Nitrilase mutant and application thereof

Abstract

The invention provides a nitrilase mutant and application thereof. Compared with wild nitrilase with an amino acid sequence shown as SEQ ID NO: 2, the nitrilase mutant comprises one or more of the following amino acid mutation sites: S200F, G238M, K241T, V242Q and G245Q. According to the invention, nitrilase derived from alcaligenes is subjected to mutation modification, and a nitrilase mutant with high enzyme activity, high salt tolerance and high substrate tolerance is constructed.

Description

Technical Field

[0001] The present application relates to the field of biotechnology, and in particular to a nitrilase mutant and application thereof. Background Art

[0002] Nicotinic acid, also known as water-soluble vitamin B3, is one of the important components in the body. It can promote cell metabolism and maintain the health of the skin, nervous system and digestive system.

[0003] At present, the main industrial production methods of nicotinic acid include potassium permanganate oxidation, nitric acid oxidation, nitric acid-sulfuric acid oxidation, ammonia oxidation, etc.; the disadvantages of the above methods include high energy consumption, complex reaction process, and serious environmental pollution. Therefore, the use of microbial enzymatic conversion to obtain nicotinic acid has attracted attention, and many researchers have continuously explored microorganisms with nitrilase activity and applied them to the preparation of nicotinic acid. However, the application of this method is restricted by many factors. At present, Escherichia coli is mainly used as the host, and its culture cycle is long and easy to be contaminated, which is not conducive to whole cell catalysis, and has poor stability and substrate tolerance.

[0004] Therefore, it is of great significance to further explore nitrilase with high catalytic activity. Summary of the invention

[0005] Based on this, one or more embodiments of the present application provide a nitrilase mutant with high catalytic activity and high substrate concentration tolerance and application thereof.

[0006] According to the first aspect of the present application, a nitrilase mutant is provided. Compared with the wild-type nitrilase with an amino acid sequence as shown in SEQ ID NO: 2, the nitrilase mutant comprises one or more of the following amino acid mutation sites: S200F, G238M, K241T, V242Q and G245Q.

[0007] In some embodiments, the amino acid mutation sites of the nitrilase mutant include one or more of the following combinations: (1) S200F / G238M, (2) S200F / V242Q, (3) K241T / G245Q, and (4) V242Q / G245Q;

[0008] Alternatively, the amino acid mutation sites of the nitrilase mutant include one or more of the following combinations: (5) S200F / G238M / V242Q, (6) S200F / V242Q / G245Q;

[0009] Alternatively, the amino acid mutation sites of the nitrilase mutant include one or more of the following combinations: (7) S200F / G238M / V242Q / G245Q; (8) G238M / K241T / V242Q / G245Q.

[0010] According to the second aspect of the present application, a nucleic acid fragment is provided, wherein the nucleic acid fragment encodes the above-mentioned nitrilase mutant.

[0011] According to the third aspect of the present application, a recombinant vector is provided, wherein the recombinant vector comprises the above-mentioned nucleic acid fragment.

[0012] According to the fourth aspect of the present application, a genetically engineered bacterium is provided, wherein the genetically engineered bacterium comprises the above-mentioned nucleic acid fragment or the above-mentioned recombinant vector.

[0013] In some embodiments, the host cell of the genetically engineered bacteria includes Vibrio natriuresis;

[0014] Optionally, the Vibrio natriegens includes Vibrio natriegens ATCC14048.

[0015] According to the fifth aspect of the present application, a method for constructing a genetically engineered bacterium is provided, comprising the following steps:

[0016] The recombinant vector expressing the nitrilase mutant is introduced into the genetically engineered bacteria to be transformed to construct the genetically engineered bacteria.

[0017] According to the sixth aspect of the present application, an enzyme catalytic preparation is provided, comprising the above-mentioned nitrilase mutant and auxiliary materials.

[0018] According to the seventh aspect of the present application, a method for preparing nicotinic acid is provided, comprising the following steps:

[0019] The nitrilase mutant, the genetically engineered bacteria or the enzyme catalytic preparation are used to catalyze the substrate to synthesize nicotinic acid.

[0020] In some embodiments, the preparation method satisfies at least one of the following characteristics:

[0021] (1) The substrate includes 3-cyanopyridine;

[0022] (2) The concentration of the substrate is 50 mM to 400 mM;

[0023] (3) The catalytic pH condition is 5.0 to 10.0; and

[0024] (4) The catalytic reaction temperature is 25°C to 55°C.

[0025] Compared with the traditional technology, this application has the following beneficial effects:

[0026] The present application constructs a nitrilase mutant with high enzyme activity and high salt and high substrate tolerance by mutating and modifying the nitrilase from Alcaligenes.

