphosphate binding protein gene Pdc is similar. Two pairs of primers, Pdcup-F and Pdcup-R, and Pdcdown-F and Pdcdown-R, were used to amplify the upstream and downstream homologous arms of Pdc from the Fusarium venenatum genome.
[0050] PEG-mediated protoplast transformation to knock out the target gene: Mycelia grown on PDA plates for 5 days were washed with approximately 2 mL of sterile water to obtain a conidial suspension. Conidia were cultured in 50 mL PDB medium for 24 h. Mycelia were filtered through double-layer lens paper, washed with sterile water, and harvested. 20 mL of mycelial lysis buffer was added, and the mixture was incubated at 30°C and 100 rpm for 3 h. 10 mL of STC solution was added, gently mixed, and protoplasts were collected through a Miracloth filter and washed once more with STC. The mixture was centrifuged at 10°C, 2,000 × g for 10 min. After washing with pre-chilled STC, the protoplasts were resuspended in STC and used directly for transformation. 10 μg linear DNA and at least 100 μL of at least 10... 8 One protoplast, 25 μL of prepared SPTC solution, and the mixture were incubated on ice for 40 minutes. 1 mL of SPTC solution was added and incubated at room temperature for 30 minutes, then the protoplast mixture was diluted with 2 mL of SPTC. The mixture was then mixed with RM medium preheated to approximately 42°C and poured into petri dishes. After overnight incubation, it was covered with selective medium containing 100 μg / mL hygromycin. After incubation at 28°C for 2-3 days, Fusarium mycelium was visible. Homokaryotic cells were purified by transplating 1-2 times and colony PCR verification was performed.
[0051] The gene sequences of FvChs (FVRRES_06397) and thiamine diphosphate-binding protein (FVRRES_12865) were downloaded from the NCBI website (https: / / www.ncbi.nlm.nih.gov / ). The Fusarium genome was extracted using the Ezup column-based fungal genomic DNA extraction kit (B518259-0100, Shanghai Sangon Biotech Co., Ltd.). Genomic DNA amplification and sequencing analysis were performed on the wild-type and mutant samples. Compared with the wild-type, the FCPD mutant gene sequence had deletions of 3155 bp and 2272 bp at two sites, respectively. The described Fusarium venenatum FCPD was deposited at the China Center for Type Culture Collection on December 6, 2024, with accession number CCTCC NO: M 20242752.
[0052] The primer sequences are:
[0053] FChs:5'-atggtcttcaacgaaaatggcca-3';
[0054] RChs:5'-ttatcgccttgcaatgcag-3';
[0055] Chsup-F:5'-agctatgaccatgattacctgatccgatggtacctagag-3';
[0056] Chsup-R: 5’-gatatgtagagttcgtctgttatatcaatcggtcgc-3’;
[0057] Chsdown-F: 5’-accgattgatataacagacgaactctacatatcgagc-3’;
[0058] Chsdown-R: 5’-gccagtgccaagcttgcagatcggaagtttcac-3’;
[0059] Pdcup-F: 5’-agctatgaccatgattacttagacccgtccacctttc-3’;
[0060] Pdcup-R: 5’-atacatacaatcagaagtggttgcggattgatcggt-3’;
[0061] Pdcdown-F: 5’-accgatcaatccgcaaccacttctgattgtatgtatcgtagta-3’;
[0062] Pdcdown-R: 5’-tccagtcacgacgttgtatcaatgccgttgtcggtg-3’;
