Nfkb1 gene overexpression cell line and construction method thereof

Abstract

The invention discloses an Nfkb1 gene overexpression cell line and a construction method thereof, and relates to the field of gene engineering. The constructed recombinant lentiviral expression vector comprises a first LTR, a CMV promoter, an Nfkb1 gene, a Flag polypeptide tag, an EF-1a promoter, a green fluorescent protein gene, a shearing element, a screening gene and a nucleic acid fragment of a second LTR which are sequentially arranged from the 5'end to the 3 'end; co-transfecting a host cell by using the recombinant lentivirus expression vector and lentivirus packaging helper plasmid, and carrying out virus packaging to obtain an Nfkb1-overexpressed recombinant lentivirus; the HT22 cell line overexpressing the Nfkb1 is obtained by infecting the HT22 cell with the recombinant lentivirus overexpressing the Nfkb1, and screening the HT22 cell line overexpressing the Nfkb1 by using a resistance gene. Recombinant lentivirus is used as a vector, HT22 cells are infected with the recombinant lentivirus vector, a cell line capable of stably overexpressing the Nfkb1 gene is obtained through screening, and the effect of the Nfkb1 in neuroinflammation is conveniently researched.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a Nfkb1 gene overexpression cell line and a construction method thereof. Background Art

[0002] Nuclear factor kappa B subunit 1 (Nfkb1) is mainly expressed on the surface of microglia in the CNS and is involved in the regulation of neuroinflammation and microglial metabolism. The gene encodes a 105kD protein that can be co-translationally processed by the 26S proteasome to produce a 50kD protein. The 105kD protein is a specific transcriptional inhibitor of Rel proteins, and the 50kD protein is a DNA-binding subunit of the NF-kappa-B (NFKB) protein complex. NFKB is a transcriptional regulator that can be activated by various intracellular and extracellular stimuli, such as cytokines, oxidative free radicals, ultraviolet irradiation, and bacterial or viral products. Activated NFKB translocates to the nucleus and stimulates the expression of genes involved in a variety of biological functions. Inappropriate activation of NFKB is associated with many inflammatory diseases, while persistent inhibition of NFKB can lead to improper development of immune cells or delayed cell growth.

[0003] HT22 cell line is a mouse hippocampal neuron cell line derived from HT4. Under normal conditions, it can be grown by adhering to the wall, and can be cultured with ordinary DMEM medium plus serum and double antibodies. This cell line is a good model for studying glutamate toxicity in vitro, and has good applications in many neurodegenerative diseases, such as Alzheimer's disease and Parkinson's disease.

[0004] There is no report on overexpression of Nfkb1 in HT22 cells using lentivirus. Therefore, the present invention constructs a HT22 cell line that stably overexpresses the Nfkb1 gene based on lentivirus, in order to explore the regulatory mechanism of Nfkb1 in mediating neuroinflammatory response and provide a favorable research tool for intervening neuroinflammation with Nfkb1 as a target. Summary of the invention

[0005] In order to overcome the shortcomings of the prior art, the purpose of the present invention is to provide a Nfkb1 gene overexpression cell line and a construction method thereof, so as to facilitate the study of Nfkb1-mediated neuroinflammatory response, accurately regulate and target Nfkb1, and provide a potential intervention strategy for the treatment of neuroinflammatory diseases.

[0006] To achieve the above-mentioned purpose of the invention, the technical solution of a Nfkb1 gene overexpressing cell line and a construction method thereof of the present invention is:

[0007] The invention relates to a recombinant lentiviral expression vector, which comprises a nucleic acid fragment including a first LTR, a CMV promoter, an Nfkb1 gene, a Flag polypeptide tag, an EF-1a promoter, a green fluorescent protein gene, a splicing element, a screening gene and a second LTR from the 5' end to the 3' end; the recombinant lentiviral expression vector and a lentiviral packaging auxiliary plasmid are used to co-transfect a host cell, and viral packaging is performed to obtain a recombinant lentivirus overexpressing Nfkb1; HT22 cells are infected with the recombinant lentivirus overexpressing Nfkb1, and a HT22 cell line overexpressing Nfkb1 is obtained by screening with a resistance gene; and the resistance gene screening step comprises screening with puromycin to obtain a HT22 cell line overexpressing the Nfkb1 gene.

[0008] Furthermore, the sequence of the first LTR is shown in SEQ ID NO: 1;

[0009] The sequence of the CMV promoter is shown in SEQ ID NO: 2;

[0010] The sequence of the Nfkb1 gene is shown in SEQ ID NO: 3;

[0011] The sequence of the Flag polypeptide tag is shown in SEQ ID NO:4;

[0012] The sequence of the EF-1a promoter is shown in SEQ ID NO:5;

[0013] The sequence of the green fluorescent protein gene is shown in SEQ ID NO:6;

[0014] The sequence of the splicing element is shown in SEQ ID NO:7;

[0015] The sequence of the screening gene is shown in SEQ ID NO:8;

[0016] The sequence of the nucleic acid fragment of the second LTR is shown in SEQ ID NO:9.