[0027] Furthermore, the genetically engineered bacteria prepared by the present application using Vibrio natriuresis as a host cell have the advantages of rapid growth, short fermentation cycle, high protein soluble expression level, and high tolerance to substrate concentration. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the specific implementation methods of the present application or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0029] Figure 1 Schematic diagram of the reaction of nitrilase NIT 338 catalyzing 3-cyanopyridine to produce nicotinic acid;

[0030] Figure 2 This is a schematic diagram of the SDS-PAGE protein of the crude enzyme solution obtained by the genetically engineered bacteria expressing the wild type of nitrilase NIT 338 in one embodiment of the present application;

[0031] Figure 3 This is a high performance liquid chromatography detection spectrum of substrates and products in the reaction of 3-cyanopyridine to nicotinic acid catalyzed by nitrilase NIT 338 in one embodiment of the present application. DETAILED DESCRIPTION

[0032] In order to make the above-mentioned purposes, features and advantages of the present application more obvious and easy to understand, the specific implementation methods of the present application are described in detail. In the following description, many specific details are set forth to facilitate a full understanding of the present application. However, the present application can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without violating the connotation of the present application, so the present application is not limited by the specific embodiments disclosed below.

[0033] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art of the present application. The terms used herein in the specification of the present application are only for the purpose of describing specific embodiments and are not intended to limit the present application. Unless otherwise specifically stated, various raw materials, reagents, instruments and equipment used in the present application, etc. can be purchased from the market or can be prepared by existing methods.

[0034] In the present application, "plurality", "multiple", "multiple times", "multiples", etc., unless otherwise specified, refer to a number greater than 2 or equal to 2. For example, "one or more" means one or greater than or equal to two.

[0035] In the present application, "further", "further", "particularly" and the like are used for descriptive purposes to indicate differences in content, but should not be construed as limiting the scope of protection of the present application.

[0036] In the present application, the technical features described in an open manner include closed technical solutions composed of the listed features, and also include open technical solutions containing the listed features.

[0037] In the present application, when it comes to numerical intervals (i.e., numerical ranges), unless otherwise specified, the optional numerical distribution is considered continuous within the above numerical interval, and includes the two numerical endpoints (i.e., the minimum and maximum values) of the numerical range, and each numerical value between the two numerical endpoints. Unless otherwise specified, when the numerical interval only refers to the integers within the numerical interval, it includes the two endpoint integers of the numerical range, and each integer between the two endpoints. In this article, it is equivalent to directly listing each integer, such as t is an integer selected from 1-10, indicating that t is any integer selected from the integer group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10. In addition, when multiple ranges are provided to describe features or characteristics, these ranges can be combined. In other words, unless otherwise specified, the ranges disclosed herein should be understood to include any and all sub-ranges included therein.

[0038] The temperature parameters in this application, unless otherwise specified, are allowed to be either constant temperature treatment or to vary within a certain temperature range. It should be understood that the constant temperature treatment allows the temperature to fluctuate within the accuracy range controlled by the instrument. Fluctuations within the range of ±5°C, ±4°C, ±3°C, ±2°C, and ±1°C are allowed.

[0039] In the present application, % (w / w) and wt% both represent weight percentage, % (v / v) refers to volume percentage, and % (w / v) refers to mass volume percentage.

[0040] In the present invention, in the "first aspect", "second aspect", "third aspect", "fourth aspect", etc., the terms "first", "second", "third", "fourth", etc. are used only for descriptive purposes and cannot be understood as indicating or implying relative importance or quantity, nor can they be understood as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first", "second", "third", "fourth", etc. only serve the purpose of non-exhaustive enumeration and description, and it should be understood that they do not constitute a closed limitation on quantity.

[0041] In a first aspect of the present application, a nitrilase mutant is provided. Compared with the wild-type nitrilase with an amino acid sequence as shown in SEQ ID NO: 2, the nitrilase mutant comprises one or more of the following amino acid mutation sites: S200F, G238M, K241T, V242Q and G245Q.

[0042] The present application performs mutation modification on the nitrilase (also known as NIT 338 enzyme) from Alcaligenes, and obtains a nitrilase mutant having the advantages of short culture time, high protein soluble expression level, high enzyme activity, and high tolerance to substrate concentration; the nitrilase mutant has high catalytic activity when used to catalyze the synthesis of nicotinic acid from 3-cyanopyridine.

[0043] It can be understood that the NCBI gene accession number of the nitrilase of Alcaligenes is WP_250756555.1; its amino acid sequence is shown in SEQ ID NO:2, and the encoding gene sequence is shown in SEQ ID NO:1.