[0063] FvChs gene sequence: SEQ ID NO.1
[0064] atggtcttcaacgaaaatggccaaagaaatggccccaactatgatgcgccacgcgagatgcaagatctacctgctggccaagcagtaagctttagccccttcagcctccaacagttggcaactgcaatagcgaccttacagggcagctacgccagcgccagcaccagcctcactggaacctgtcgcaaaacaattacaaccaccgtttctaacttgacctttcttttccttccagtaccactttcgcgaatctgacgacgcaaacgcctcaaaccgatc
[0065] gcccgtgagcaacccatacgaacccgattatgaacaattatctcccccgcccatgctgggcgcacagcgccctgtccccgaacaaaacgagtc
[0066] gagccgcgatcttctacacagctcttaccatggcagtataggtcaggccagcttcgaccagggcagcctcggccacaacagtgcctatggagtt
[0067] ggcgctttcggtcattatcctcctgaccagcacggtcggttgcctggctcgccgggttacgagtacccagaacctgagtacgatgtcgaagcctc
[0068] ccgcctggctgaatcacgcctttctgtcgtgcatcgtacacctacgatgcaggaatggggtcagaatggggagacactgtctgtttcgcctgaatt
[0069] tgcccacggccgcccagattcgacttaccaggaattcgacgttgacgagagctggatgatgcgccagcagcaagcacaacttggacctggtg
[0070] gcctcggtcgctcaaagactcgcaaggtcaagcttgtccagggctccgtcctcagtatcgactaccccgtccccagcgccgtcaagaacgccat
[0071] cgagcccaggtatcgcaacggtcctggaagcatggaggaggaattcacaaagatgcgctacacagctgctacctgcgatccgaacgacttca
[0072] ccctgcgcaacggtttcaacctccgcccgcgaatgtataaccgtcataccgaactcctcatcgcaatcacctattacaacgaagacaaggtgctt
[0073] ctcgcccgaaccctacactacacaatgaagaacattcaggacattgtgaacctgaagcgatccaaattctggaacaagggaggtccagcctgg
[0074] cagaaaatcgtcgtctgtctcgtcttcgatggtctcgataaagttgacaagaatgtctttgacgtcctcgccactgttggtgtctatcaggacggcgt
[0075] tctcaaaaaggacgtcaatggcaaggaaactgtcgcccatattttcgagtacaccagtcaaatctccgtgacgcccgatcaacagcttgtccgtc
[0076] ctgaccccgacaagccgcatcgcaatctgccccccgtgcagttcattttctgtcttaagcaaaagaacagcaagaagatcaattcgcatcgctgg
[0077] ctgttcaacgcctttggtcgcattctaaacccagaagtcgccatcctcatcgacgccggaacaaaacctggcccgcgcgccctgttgtctctctgg
[0078] gaaggcttctataacgatcgtgacctcggcggtgcttgtggtgagatccacgtcatgttaggcaagggtggaaagatgcttctcaacccgcttgtc
[0079] gcggtacagaacttcgagtacaaaatttccaatgtgctcgataagcctctggaaagtgcgttcggatacgtcagtgtcctgcctggtgcgttttcag
[0080] cgtaccgcttccgtgccattatgggacgaccattggagcagtacttccacggcgaccacacgctctccaaaactctaggcaagaagggtattga
[0081] cggaatgaacatcttcaagaagaacatgttccttgccgaggaccgaattctctgcttcgaattggtcgcaaaggcgagtcaaaaatggcatctga
[0082] gctacatcaaggcatccaagggcgagaccgatgtgcctgaaggcgcatctgagtttattggccagcgacgtcgatggcttaacggatctttcgc
[0083] catgtctctctattctcttatgcatttcggacgaatgtatggctctggccataacgttgtccgactctttttcctccacatccagttcgtgtacaacttact
[0084] caacgtgctgttcagttggttctcgctcgctgctttctatctcactaccacgattatcatgaagcttgtcggaacgccacaggttctatccgggtacca
[0085] tggctggccgtttggcgatatggctacgccaattgtcaatgttctgatcaaatatatttacatcgctttcctcgtcctgcaattcgtcctcgctcttgga
[0086] aacagaccaaagggtgctcagtacacttacgtcctctccttcatggttttcggcttgatccagttgtatcttttggtcttgactggctatctcgtgtacc
[0087] gagccttcactggaacgcccattgaagaccagatctcattcgcgtccgggcaagccttcttcgatagtttcttcggaggcgatactggtgtcgcag
[0088] gtctgatcatcatcgccttgatcactatctacggtctcaactacatcgcgtccttcctctacctagatccgtggcacatgttccactccttccctcaata
[0089] tcttgtcctcatgtcaacctacatcaacatcctgatggtttatgccttcaacaactggcacgatgtgtcctggggaacaaagggttccgatgctgcc
[0090] gaagctctgccctctgccaacattgtcaaggatgaaaagggcaaggaagccgttgtggaagaaatcgagcaggagcaggaggatatcgaca