[0017] Furthermore, the lentiviral packaging auxiliary plasmids are psPAX2 and pMD2.G, and the mass ratio of the recombinant lentiviral expression vector, pMD2.G and pxPAX2 plasmid is 4:1:3.

[0018] Furthermore, the host cell is a 293T cell.

[0019] Furthermore, the specific method for constructing the Nfkb1 gene overexpression cell line is as follows:

[0020] (a) Design primers to amplify the full length of the Nfkb1 gene:

[0021] According to the mouse Nfkb1 gene (NM_008689.3) published by NCBI, the corresponding nucleotide sequence was downloaded, and the primers of the Nfkb1 gene were designed using the primer design software Primer Premier 5; the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd., and the synthesized primer sequences are as follows:

[0022] Nfkb1-F:5'-ATTTCCGGTGAATTCGCCACCATGGCAGACGATGATCCCTAC-3';

[0023] Nfkb1-R:5'-AAGCTGGTACCGAGGATCCAATTTTGCCTTCAATAGGTC-3'.

[0024] (b) PCR amplification of Nfkb1 gene:

[0025] Using the cDNA of HT22 cells as a template, PCR amplification was performed with primers Nfkb1-F and Nfkb1-R under the action of super-fidelity DNA polymerase. The PCR system: 25 μL 2×Phanta Max Master Mix, 2 μL Nfkb1-F, 2 μL Nfkb1-R, 3 μL cDNA, 18 μL sterile water to a total volume of 50 μL; the PCR reaction program was: pre-denaturation: 95°C, 3 min; denaturation: 95°C, 15 s; annealing: 60°C, 15 s; extension: 72°C, 3 min, 35 cycles, 72°C, 5 min, and storage at 12°C; the PCR product was subjected to agarose gel electrophoresis, and the target gene was recovered using a gel recovery kit according to the operating steps in the instruction manual; the gel recovery kit is FastPure Gel DNA Extraction Mini Kit, produced by Nanjing Novozymes Co., Ltd., with the product number DC301.

[0026] (c) Double enzyme digestion to obtain linearized pLV vector:

[0027] The following double enzyme digestion system was prepared: 2 μL BamH1, 2 μL EcoR1, 5 μL NEBuffer r2.1, 2 μg plasmid, mixed, incubated at 37°C for 2 hours, subjected to agarose gel electrophoresis on the double enzyme digestion products, and the nucleic acid products were recovered using a gel recovery kit, which was produced by Nanjing Novozymes Co., Ltd. with a catalog number of DC301.

[0028] (d) Construction of recombinant lentiviral expression vector:

[0029] The Nfkb1 gene fragment was connected to the vector pCMV-3×Flag-EF1α-GFP-T2A-Puro to construct a recombinant lentiviral expression plasmid; specifically, the steps of connecting the Nfkb1 gene fragment to the vector pCMV-3×Flag-EF1α-GFP-T2A-Puro included: double enzyme digestion of the pCMV-3×Flag-EF1α-GFP-T2A-Puro vector plasmid with BamH1 and EcoR1 to obtain a linearized pCMV-3×Flag-EF1α-GFP-T2A-Puro backbone fragment; using a recombination kit to connect the Nfkb1 gene fragment to the pCMV-3×Flag-EF1α-GFP-T2A-Puro backbone fragment, picking positive clones for sequencing verification, and obtaining the pCMV-Nfkb1-3×Flag-EF1α-GFP-T2A-Puro vector; the recombination kit was produced by Nanjing Novozymes Co., Ltd. with a product number of C116.

[0030] (e) using the recombinant lentiviral expression vector and the virus packaging helper plasmid to co-transfect host cells, and performing virus packaging to obtain a recombinant lentivirus that overexpresses Nfkb1;

[0031] According to the mass ratio of recombinant lentiviral expression vector, pMD2.G and pxPAX2 plasmid of 4:1:3, transfection reagent was added and transfected into 293T host cells. The cell supernatant was collected at 36 hours and 72 hours, respectively, filtered through a 0.45 μm filter membrane, and centrifuged at 3000 rpm, 4°C for 30 minutes. The supernatant was discarded and the precipitate was resuspended with PBS to obtain the recombinant lentivirus.

[0032] (f) HT22 cells were infected with a recombinant lentivirus that overexpressed Nfkb1, and a HT22 cell line that overexpressed Nfkb1 was obtained by screening with a resistance gene:

[0033] After infecting HT22 cells with the above-mentioned Nfkb1 recombinant virus, an Nfkb1 overexpression cell line was obtained; 2ug / ml of puromycin was added to the culture medium, and after two weeks of resistance screening, an Nfkb1 overexpression cell line was obtained.