[0044] In the present application, "S200F" refers to a mutation in which the 200th serine (Serine, abbreviated as S) is replaced by phenylalanine (Phenylalanine, abbreviated as F) in the amino acid sequence of a protein; other similar expressions in this article have similar meanings.

[0045] In some embodiments, the amino acid mutation site of the nitrilase mutant comprises S200F.

[0046] In some embodiments, the amino acid mutation site of the nitrilase mutant comprises G238M.

[0047] In some embodiments, the amino acid mutation site of the nitrilase mutant comprises K241T.

[0048] In some embodiments, the amino acid mutation site of the nitrilase mutant comprises V242Q.

[0049] In some embodiments, the amino acid mutation site of the nitrilase mutant comprises G245Q.

[0050] In some embodiments, the amino acid mutation sites of the nitrilase mutant include S200F / G238M.

[0051] In some embodiments, the amino acid mutation sites of the nitrilase mutant include S200F / V242Q.

[0052] In some embodiments, the amino acid mutation sites of the nitrilase mutant include K241T / G245Q.

[0053] In some embodiments, the amino acid mutation sites of the nitrilase mutant include V242Q / G245Q.

[0054] In some embodiments, the amino acid mutation sites of the nitrilase mutant include S200F / G238M / V242Q.

[0055] In some embodiments, the amino acid mutation sites of the nitrilase mutant include S200F / V242Q / G245Q.

[0056] In some embodiments, the amino acid mutation sites of the nitrilase mutant include S200F / G238M / V242Q / G245Q.

[0057] In some embodiments, the amino acid mutation sites of the nitrilase mutant include G238M / K241T / V242Q / G245Q.

[0058] It should be noted that in the present application, "S200F / G238M" means the simultaneous presence of S200F mutation and G238M mutation, and other identical expressions have similar meanings.

[0059] In a second aspect, the present application provides a nucleic acid fragment encoding the above-mentioned nitrilase mutant.

[0060] In a third aspect, the present application provides a recombinant vector comprising the above-mentioned nucleic acid fragment.

[0061] In some embodiments, the recombinant vector comprises a pET28a plasmid, a pET-15b plasmid, a pET-21a plasmid, a pET-22b plasmid, or a pET-26b plasmid.

[0062] In a fourth aspect, the present application provides a genetically engineered bacterium comprising the above-mentioned nucleic acid fragment or the above-mentioned recombinant vector.

[0063] In some embodiments, the genetically engineered bacterial host cell comprises Vibrio natriuresis.

[0064] Vibrio natriegens has a generation time of less than 10 minutes, making it the shortest known non-parasitic bacterium. It has a fast growth rate, a short fermentation cycle for expressing foreign proteins as a host, and can inhibit the growth of foreign bacteria without the use of antibiotics by increasing the salt concentration of the culture medium.

[0065] Using Vibrio natrii as a host cell to express the nitrilase mutant of the present application has the advantages of short culture time, high soluble protein expression, strong salt tolerance, ability to tolerate high concentration substrates, and the produced nitrilase has higher enzyme activity in the process of synthesizing nicotinic acid.

[0066] Furthermore, the genetically engineered bacteria of the present application have a high salt tolerance to both salt and substrate concentrations, and thus can increase the salt concentration in the culture medium, thereby inhibiting the growth of foreign bacteria without the use of antibiotics, reducing the risk of contamination while saving costs.

[0067] The genetically engineered bacteria constructed by the present application using Vibrio natrii grow very fast, only needing 6 hours to grow on an agar plate and only needing 3 hours to amplify in a liquid culture medium; it only takes 18 hours to construct a plasmid using the genetically engineered bacteria, which is at least 10 hours faster than Escherichia coli.

[0068] In some embodiments, the Vibrio natriegens includes Vibrio natriegens ATCC14048.

[0069] It will be appreciated that the above-mentioned Vibrionatriegens ATCC 1404 can be obtained through commercial routes.

[0070] In some embodiments, a T7 RNA polymerase expression cassette is integrated into the DNA site of the Vibrio nautilus genome.

[0071] Understandably, T7 RNA polymerase can effectively improve the transcriptional regulation efficiency of genetically engineered bacteria.

[0072] In a fifth aspect, the present application provides a method for constructing the above-mentioned genetically engineered bacteria, comprising the following steps: introducing a recombinant vector expressing the above-mentioned nitrilase mutant into the genetically engineered bacteria to be transformed, thereby constructing the genetically engineered bacteria.

[0073] In a sixth aspect, the present application provides an enzyme catalytic preparation comprising the above-mentioned nitrilase mutant and auxiliary materials.

[0074] In some embodiments, the auxiliary materials may include one or more of a precipitant, a surfactant, a cross-linking agent, and a stabilizer.