[0091] gcaagtttgaaaaggtcgtttggcgagccctcgcaccaatgagcgaaatgatggaagaacagcccgagaagaaggacgttgaagattcataca
[0092] agtctttccgaactggtcttgttattctttggttgctgtgcaacattgttctcattgtctttgtcacaacagacgattttatcactctcggtgtctctgtaagt
[0093] tatcttccccttgttctatagttccaacagcatgctaacccattcctttcagaaagccgcagacgtccgtacacccatgtatttccgtttcctcctctact
[0094] cgacaggtgtgctgtctattgtccgcttcattggtttcctctggttcattggacgaactggtattatgtgctgcattgcaaggcgataa;
[0095] Thiamine diphosphate-binding protein gene Pdc sequence: SEQ ID NO.2
[0096]
[0097] Example 2: Culture and characterization of Fusarium vesicae FCPD
[0098] Mycelium culture methods:
[0099] For solid plate culture, rinse the mycelium of the original plate with 2 mL of sterile water and dilute the turbid liquid to an appropriate concentration. Add 10 μL of spore suspension to a new PDA culture plate. After drying, invert the plate and culture for 2-5 days to obtain Fusarium colonies.
[0100] For cultivation in a 20L fermenter, scrape fresh spores (1mL, 1×10⁶) from a PDA plate. 5 Conidia ( / mL) were inoculated into 1.5L of PDB liquid medium and pre-cultured for 48h (28℃-32℃, 100rpm-250rpm) to obtain seed culture, which was then inoculated into a 20L stirred tank bioreactor containing 12.5L of FDB upper tank medium. Fermentation temperature was 29℃, aeration rate was 1vvm, and rotation speed was 100rpm. The pH was adjusted to 6.0 by adding 6M ammonia. On-tank fermentation lasted 72h, with samples taken every 24h to test sugar consumption and ethanol production. After fermentation, the fermentation broth was heat-treated at 60℃ for 20min, and the resulting mycelium was collected after washing with sterile water. Fresh, moist mycelium was used for in vitro simulated digestion experiments. The moist mycelium was freeze-dried to determine the lipid content of FCPD and wild-type mycelium.
[0101] 1. Phenotypic differences between Fusarium venetum FCPD and wild-type strains
[0102] Wild-type and FCPD mutant strains of *Fusarium vesicae* were inoculated onto plates and cultured for mycelial growth. The results are as follows: Figure 1 and Figure 2 As shown, compared with the wild type, the back of the FCPD strain plate turned red and the mycelium spread better on wet substrate.
[0103] 2. Comparative analysis of sugar consumption and ethanol production between *Fusarium vesicae* FCPD and wild-type strains
[0104] The 72-hour fermentation broth obtained from the above culture was collected, appropriately diluted, and the residual glucose and ethanol content in the fermentation broth was determined using a Silman M-100 biosensor analyzer. Mycelia were collected after 72 hours, lyophilized, and weighed to determine the sugar consumption of FCPD and wild-type strains at the same mycelial weight. Protein conversion rate was calculated as: biomass × protein content / glucose consumption. The protein content of dry mycelia was determined using a Kjeldahl nitrogen analyzer. The determination was repeated three times.