[0034] (g) WB experimental verification of HT22 cell line overexpressing Nfkb1:

[0035] Western blot was used to detect the expression level of Nfkb1:

[0036] (1) Collect HT22 cells from a 6-well plate, add 100 μL RIPA strong lysis buffer (containing protease inhibitors) to each well, then add 25 μL 5x protein loading buffer, and boil in boiling water for 8 min;

[0037] (2) SDS-PAGE gel electrophoresis: The prestained protein marker and the denatured protein sample were spotted into the wells of the protein gel, and electrophoresis was performed at a constant voltage of 150 V for 50 min.

[0038] (3) Transfer: Cut the NC membrane of appropriate size and mark it; then soak the NC membrane in the transfer solution and assemble the transfer device from bottom to top in the order of filter paper, NC membrane, gel, and filter paper; after fixing, place it in the transfer instrument and add an appropriate amount of transfer solution, and transfer at 275 mA for 60 min;

[0039] (4) Blocking: Place the NC-containing membrane in a blocking solution containing 5% skimmed milk powder and block at room temperature for 30 min;

[0040] (5) Primary antibody incubation: Remove the blocked NC membrane, wash the blocking solution with PBS, and then place it in the primary antibody diluted in TBST, where Nfkb1 and 3xFlag antibodies are diluted at 1:1000, and actin antibody is diluted at 1:3000, and incubate at 4°C overnight;

[0041] (6) Rinse with TBST at room temperature three times, 10 min each time;

[0042] (7) Secondary antibody incubation: Place the NC membrane in the secondary antibody (Goat anti-Rabbit IgG) diluted in TBST, the secondary antibody dilution ratio is 1:10000, and incubate at room temperature for 1 hour;

[0043] (8) Rinse with TBST at room temperature three times, 10 min each time;

[0044] (9) Protein exposure scanning was performed using an Odyssey scanner.

[0045] (h) Fluorescence microscopy observation of HT22 cell line overexpressing Nfkb1:

[0046] HT22 cells overexpressing Nfkb1 were observed under a fluorescence microscope, and bright field and green fluorescence images were taken.

[0047] (i) Immunofluorescence validation of HT22 cell line overexpressing Nfkb1:

[0048] HT22 cells overexpressing Nfkb1 were plated in a 12-well plate containing a glass slide, ensuring that the cells were evenly distributed, and an appropriate amount of culture medium was added;

[0049] (1) Fixation: After 2 days, discard the culture medium, wash twice with PBS, and then add 4% paraformaldehyde (PFA) to fix the cells to maintain the cell morphology and structure. Fix at room temperature for 10-20 minutes, and then rinse three times with PBS, each time for 5 minutes;

[0050] (2) Membrane disruption: Add 0.5% Triton X-10 solution and incubate at room temperature for 10 minutes to disrupt the cell membrane, then wash with PBS three times, 5 minutes each time;

[0051] (3) Blocking: Incubate with 5% BSA (bovine serum albumin) solution at room temperature for 30 minutes;

[0052] (4) Primary antibody incubation: Add the diluted primary antibody solution (Nfkb1 antibody diluted at a ratio of 1:500) to the sample, incubate overnight at 4°C, and wash three times with PBST (PBS containing Tween-20), 5 minutes each time;

[0053] (5) Secondary antibody incubation: Add fluorescently labeled secondary antibody (Goat anti-Rabit IgG Secondary Antibody, Alexa Fluor 546) at a ratio of 1:200, incubate at room temperature in the dark for 1 hour, and wash three times with PBST, 5 minutes each time;

[0054] (6) Nuclear staining: Use DAPI (4',6-diamidino-2-phenylindole) dye to stain the cell nucleus, prepare the dye working solution at a ratio of 1:500, incubate in the dark for 10 minutes, and wash three times with PBS;

[0055] (7) Sealing: Add a sealing agent (PBS containing 50% glycerol) on the sample and gently cover it with a coverslip to avoid bubbles. Observe the sample under a confocal microscope, select the appropriate excitation wavelength and filter, and collect and save the image data.

[0056] Compared with the prior art, the present invention designs a simple and effective method for constructing a cell line overexpressing the Nfkb1 gene, uses a recombinant lentivirus as a vector, infects HT22 cells with the recombinant lentivirus vector, and screens to obtain a cell line that can stably overexpress the Nfkb1 gene. The HT22 cell line of the present invention can stably express Nfkb1, overcomes the shortcoming of the short maintenance time of exogenous gene overexpression in transient transfection experiments, and is convenient for studying the role of Nfkb1 in neuroinflammation. BRIEF DESCRIPTION OF THE DRAWINGS

[0057] In order to make the content of the present invention more clearly understood, the present invention is further described in detail below based on specific embodiments and in conjunction with the accompanying drawings, wherein:

[0058] Figure 1 It is a schematic diagram of the pLV-Nfkb1 vector in the present invention.