[0075] In a seventh aspect, the present application provides a method for preparing nicotinic acid, comprising the following steps:

[0076] The nitrilase mutant, the genetically engineered bacteria or the enzyme catalytic preparation is used to catalyze the substrate to synthesize nicotinic acid.

[0077] In some embodiments, the above-mentioned method for preparing niacin further includes the following step: culturing the above-mentioned genetically engineered bacteria to prepare a crude enzyme solution.

[0078] In some embodiments, in the above method for preparing niacin, the culturing step comprises:

[0079] Inducing and culturing the genetically engineered bacteria to prepare a bacterial solution;

[0080] The bacterial solution was subjected to cell disruption treatment to prepare a crude enzyme solution.

[0081] In some embodiments, the substrate comprises 3-cyanopyridine.

[0082] It can be understood that the reaction formula for synthesizing nicotinic acid using 3-cyanopyridine as a substrate and nitrilase as a catalyst is as follows: Figure 1 shown.

[0083] In some embodiments, the concentration of the substrate is 50 mM to 400 mM.

[0084] As an example, the concentration of the substrate can be 50mM, 60mM, 70mM, 80mM, 90mM, 100mM, 110mM, 120mM, 130mM, 140mM, 150mM, 160mM, 170mM, 180mM, 190mM, 200mM, 210mM, 220mM, 230mM, 240mM, 250mM, 260mM, 270mM, 280mM, 290mM, 300mM, 310mM, 320mM, 330mM, 340mM, 350mM, 360mM, 370mM, 380mM, 390mM, 400mM, or any value within the range formed by any two of the above point values.

[0085] In some embodiments, the pH condition for catalysis is 5.0-10.0.

[0086] As an example, the pH condition for catalysis can be 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, or any value within the range formed by any two of the above point values.

[0087] In some embodiments, when genetically engineered bacteria are used as catalysts, the amount of genetically engineered bacteria added to the reaction system is 1.0 g / L to 4.0 g / L based on the dry weight of the genetically engineered bacteria.

[0088] As an example, the addition amount of genetically engineered bacteria in the reaction system can be 1.0 g / L, 1.5 g / L, 2.0 g / L, 2.5 g / L, 3.0 g / L, 3.5 g / L, 4.0 g / L, or any value within the range formed by any two of the above point values.

[0089] In some embodiments, the solvent for the catalytic reaction includes water.

[0090] In some embodiments, the catalytic temperature is 25°C to 55°C.

[0091] As an example, the temperature of the catalytic reaction can be 25°C, 30°C, 35°C, 40°C, 45°C, 50°C, 55°C, or any value within the range formed by any two of the above point values.

[0092] In the above method for preparing nicotinic acid, the enzyme activity of the catalyst may be 0.5 U / mL to 15 U / mL.

[0093] The method for preparing nicotinic acid of the present application has simple product separation and purification, low cost, and an environmentally friendly production process with less pollution, which complies with the concept of green chemistry.

[0094] The present application will be further described below in conjunction with specific examples and comparative examples, but they should not be construed as limiting the scope of protection of the present application. The raw materials involved in the following specific examples, unless otherwise specified, can all be sourced from commercial sources, the instruments used, unless otherwise specified, can all be sourced from commercial sources, and the processes involved, unless otherwise specified, are all conventionally selected by those skilled in the art.

[0095] The 3-cyanopyridine, nicotinic acid and phosphate used in the examples of the present application are all commercially available analytically pure.

[0096] Example 1

[0097] (1) Construction of genetically engineered bacteria

[0098] A nitrilase from Alcaligenes was selected, and the gene encoding the nitrilase was NIT338, and the gene accession number in NCBI was WP_250756555.1; the base sequence of NIT 338 was shown in SEQ ID NO: 1, and the amino acid sequence encoded by it was shown in SEQ ID NO: 2.

[0099] SEQ ID NO:1

[0100]

[0101] SEQ ID NO:2

[0102] TQQKSQSRTVRVAAVQYAPDLETTEATLRRVLDAVAEAAAKGAQLVVFPETFIPHYPYFSAVLAPAAMGAEQNRLYENAVRIPGPVTEALSEAARRHRIVLAVGVTERDHGSLYNTQLIFDVDGSLIQKHRKISPAPHERLIWDEGDGTSIKVVESTVGRLGALTCWEH YNPLARFSLIAQHEEIHISTYIGSIFGPVFSKQTETQLMNHALESGCFVVNATAWLTDEQRARIVDDPGMQKVLTGGCMTAIIGPDGQHIVPPLTDGEGILADLDFSAITNAKRIRDSVGHYSRPDLFSLAVHSKPTPHIRAIASSETVRRDADVVVDSAVNPEQEA.