[0105] Statistical analysis showed significant differences between FCPD strains and wild-type strains (see...). Figure 3-6Based on dry mycelium, the biomass yield of the FCPD strain after 72 hours of fermentation in a 20L fermenter (85.87 g / L) was similar to that of the wild type (87.43 g / L). The wild type strain produced 10.5 g / L of ethanol as a byproduct in its fermentation broth after 72 hours, but the FCPD strain produced almost no ethanol (0.1 g / L). Furthermore, the total sugar consumption over 72 hours (1012.66 g) was significantly lower than that of the wild type (1934 g). The protein content of the FCPD dry mycelium was 50.83%, compared to 43.65% for the wild type, representing an increase of 7.18%. The protein conversion rate was as high as 57.32%, an increase of 77.1% compared to the wild type.
[0106] 3. Analysis of oil content in Fusarium venetum mycelium
[0107] The lipid content of dry mycelium was determined using a Soxhlet fat analyzer. The determination was repeated three times. A significant difference in lipid content was observed between the FCPD strain and the wild type (see [link to Soxhlet fat analyzer]). Figure 7 Based on dry mycelium, the oil content of wild-type mycelium was 5.23%, while the oil content of FCPD mycelium was significantly higher, reaching 10.07%. The high oil content may be one of the important reasons for the subsequent prolonged gastric emptying time.
[0108] 4. Digestive quality analysis of Fusarium venetum FCPD and wild-type strains
[0109] In vitro dynamic digestion was performed using the DIVHS-IV system (Xiaodong Yijian Instrument Equipment Co., Ltd., Suzhou, China), which included a biomimetic gastrointestinal human model. A 100g sample was placed in the biomimetic human stomach to initiate gastric emptying or gastrointestinal digestion. The ambient temperature was set to 37℃. For the gastric emptying experiment, chyme expelled from the terminal duodenum was collected and weighed every 20 minutes to determine the gastric emptying curve and half-emptying time.
[0110] To further quantitatively compare gastric emptying characteristics, the Elashoff index model, widely used to characterize gastric emptying of food matrix, was used to fit the gastric emptying data. Both FCPD and wild-type strain mycelial gastric emptying data showed good fit to the model (see [link to data]). Figure 8 Further comparison of the gastric half-emptying time (t) between the two methods. 1 / 2 (See Table 1) The half-emptying time of wild-type WT was 96.18 min, while that of FCPD was 109.98 min, which was significantly higher than that of wild-type. This indicates that knocking out the FvChs gene and the thiamine diphosphate binding protein gene can significantly slow down the gastric emptying process, which is beneficial for application in high satiety foods.
[0111] Table 1. Fitting results of the Elashoff model
[0112] sample k(1 / min) β <![CDATA[t 1 / 2 (min)]]> <![CDATA[r 2 ]]> WT 0.0206±0.0014 4.88±0.74 98.37 0.992 FCPD 0.01947±0.001 5.55±0.65 109.98 0.995
[0113] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.
Claims
1. A strain of Venetian Fusarium ( Fusarium venenatum FCPD, characterized in that, The *Fusarium vesicae* FCPD was deposited at the China Center for Type Culture Collection on December 6, 2024, with accession number CCTCC NO: M20242752.
2. A product containing the Fusarium vesicae FCPD of claim 1.
3. A method for preparing mycelial protein, characterized in that, The *Fusarium vesicatoria* FCPD of claim 1 was cultured.
4. The method according to claim 3, characterized in that, Incubate at 28℃-32℃ for 48-96 h at a rotation speed of 100rpm-250rpm.
5. The use of the Venetian Fusarium FCPD of claim 1 in the preparation of products with high satiety and / or high protein and / or high fat content.
6. The application as described in claim 5, characterized in that, The high feeling of satiety is due to prolonged gastric emptying time.
Citation Information
Patent Citations
Fusarium venanii and application thereof in improving digestibility of hypha protein
CN118421487A