[0059] Figure 2 It is a result diagram and a statistical diagram of the overexpression level of Nfkb1 detected by Western blot in the present invention.

[0060] Figure 3 This is a diagram showing the green fluorescence observation results in the stably transfected cell line of the present invention.

[0061] Figure 4 This is a result diagram of the overexpression level of Nfkb1 detected by immunofluorescence in the present invention. DETAILED DESCRIPTION

[0062] In order to make the invention purpose, technical scheme and advantages of the present invention more clear, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the protection scope of the present invention.

[0063] Nfkb1 is a key member of the NF-κB family, and the p50 subunit it encodes plays an important regulatory role in neuroinflammation. Nfkb1 is both a driver of proinflammatory signals and a participant in the negative feedback mechanism in neuroinflammation. Its bidirectional regulatory effect makes it an important hub for neuroimmune response. Precise regulation targeting Nfkb1 can provide a potential intervention strategy for the treatment of neuroinflammatory diseases. In order to facilitate the study of Nfkb1-mediated neuroinflammatory response, the present invention uses a lentiviral overexpression method to construct an HT22 cell line that stably expresses Nfkb1.

[0064] The present invention discloses an Nfkb1 gene overexpression cell line and a construction method thereof, comprising: constructing a recombinant lentiviral expression vector, wherein the recombinant lentiviral expression vector comprises a nucleic acid fragment which, from the 5' end to the 3' end, is sequentially a first LTR, a CMV promoter, an Nfkb1 gene, a Flag polypeptide tag, an EF-1a promoter, a green fluorescent protein gene, a splicing element, a screening gene and a second LTR.

[0065] The sequence of the first LTR is shown in SEQ ID NO: 1; specifically, the nucleotide sequence shown in SEQ ID NO: 1 is:

[0066] 5'-GGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACC CACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGT TGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTAGTCAGTGTGGAAAATCTCTA GCA.

[0067] The CMV promoter sequence is shown in SEQ ID NO: 2. Specifically, the nucleotide sequence shown in SEQ ID NO: 2 is:

[0068] 5'-CGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCA TTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATT AGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCT-3'.

[0069] The above Nfkb1 gene sequence is shown in SEQ ID NO: 3. Specifically, the nucleotide sequence shown in SEQ ID NO: 3 is:

[0070]

[0071] The Flag polypeptide tag sequence is shown in SEQ ID NO: 4. Specifically, the nucleotide sequence shown in SEQ ID NO: 4 is:

[0072] 5'-GACTACAAGGATGACGATGACAAGGATTACAAAGACGACGATGATAAGGACTATAAGGATGATGACGACAAA-3'.

[0073] The EF-1a promoter sequence is shown in SEQ ID NO: 5. Specifically, the nucleotide sequence shown in SEQ ID NO: 5 is:

[0074] 5'-GGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATT GAACGGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTG GCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGA ACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAG-3'.

[0075] The green fluorescent protein gene sequence is shown in SEQ ID NO: 6. Specifically, the nucleotide sequence shown in SEQ ID NO: 6 is:

[0076] 5'-ATGGCCCAGTCCAAGCACGGCCTGACCAAGGAGATGACCATGAAGTACCGCATGGAG GGCTGCGTGGACGGCCACAAGTTCGTGATCACCGGCGAGGGCATCGGCTACCCCTTCAAGGGCAAGCAGGCCATCAACCTGTGCGTGGTGGAGGGCGGCCCCTTGCCCTTCGCCGAGGACATCTTGTCCGCCGCCTTCATGTACGGCAACCGCGTGTTCACCGAGTACCCCCAGGACATCGTCGACTACTTCAAGAACTCCTGCCCCGCCGGCTACACCTGGGACCGCTCCTTCCTGTTCGAGGACGGCGCCGTGTGCATCTGCAACGCCGACATCACCGTGAGCGTGGAGGAGAACTGCATGTACCACGAGTCCAAGTTCTACGGCGTGAACTTCCCCGCCGACGGCCCCGTGATGAAGAAGATGACCGACAACTGGGAGCCCTCCTGCGAGAAGATCATCCCCGTGCCCAAGCAGGGCATCTTGAAGGGCGACGTGAGCATGTACCTGCTGCTGAAGGACGGTGGCCGCTTGCGCTGCCAGTTCGACACCGTGTACAAGGCCAAGTCCGTGCCCCGCAAGATGCCCG ACTGGCACTTCATCCAGCACAAGCTGACCCGCGAGGACCGCAGCGACGCCAAGAACCAGAAGTGGCACCTGACCGAGCACGCCATCGCCTCCGGCTCCGCCTTGCCC-3’。

[0077] The above-mentioned cleavage element is T2A, and the sequence is as shown in SEQ ID NO:7. Specifically, the nucleotide sequence shown in SEQ ID NO:7 is:

[0078] 5'-GAGGGCAGAGGAAGTCTTCTAACATGCGGTGACGTGGAGGAGAATCCCGGCCCT-3’。

[0079] The screening gene is the puromycin gene, and the sequence is shown in SEQ ID NO: 8. Specifically, the nucleotide sequence shown in SEQ ID NO: 8 is: 5'-ATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGCC -3'.