[0103] Based on protein structure analysis, the applicant found that compared with the wild type, the S200F, G238M, K241T, V242Q or G245Q mutation caused structural changes in the protein, which may affect the function of the nitrilase mutant.

[0104] In order to further verify the effect of the above mutation sites on the function of nitrilase, the amino acid sequence was converted into a nucleotide sequence by codon optimization to obtain the nucleotide sequence of NIT 338. The nucleotide sequence was fully synthesized by chemical method (Qingke Biotechnology) and integrated into the multiple cloning site (between BamH I and Hind III restriction sites) of the expression vector pET-28a (+) to obtain the recombinant plasmid pET28a-NIT 338; finally, the constructed recombinant plasmid was introduced into the Vibrio natriegens ATCC14048 host cell to construct the genetically engineered bacteria VNDX-pET28a-NIT 338 (i.e., Vibrio natriegens expressing wild-type NIT 338). Among them, Vibrio natriegens ATCC14048 can be purchased from the China Industrial Microbiological Culture Collection Administration Center.

[0105] (2) Construction of nitrilase mutants

[0106] (a) Activation of engineered bacteria and plasmid extraction

[0107] The engineered bacteria VNDX-pET28a-NIT 338 was activated and cultured using TB culture medium; specifically, the glycerol tube containing the engineered bacteria was inoculated into a test tube containing 10 mL of TB culture medium and cultured at 30°C and 200 rpm for 6 hours. After obtaining the cultured bacteria, plasmid extraction was performed according to the operating instructions of the Axygen plasmid extraction kit, and the obtained plasmid was directly used for point mutation or stored at -20°C for a long time.

[0108] TB liquid medium: peptone 12g / L, yeast powder 24g / L, NaCl 15g / L, glycerol 5% (v / v), KH 2 PO 4 2.31g / L, K 2 HPO 4 16.43g / L, dissolve in deionized water and make up to volume, sterilize at 121℃ for 20min before use. Compared with liquid culture medium, TB solid culture medium also contains 2% (w / v) agar powder.

[0109] (b) Site-directed mutagenesis

[0110] Using the plasmid extracted in the above step (a) as a template, PCR amplification was performed using the primer pairs shown in Table 1 to obtain a plasmid containing the mutation site.

[0111] Table 1

[0112] Primer name Primer number Sequence (5'-3') S200F_F SEQ ID NO:3 CCCGTATTTTTTAAGCAAACCGAGACGCAAC S200F_R SEQ ID NO:4 GTTTGCTTAAAAAATACGGGACCAAAAATCGATC G238M_F SEQ ID NO:5 GACCCTATGATGCAAAAAGTGCTGACCGG G238M_R SEQ ID NO:6 TGCATCATAGGGTCATCTACGATGCG K241T_F SEQ ID NO:7 GCATGCAAACCGTGCTGACCGGAGGATG K241T_R SEQ ID NO:8 TCAGCACGGTTTGCATGCCAGGGTCATC V242Q_F SEQ ID NO:9 TGCAAAAACAGCTGACCGGAGGATGTATG V242Q_R SEQ ID NO:10 CGGTCAGCTGTTTTTGCATGCCAGGGTCATC G245Q_F SEQ ID NO:11 CTGACCCAGGGATGTATGACTGCTATTATCGG G245Q_R SEQ ID NO:12 CATCCCTGGGTCAGCACTTTTTGCATGC S200F_F SEQ ID NO:13 CCCGTATTTTTTAAGCAAACCGAGACGCAAC S200F_R SEQ ID NO:14 GTTTGCTTAAAAAATACGGGACCAAAAATCGATC G238M_F SEQ ID NO:15 GACCCTATGATGCAAAAAGTGCTGACCGG G238M_R SEQ ID NO:16 TGCATCATAGGGTCATCTACGATGCG

[0113] In the above table, S200F_F and S200F_R as a primer pair can direct mutation to obtain a gene fragment containing the S200F mutation site, and other expressions have similar meanings.

[0114] The PCR amplification system (50 μL) included: 25 μL of DNA polymerase (Primer STAR, purchased from TaKaRa), 1 μL of upstream primer (F), 1 μL of downstream primer (R), 0.5 μL of plasmid template and ddH 2 O 22.5 μL.

[0115] The PCR amplification program was as follows: pre-denaturation at 98°C for 5 min; denaturation at 98°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 90 s, 30 cycles; post-extension at 72°C for 10 min; and storage at 4°C.