[0080] The sequence of the nucleic acid fragment of the second LTR is shown in SEQ ID NO: 9. Specifically, the nucleotide sequence shown in SEQ ID NO: 9 is:

[0081] 5'-TGGAAGGGCTAATTCACTCCCAACGAAAATAAGATCTGCTTTTTGCTTGTACTGGGTC TCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGC TTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTG ACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCA.

[0082] The specific construction method of a Nfkb1 gene overexpression cell line of the present invention is as follows:

[0083] 1. Design primers to amplify the full length of Nfkb1 gene.

[0084] According to the mouse Nfkb1 gene (NM_008689.3) published by NCBI, the corresponding nucleotide sequence was downloaded, and the primers of the Nfkb1 gene were designed using the primer design software Primer Premier 5. The primers were synthesized by Beijing Qingke Biotechnology Co., Ltd. The synthesized primer sequences are as follows:

[0085] Nfkb1-F:5'-ATTTCCGGTGAATTCGCCACCATGGCAGACGATGATCCCTAC-3'.

[0086] Nfkb1-R:5'-AAGCTGGTACCGAGGATCCAATTTTGCCTTCAATAGGTC-3'.

[0087] 2. PCR amplification of Nfkb1 gene.

[0088] Using the cDNA of HT22 cells as a template, primers Nfkb1-F and Nfkb1-R were used for PCR amplification under the action of super-fidelity DNA polymerase. The PCR system was as follows: 25 μL 2×Phanta Max Master Mix, 2 μL Nfkb1-F, 2 μL Nfkb1-R, 3 μL cDNA, and 18 μL sterile water to a total volume of 50 μL; the PCR reaction program was as follows: pre-denaturation: 95°C, 3 min; denaturation: 95°C, 15 s; annealing: 60°C, 15 s; extension: 72°C, 3 min, 35 cycles, 72°C, 5 min, and storage at 12°C. The PCR product was subjected to agarose gel electrophoresis, and the target gene was recovered using a gel recovery kit (FastPure Gel DNA Extraction Mini Kit, Nanjing Novogene Co., Ltd., catalog number DC301) according to the instructions.

[0089] 3. Double enzyme digestion to obtain linearized pLV vector.

[0090] The following double enzyme digestion system was prepared: 2 μL BamH1, 2 μL EcoR1, 5 μL NEBuffer r2.1, 2 μg plasmid. Mix well and incubate at 37°C for 2 hours. The double enzyme digestion products were subjected to agarose gel electrophoresis, and the nucleic acid products were recovered using a gel recovery kit (Nanjing Novozyme Co., Ltd., Cat. No. DC301).

[0091] 4. Construct a recombinant lentiviral expression vector.

[0092] The Nfkb1 gene fragment was connected to the vector pCMV-3×Flag-EF1α-GFP-T2A-Puro to construct a recombinant lentiviral expression plasmid. Specifically, the steps of connecting the Nfkb1 gene fragment to the vector pCMV-3×Flag-EF1α-GFP-T2A-Puro include: double digestion of the pCMV-3×Flag-EF1α-GFP-T2A-Puro vector plasmid with BamH1 and EcoR1 to obtain a linearized pCMV-3×Flag-EF1α-GFP-T2A-Puro backbone fragment. The Nfkb1 gene fragment was connected to the pCMV-3×Flag-EF1α-GFP-T2A-Puro backbone fragment using a recombination kit (Nanjing Novogene, Cat. No. C116), and the positive clones were selected for sequencing verification to obtain the pCMV-Nfkb1-3×Flag-EF1α-GFP-T2A-Puro vector.

[0093] 5. The recombinant lentiviral expression vector and the virus packaging helper plasmid are used to co-transfect host cells, and virus packaging is performed to obtain a recombinant lentivirus that overexpresses Nfkb1.

[0094] According to the mass ratio of recombinant lentiviral expression vector, pMD2.G and pxPAX2 plasmid of 4:1:3, transfection reagent was added and transfected into 293T host cells. The cell supernatant was collected at 36 hours and 72 hours, filtered through a 0.45μm filter membrane, and centrifuged at 3000rpm, 4℃, for 30min. The supernatant was discarded and the precipitate was resuspended with PBS to obtain the recombinant lentivirus.

[0095] 6. Use recombinant lentivirus overexpressing Nfkb1 to infect HT22 cells, and use resistance gene screening to obtain HT22 cell lines overexpressing Nfkb1.

[0096] After infecting HT22 cells with the above-mentioned Nfkb1 recombinant virus, an Nfkb1 overexpression cell line was obtained. 2ug / ml of puromycin was added to the culture medium, and after two weeks of resistance screening, an Nfkb1 overexpression cell line was obtained.

[0097] 7. WB experimental verification of HT22 cell line overexpressing Nfkb1.

[0098] Western blot was used to detect the expression level of Nfkb1:

[0099] (1) Collect HT22 cells from a 6-well plate, add 100 μL RIPA strong lysis buffer (containing protease inhibitors) to each well, then add 25 μL 5x protein loading buffer, and cook in boiling water for about 8 minutes.

[0100] (2) SDS-PAGE gel electrophoresis: The prestained protein marker and the denatured protein sample were applied to the wells of the gel, and the electrophoresis was performed at a constant voltage of 150 V for 50 min.

[0101] (3) Transfer. Cut the NC membrane to the appropriate size and mark it. Then soak the NC membrane in the transfer solution and assemble the transfer device from bottom to top in the order of filter paper, NC membrane, gel, and filter paper. After fixing, place it in the transfer apparatus and add an appropriate amount of transfer solution. Transfer at 275 mA for 60 min.

[0102] (4) Blocking: Place the NC-containing membrane in a blocking solution containing 5% skimmed milk powder and block at room temperature for 30 minutes.

[0103] (5) Primary antibody incubation. Remove the blocked NC membrane, wash the blocking solution with PBS, and then place it in the primary antibody diluted in TBST, where Nfkb1 and 3xFlag antibodies are diluted at 1:1000, and actin antibody is diluted at 1:3000, and incubate overnight at 4°C.

[0104] (6) Rinse with TBST at room temperature three times, 10 min each time;

[0105] (7) Secondary antibody incubation. Place the NC membrane in the secondary antibody (Goat anti-Rabbit IgG) diluted in TBST at a dilution ratio of 1:10000 and incubate at room temperature for 1 hour.

[0106] (8) Rinse with TBST at room temperature three times, 10 min each time;

[0107] (9) Protein exposure scanning was performed using an Odyssey scanner.

[0108] 8. Fluorescence microscopy observation of HT22 cell line overexpressing Nfkb1.

[0109] HT22 cells overexpressing Nfkb1 were observed under a fluorescence microscope, and bright field and green fluorescence images were taken.

[0110] 9. Immunofluorescence experiment verification of HT22 cell line overexpressing Nfkb1.

[0111] HT22 cells overexpressing Nfkb1 were plated in a 12-well plate containing a glass slide, ensuring that the cells were evenly distributed, and an appropriate amount of culture medium was added.

[0112] (1) Fixation. After 2 days, discard the culture medium, wash twice with PBS, and then add 4% paraformaldehyde (PFA) to fix the cells to maintain the cell morphology and structure. Fix at room temperature for 10-20 minutes, and then rinse three times with PBS, each time for 5 minutes.

[0113] (2) Membrane disruption: Add 0.5% Triton X-10 solution and incubate at room temperature for 10 minutes to disrupt the cell membrane, and then wash with PBS three times, 5 minutes each time.

[0114] (3) Blocking: Incubate with 5% BSA (bovine serum albumin) solution at room temperature for 30 minutes.

[0115] (4) Primary antibody incubation. Add the diluted primary antibody solution (Nfkb1 antibody diluted at a ratio of 1:500) to the sample, incubate overnight at 4°C, and wash three times with PBST (PBS containing Tween-20), each time for 5 minutes.

[0116] (5) Secondary antibody incubation. Add fluorescently labeled secondary antibody (Goat anti-Rabit IgG Secondary Antibody, Alexa Fluor 546) at a ratio of 1:200, incubate at room temperature for 1 hour in the dark, and wash three times with PBST, 5 minutes each time.

[0117] (6) Nuclear staining. Use DAPI (4',6-diamidino-2-phenylindole) dye to stain the cell nucleus. Prepare the dye working solution at a ratio of 1:500, incubate in the dark for 10 minutes, and wash three times with PBS.

[0118] (7) Sealing. Add a sealing agent (PBS containing 50% glycerol) to the sample and gently cover it with a coverslip to avoid bubbles. Observe the sample under a confocal microscope, select the appropriate excitation wavelength and filter, and collect and save the image data.

[0119] Through the above steps, the HT22 cell line overexpressing Nfkb1 was successfully constructed, which can fully study the molecular mechanism of neuroinflammation mediated by this gene.