[0116] After PCR amplification, the amplified product was detected by electrophoresis using 0.9% agarose gel, and the result showed that the amplified product was a single band with a target band size of about 1500 bp. The amplified product was purified and recovered according to the instructions of the DNA recovery and purification kit (AxyPrep DNA gel recovery kit).

[0117] (c) Construction of mutant engineered bacteria

[0118] The purified gene fragment was digested with DpnI to remove the template, and then recombined with a recombinase (ClonExpress II one-step cloning kit, purchased from Vazyme); the recombinant product was transformed into Vibrio nativus competent cells, plated, and single colonies were picked to TB liquid culture, and the PCR method was used to identify the successfully constructed positive transformants, and the correctness of the mutation site was verified by sequencing. After verification, it was added to a final concentration of 20% sterile glycerol, labeled, and stored at -80°C for later use.

[0119] Based on the above steps, the following 13 mutations or mutation combinations were constructed: S200F, G238M, K241T, V242Q, G245Q, S200F / G238M, S200F / V242Q, K241T / G245Q, V242Q / G245Q, S200F / G238M / V242Q, S200F / V242Q / G245Q, S200F / G238M / V242Q / G245Q, G238M / K241T / V242Q / G245Q. It should be noted that "S200F / G238M" means that S200F and G238M mutations exist at the same time, and other expressions have similar meanings.

[0120] (3) Bacterial culture and whole cell preparation

[0121] (a) Culture of bacteria

[0122] The 13 mutant engineered bacteria and the engineered bacteria expressing the wild type of NIT 338 prepared above were activated by streaking on plates, and single colonies were inoculated into 5 mL TB liquid culture medium containing 200 μg / mL kanamycin and cultured at 30°C with shaking until OD 600 When the inoculum reached about 0.6, the inoculum was transferred to 50 mL of fresh TB liquid medium containing 200 μg / mL Kan antibiotic at a 1% (v / v) inoculum and cultured at 30°C with shaking until the OD 600 When the pH value reached about 0.6, IPTG was added to a final concentration of 0.3 mM, and the culture was induced at 18°C ​​for 10 h. After the culture was completed, the culture solution was centrifuged at 10,000 rpm for 5 min, the supernatant was discarded, the cells were collected, and the cells were washed twice with a phosphate buffer solution with a concentration of 10 mM and a pH value of 7.4; and stored in a -80°C ultra-low temperature refrigerator for later use.

[0123] (b) Preparation of whole cells and crude enzyme solution

[0124] The collected cells after the culture was completed were suspended twice in a phosphate buffer with a concentration of 10 mM and a pH of 7.4, and the whole cells of the engineered Vibrio nitrilase-containing cells were resuspended. The cells were ultrasonically disrupted 30 times at a power of 400 W, with each ultrasonication lasting 3 seconds and a rest period of 7 seconds. The disrupted liquid was centrifuged at 12000 rpm and 4°C for 10 minutes to remove the precipitate, and the supernatant obtained was a crude enzyme solution containing nitrilase (10 g wet cells / L).

[0125] (4) Soluble expression of nitrilase expressed in different hosts

[0126] (a) Reagent preparation

[0127] SDS-PAGE electrophoresis buffer: Dissolve one pack of Tris-MOPS-SDS electrophoresis buffer powder (purchased from GenScript Biotech Co., Ltd.) in 1 L of deionized water and mix well for later use;

[0128] Protein gel staining solution: weigh 2.5g Coomassie Brilliant Blue R-250, add 454mL anhydrous ethanol and 46mL glacial acetic acid, and finally dilute to 1L with deionized water. Mix well and filter, then store the staining solution at room temperature away from light;

[0129] Protein gel destaining solution: 380 mL deionized water, 70 mL anhydrous ethanol and 50 mL glacial acetic acid, mix well and store at room temperature.

[0130] (b) SDS-PAGE protein electrophoresis

[0131] Crude enzyme solution A of engineered bacteria expressing wild-type NIT 338 was prepared according to the method described in step (3) (a), and crude enzyme solution B prepared by engineering bacteria expressing wild-type NIT 338 using Escherichia coli BL21 (DE3) as a host was used as a comparison.

[0132] Take 60μL of protein samples of crude enzyme solution A and B respectively, add 20μL of 4×Protein SDS PAGE Loading Buffer, mix well and denature at 100℃ for 10min. Remove the bottom seal of the pre-set protein gel and put it into the electrophoresis tank, pour enough electrophoresis buffer (about 1L), and carefully pull out the comb to avoid damaging the gel hole. Add 10μL of protein sample or protein marker to the loading well. Turn on the power and perform protein electrophoresis at 120V voltage. Stop electrophoresis when the bromophenol blue indicator just leaves the bottom of the gel. Take out the electrophoresis gel, remove the plastic shell, put it in the dye tank filled with staining solution, heat it in a microwave for 60s, and stain it on a reciprocating decolorization shaker for 30min. Then transfer the electrophoresis gel to the decolorization solution and decolorize it several times until the background color is completely removed. Use a gel imaging system to observe the electrophoresis bands.