[0120] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A Nfkb1 gene overexpression cell line and a method for constructing the same, characterized in that: The invention relates to a recombinant lentiviral expression vector, which comprises a nucleic acid fragment including a first LTR, a CMV promoter, an Nfkb1 gene, a Flag polypeptide tag, an EF-1a promoter, a green fluorescent protein gene, a splicing element, a screening gene and a second LTR from the 5' end to the 3' end; the recombinant lentiviral expression vector and a lentiviral packaging auxiliary plasmid are used to co-transfect a host cell, and viral packaging is performed to obtain a recombinant lentivirus overexpressing Nfkb1; HT22 cells are infected with the recombinant lentivirus overexpressing Nfkb1, and a resistance gene is used to screen to obtain a HT22 cell line overexpressing Nfkb1; and the resistance gene screening step comprises screening with puromycin to obtain a HT22 cell line overexpressing the Nfkb1 gene.

2. The Nfkb1 gene overexpressing cell line and the construction method thereof according to claim 1, characterized in that: The sequence of the first LTR is shown in SEQ ID NO: 1; The sequence of the CMV promoter is shown in SEQ ID NO: 2; The sequence of the Nfkb1 gene is shown in SEQ ID NO: 3; The sequence of the Flag polypeptide tag is shown in SEQ ID NO:4; The sequence of the EF-1a promoter is shown in SEQ ID NO:5; The sequence of the green fluorescent protein gene is shown in SEQ ID NO:6; The sequence of the splicing element is shown in SEQ ID NO:7; The sequence of the screening gene is shown in SEQ ID NO:8; The sequence of the nucleic acid fragment of the second LTR is shown in SEQ ID NO:

9.

3. The Nfkb1 gene overexpressing cell line and the construction method thereof according to claim 1, characterized in that: The lentiviral packaging auxiliary plasmids are psPAX2 and pMD2.G, and the mass ratio of the recombinant lentiviral expression vector, pMD2.G and pxPAX2 plasmid is 4:1:

3.

4. The Nfkb1 gene overexpressing cell line and the construction method thereof according to claim 1, characterized in that: The host cell is 293T cell.

5. The Nfkb1 gene overexpressing cell line and the construction method thereof according to claim 1, characterized in that: The specific construction method is as follows: (a) Design primers to amplify the full length of the Nfkb1 gene: According to the mouse Nfkb1 gene (NM_008689.3) published by NCBI, the corresponding nucleotide sequence was downloaded, and the primers of the Nfkb1 gene were designed using the primer design software Primer Premier 5; the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd., and the synthesized primer sequences are as follows: Nfkb1-F:5'-ATTTCCGGTGAATTCGCCACCATGGCAGACGATGATCCCTAC-3'; Nfkb1-R:5'-AAGCTTTGGTACCGAGGATCCAATTTTGCCTTCAATAGGTC-3'; (b) PCR amplification of Nfkb1 gene: The cDNA of HT22 cells was used as a template, and primers Nfkb1-F and Nfkb1-R were used for PCR amplification under the action of super-fidelity DNA polymerase. The PCR system was as follows: 25 μL 2×Phanta Max Master Mix, 2 μL Nfkb1-F, 2 μL Nfkb1-R, 3 μL cDNA, and 18 μL sterile water to a total volume of 50 μL; the PCR reaction procedure was as follows: pre-denaturation: 95°C, 3 min; denaturation: 95°C, 15 s; Annealing: 60℃, 15s; Extension: 72°C, 3 min, 35 cycles, 72°C, 5 min, 12°C storage; the PCR product was subjected to agarose gel electrophoresis, and the target gene was recovered using a gel recovery kit according to the operating steps in the instruction manual; the gel recovery kit is FastPure Gel DNA Extraction Mini Kit, produced by Nanjing Novozymes Co., Ltd., with a catalog number of DC301; (c) Double enzyme digestion to obtain linearized pLV vector: The following double enzyme digestion system was prepared: 2 μL BamH1, 2 μL EcoR1, 5 μL NEBuffer r2.1, 2 μg plasmid, mixed, incubated at 37°C for 2 hours, subjected to agarose gel electrophoresis on the double enzyme digestion products, and the nucleic acid products were recovered using a gel recovery kit, the gel recovery kit was produced by Nanjing Novozyme Co., Ltd., with the catalog number DC301; (d) Construction of recombinant lentiviral expression vector: The Nfkb1 gene fragment was connected to the vector pCMV-3×Flag-EF1α-GFP-T2A-Puro to construct a recombinant lentiviral expression plasmid; specifically, the steps of connecting the Nfkb1 gene fragment to the vector pCMV-3×Flag-EF1α-GFP-T2A-Puro include: double digestion of the pCMV-3×Flag-EF1α-GFP-T2A-Puro vector plasmid with BamH1 and EcoR1 to obtain a linearized pCMV-3×Flag-EF1α-GFP-T2A-Puro backbone fragment; using a recombination kit to connect the Nfkb1 gene fragment to the pCMV-3×Flag-EF1α-GFP-T2A-Puro backbone fragment, picking positive clones for sequencing verification, and obtaining the pCMV-Nfkb1-3×Flag-EF1α-GFP-T2A-Puro vector; the recombination kit is produced by Nanjing Novozymes Co., Ltd., with a product number of C116; (e) using the recombinant lentiviral expression vector and the virus packaging helper plasmid to co-transfect host cells, and performing virus packaging to obtain a recombinant lentivirus that overexpresses Nfkb1; According to the mass ratio of recombinant lentiviral expression vector, pMD2.G and pxPAX2 plasmid of 4:1:3, transfection reagent was added and transfected into 293T host cells. The cell supernatant was collected at 36 hours and 72 hours, respectively, filtered through a 0.45 μm filter membrane, centrifuged at 3000 rpm, 4°C for 30 minutes, the supernatant was discarded, and the precipitate was resuspended with PBS to obtain the recombinant lentivirus; (f) HT22 cells were infected with a recombinant lentivirus that overexpressed Nfkb1, and a HT22 cell line that overexpressed Nfkb1 was obtained by screening with a resistance gene: After infecting HT22 cells with the above-mentioned Nfkb1 recombinant virus, an Nfkb1 overexpression cell line was obtained; 2ug / ml of puromycin was added to the culture medium, and after two weeks of resistance screening, an Nfkb1 overexpression cell line was obtained; (g) WB experimental verification of HT22 cell line overexpressing Nfkb1: Western blot was used to detect the expression level of Nfkb1: (1) Collect HT22 cells from a 6-well plate, add 100 μL RIPA strong lysis buffer (containing protease inhibitors) to each well, then add 25 μL 5x protein loading buffer, and boil in boiling water for 8 min; (2) SDS-PAGE gel electrophoresis: The prestained protein marker and the denatured protein sample were spotted into the wells of the protein gel, and electrophoresis was performed at a constant voltage of 150 V for 50 min. (3) Transfer: Cut the NC membrane of appropriate size and mark it; then soak the NC membrane in the transfer solution and assemble the transfer device from bottom to top in the order of filter paper, NC membrane, gel, and filter paper; after fixing, place it in the transfer instrument and add an appropriate amount of transfer solution, and transfer at 275 mA for 60 min; (4) Blocking: Place the NC-containing membrane in a blocking solution containing 5% skimmed milk powder and block at room temperature for 30 min; (5) Primary antibody incubation: Remove the blocked NC membrane, wash the blocking solution with PBS, and then place it in the primary antibody diluted in TBST, where Nfkb1 and 3xFlag antibodies are diluted at 1:1000, and actin antibody is diluted at 1:3000, and incubate at 4°C overnight; (6) Rinse with TBST at room temperature three times, 10 min each time; (7) Secondary antibody incubation: Place the NC membrane in the secondary antibody (Goat anti-Rabbit IgG) diluted in TBST, the secondary antibody dilution ratio is 1:10000, and incubate at room temperature for 1 hour; (8) Rinse with TBST at room temperature three times, 10 min each time; (9) Protein exposure scanning using Odyssey scanner; (h) Fluorescence microscopy observation of HT22 cell line overexpressing Nfkb1: HT22 cells overexpressing Nfkb1 were placed under a fluorescence microscope for observation, and bright field and green fluorescence photography were performed; (i) Immunofluorescence validation of HT22 cell line overexpressing Nfkb1: HT22 cells overexpressing Nfkb1 were plated in a 12-well plate containing a glass slide, ensuring that the cells were evenly distributed, and an appropriate amount of culture medium was added; (1) Fixation: After 2 days, discard the culture medium, wash twice with PBS, and then add 4% paraformaldehyde (PFA) to fix the cells to maintain the cell morphology and structure. Fix at room temperature for 10-20 minutes, and then rinse three times with PBS, each time for 5 minutes; (2) Membrane disruption: Add 0.5% Triton X-10 solution and incubate at room temperature for 10 minutes to disrupt the cell membrane, then wash with PBS three times, 5 minutes each time; (3) Blocking: Incubate with 5% BSA (bovine serum albumin) solution at room temperature for 30 minutes; (4) Primary antibody incubation: Add the diluted primary antibody solution (Nfkb1 antibody diluted at a ratio of 1:500) to the sample, incubate overnight at 4°C, and wash three times with PBST (PBS containing Tween-20), 5 minutes each time; (5) Secondary antibody incubation: Add fluorescently labeled secondary antibody (Goat anti-Rabit IgG Secondary Antibody, Alexa Fluor 546) at a ratio of 1:200, incubate at room temperature in the dark for 1 hour, and wash three times with PBST, 5 minutes each time; (6) Nuclear staining: Use DAPI (4',6-diamidino-2-phenylindole) dye to stain the cell nucleus, prepare the dye working solution at a ratio of 1:500, incubate in the dark for 10 minutes, and wash three times with PBS; (7) Sealing: Add a sealing agent (PBS containing 50% glycerol) on the sample and gently cover it with a coverslip to avoid bubbles. Observe the sample under a confocal microscope, select the appropriate excitation wavelength and filter, and collect and save the image data.

Images