[0133] The results are as follows Figure 2 As shown, when using Vibrio nautilus as the host bacteria, the soluble expression of nitrilase accounts for 95%, which is much higher than the soluble expression proportion (40%) when using Escherichia coli as the host, indicating that using Vibrio nautilus as the host is more conducive to whole-cell catalysis. Figure 2 Here, "Vn" indicates the sample prepared with Vibrio natrii as the host bacterium, "BL21" indicates the sample prepared with Escherichia coli BL21 as the host bacterium, "supernatant" refers to the supernatant (i.e., crude enzyme solution) collected after the whole cell culture fluid is crushed, and "precipitate" refers to the precipitate discarded after the whole cell culture fluid is crushed.

[0134] (5) Enzyme activity of nitrilase expressed in different hosts

[0135] According to the method described in step (3), the Escherichia coli engineered bacteria expressing the wild type of NIT 338 are cultured to obtain whole cells and crude enzyme solution, and nicotinic acid is synthesized by using the Escherichia coli engineered bacteria expressing the wild type of NIT 338 and the Vibrio natriuresis engineered bacteria expressing the wild type of NIT 338, respectively.

[0136] 1mL of the synthetic system contains 3-cyanopyridine with a final concentration of 50mM and 250μL of crude enzyme solution. The reaction temperature is controlled at 30°C, pH value is 7.4, and rotation speed is 700rpm by a metal bath, and the reaction is carried out for 5min. The product concentration is determined by high performance liquid chromatography (HPLC), and the enzyme activity of different engineered bacteria at different substrate concentrations is calculated according to the product concentration. The results are shown in Table 2; the enzyme activity of the nitrilase produced by the Vibrio nautilus host is 1.6 times that of the Escherichia coli host, indicating that the use of Vibrio nautilus as a host cell can produce a nitrilase with higher enzyme activity.

[0137] The HPLC conditions include: SIL-20A Shimadzu high performance liquid chromatograph, chromatographic column QS-C18 Plus, catalog number: 05BM046250, QS-C18 Plus, 5um, 4.6*250mm, column temperature 30°C, flow rate 1mL / min, UV detection wavelength 260nm, mobile phase acetonitrile / 0.25% phosphoric acid (9:1). The liquid chromatographic spectrum is shown in the figure below. Figure 3 As shown, the peak at 3.424 min is 3-cyanopyridine, and the peak at 12.482 min is nicotinic acid.

[0138] The enzyme activity in this application is calculated as follows: crude enzyme activity (U / mL) = (C*V*n) / (T*v);

[0139] Wherein, C is the product concentration, mmol / L; V is the reaction volume; n is the dilution factor; T is the reaction time; and v is the volume of the enzyme solution added.

[0140] Table 2

[0141] Host species Escherichia coli Vibrio nautilus Enzyme activity 3.59 U / mL 5.80U / mL

[0142] (6) Residual enzyme activity of nitrilase expressed in different hosts at different substrate concentrations

[0143] According to the method described in step (3), the Escherichia coli engineered bacteria expressing the wild type of NIT 338 are cultured to obtain whole cells and crude enzyme solution, and the Escherichia coli engineered bacteria expressing the wild type of NIT 338 and the Vibrio natriuresis engineered bacteria expressing the wild type of NIT 338 are used to synthesize nicotinic acid at different substrate concentrations.

[0144] The above two whole cells were soaked in 3-cyanopyridine with substrate concentrations of 100mM, 200mM, 300mM, and 400mM for 1h, and then centrifuged at 4000rpm, 4°C, and 15min to obtain the bacteria. Specifically, 1mL of the synthetic system contains 3-cyanopyridine with a final concentration of 100mM / 200mM / 300mM / 400mM and 250μL of crude enzyme solution; the reaction temperature is controlled to 30°C by a metal bath, the pH value is 7.4, the speed is 700rpm, the reaction is 5min, the product concentration is determined by liquid phase, and the enzyme activity of different host engineering bacteria at different substrate concentrations is calculated according to the product concentration. The results are shown in Table 3.

[0145] Table 3

[0146] Substrate concentration Escherichia coli enzyme activity Vibrio nautilus enzyme activity 100mM 3.5 U / mL 5.5U / mL 200mM 1.2 U / mL 2.9 U / mL 300mM 1.0U / mL 1.7 U / mL 400mM 0.8U / mL 1.3 U / mL

[0147] As can be seen from the above table, as the substrate concentration increases from 50 mM to 400 mM, the enzymatic activity of nitrilase gradually decreases, but compared with Escherichia coli, the nitrilase produced by Vibrio natrii has a higher tolerance to substrate concentration.

[0148] (7) Conversion rate of different mutants at different substrate concentrations for 8 h

[0149] According to the method described in the above step (3), Escherichia coli and Vibrio natriuresis expressing wild-type or mutant NIT 338 are cultured respectively, and the above-mentioned engineered bacteria are used to catalyze 50mM and 400mM substrates to produce nicotinic acid respectively.

[0150] The 40 mL synthesis system contained 3-cyanopyridine with a final concentration of 50 mM (or 400 mM) and 10 mL crude enzyme solution. The reaction temperature was controlled at 30°C, pH value was 7.4, and the speed was 300 rpm by a water bath. The reaction was carried out for 8 h. The product concentration was determined by liquid phase, and the conversion rate of different engineered bacteria at different substrate concentrations for 8 h was calculated based on the product concentration. The results are shown in Tables 4 and 5.

[0151] Table 4

[0152]

[0153] Table 5

[0154]

[0155]

[0156] It can be seen from Tables 4 and 5 that, compared with the wild type, the nitrilase mutant provided in the present application not only has higher enzyme activity in the reaction of catalyzing 3-cyanopyridine to nicotinic acid, but also can achieve a higher conversion rate in a shorter reaction time.

[0157] In the test of different substrate concentrations, the enzyme activity of the nitrilase mutant was significantly improved, and when the concentration of 3-cyanopyridine increased from 200mM to 400mM, the enzyme activity of the mutant decreased very little, while also maintaining a high conversion rate, indicating that the nitrilase mutant of the present application has a higher tolerance to the substrate than the wild-type nitrilase.

[0158] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0159] The above-mentioned embodiments only express several implementation methods of the present application, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present application, and these all belong to the protection scope of the present application. Therefore, the protection scope of the present application shall be subject to the attached claims.

Claims

1. A nitrilase mutant, characterized in that Compared to the wild-type nitrilase having an amino acid sequence as shown in SEQ ID NO: 2, the nitrilase mutant comprises one or more of the following amino acid mutation sites: S200F, G238M, K241T, V242Q and G245Q.

2. The nitrilase mutant according to claim 1, characterized in that The amino acid mutation sites of the nitrilase mutant include one or more of the following combinations: (1) S200F / G238M, (2) S200F / V242Q, (3) K241T / G245Q, and (4) V242Q / G245Q; Alternatively, the amino acid mutation sites of the nitrilase mutant include one or more of the following combinations: (5) S200F / G238M / V242Q, (6) S200F / V242Q / G245Q; Alternatively, the amino acid mutation sites of the nitrilase mutant include one or more of the following combinations: (7) S200F / G238M / V242Q / G245Q; (8) G238M / K241T / V242Q / G245Q.

3. A nucleic acid fragment, characterized in that The nucleic acid fragment encodes the nitrilase mutant according to any one of claims 1 to 2.

4. A recombinant vector, characterized in that: The recombinant vector comprises the nucleic acid fragment according to claim 3.

5. A genetically engineered bacterium, characterized in that: The genetically engineered bacteria comprises the nucleic acid fragment according to claim 3 or the recombinant vector according to claim 4.

6. The genetically engineered bacterium according to claim 5, characterized in that: The host cell of the genetically engineered bacteria includes Vibrio natriuresis; Optionally, the Vibrio natriegens includes Vibrio natriegens ATCC14048.

7. A method for constructing a genetically engineered bacterium, characterized in that: The steps include: The recombinant vector expressing the nitrilase mutant according to any one of claims 1 to 2 is introduced into the genetically engineered bacteria to be transformed to construct the genetically engineered bacteria.

8. An enzyme catalytic preparation, characterized in that The invention comprises the nitrilase mutant according to any one of claims 1 to 2 and auxiliary materials.

9. A method for preparing nicotinic acid, characterized in that: The steps include: The nitrilase mutant according to any one of claims 1 to 2, the genetically engineered bacteria according to any one of claims 5 to 6, or the enzyme catalytic preparation according to claim 8 is used to catalyze the synthesis of nicotinic acid from the substrate.

10. The method for preparing nicotinic acid according to claim 9, characterized in that: The preparation method meets at least one of the following characteristics: (1) The substrate includes 3-cyanopyridine; (2) The concentration of the substrate is 50 mM to 400 mM; (3) the pH condition of the catalysis is 5.0-10.0; and (4) the reaction temperature of the catalysis is 25°C-55°C.

Images