Promoters for high expression of entomopathogenic fungi in the hemolymph of insects and use thereof

Abstract

The application provides a promoter for controlling entomopathogenic fungi to highly express in the hemocoel of insects and application thereof. The promoter is specifically expressed in the hyphal stage, that is, the target gene can be driven to be highly expressed only after entering the body of the insect. The application not only provides a new selection for functional gene research and genetic engineering breeding of the pathogenic fungi, but also can effectively ensure the environmental safety of the genetically engineered strain, and eliminate possible factors of the genetically engineered strain affecting the environment.

Description

Technical Field

[0001] This invention belongs to the field of agricultural science, and more specifically, this invention relates to promoters for controlling the high expression of insecticidal pathogenic fungi in the hemocoel of insects and their applications. Background Technology

[0002] According to the Food and Agriculture Organization of the United Nations (FAO), crop pests cause significant global food losses annually. Chemical control is an important measure in pest management and plays a positive role in ensuring agricultural production. However, the problems caused by the large-scale use of chemical pesticides are becoming increasingly prominent, including pesticide residues, non-target organisms, pest resistance and re-emergence, ecological damage, and threats to human health. With increasing emphasis on the living environment, calls for reducing the use of chemical pesticides are growing louder, making the research, development, and use of safe and environmentally friendly biological pesticides highly anticipated. Entomopathogenic fungi, with their advantages of no residue, ease of mass production, safety against non-target organisms, and low likelihood of host resistance, have been developed into biological pesticides and are widely used in the control of agricultural and forestry pests as well as urban sanitation insects.

[0003] Unlike entomopathogenic bacteria, entomopathogenic fungi do not ingest the host but directly invade it through the exoskeleton or epidermis. Their infection process involves several steps: conidia attach to the insect's body wall and germinate, forming infection structures (such as appressoria); hyphae penetrate the insect's body wall and proliferate rapidly within the insect as entomopathogenic cells, causing disease. Because insects have evolved highly efficient immune defense systems to combat fungal infection through long-term interaction and competition with pathogens, the pathogenicity of fungi is relatively slow, which limits the widespread application of fungal insecticides. Therefore, many studies have genetically modified strains by overexpressing exogenous toxins or virulence proteins to enhance the insecticidal efficacy of biocontrol fungi. Genetically modified strains have shown great potential in the control of agricultural and urban pests, demonstrating the broad application prospects of entomopathogenic fungi in the field of biocontrol. Therefore, utilizing genetic engineering to regulate the expression of target genes in entomopathogenic fungi is of great significance for the widespread application of entomopathogenic fungi. However, in the study of genetically modified strains of entomopathogenic fungi, most of the research focuses on constitutive promoters driving genes. Since constitutive expression promoters cannot effectively control the spatiotemporal expression of target genes, they can easily lead to excessive consumption of intracellular substances and energy, which can have adverse effects on the growth of organisms and even the environment. Therefore, there are certain shortcomings in practical operation.

[0004] Therefore, there is an urgent need to develop tissue-specific regulatory molecules (such as promoters) with high expression levels to genetically improve insecticidal fungi. Summary of the Invention

[0005] The purpose of this invention is to provide a promoter for controlling the high expression of insecticidal pathogenic fungi in the insect hemocoel and its application.

[0006] In a first aspect of the invention, the use of the promoter of the MAA_06769 gene is provided for use as a specific expression promoter to guide the expression of a target gene after the insect pathogenic fungus enters the insect hemocoel.

[0007] In another aspect of the present invention, a method is provided for expressing a target gene after an entomopathogenic fungus enters the hemocoel of an insect, comprising: (a) operatively linking the target gene to the promoter of the MAA_06769 gene to form an expression cassette; introducing the expression cassette into the entomopathogenic fungus; and (b) infecting an insect with the entomopathogenic fungus described in (a), wherein the target gene is expressed after the fungus enters the hemocoel of the insect.

[0008] In one or more embodiments, the insect is an insect susceptible to the insect pathogenic fungus; preferably, the insect includes (but is not limited to): Lepidoptera, Diptera, Homoptera, Orthoptera, Coleoptera, Hemiptera, and Hymenoptera.

[0009] In one or more embodiments, the entomopathogenic fungus is a fungus that infects insects; preferably, it includes fungi of the genus *Metarhizium* and fungi of the genus *Beauveria bassiana*.

[0010] In one or more embodiments, the pathogenic fungus includes its spores.

[0011] In one or more embodiments, the pathogenic fungus includes worm-bacterial bodies formed therefrom.

[0012] In another aspect of the present invention, an isolated nucleic acid (promoter of the MAA_06769 gene) is provided, comprising nucleic acids selected from the group consisting of: (1) a nucleic acid having SEQ ID NO:1 or containing the nucleotide sequence shown in positions 593 to 911 (-1 bp to -319 bp of the MAA_06769 gene); (2) a nucleic acid having more than 80% (preferably more than 85% or 90%, more preferably more than 95%) nucleotide sequence similarity to (1), having a conserved TATA box (TATAAAA) and CAAT box (CAAT), and having the function of guiding the expression of the target gene after the insect pathogenic fungus enters the insect hemocoel; (3) a nucleic acid capable of hybridizing with the nucleotide sequence of (1) under stringent conditions, having a conserved TATA box and CAAT box, and having the function of guiding the expression of the target gene after the insect pathogenic fungus enters the insect hemocoel; preferably, the nucleic acid also has a conserved GC box (GGGCGG).

[0013] In one or more embodiments, the nucleic acid comprises a nucleic acid selected from: the nucleic acid of positions 593 to 911 (-1bp to -319bp of the MAA_06769 gene; P319) in SEQ ID NO:1; the nucleic acid of positions 295 to 911 (-1bp to -617bp of the MAA_06769 gene; P617) in SEQ ID NO:1; and the nucleic acid of positions 1 to 911 (-1bp to -911bp of the MAA_06769 gene; P911) in SEQ ID NO:1.

[0014] In another aspect of the invention, an expression construct (such as an expression cassette or expression vector) is provided, containing the aforementioned nucleic acid as a promoter element.

[0015] In one or more embodiments, the expression construct further contains a target gene operatively linked to the promoter element.

[0016] In one or more embodiments, the target gene includes (but is not limited to): a functional gene (a gene encoding a protein with a specific function) and a structural gene.

[0017] In one or more embodiments, the functional gene includes (but is not limited to): reporter genes, genes for proteins that reduce insect survival ability, such as insecticidal toxin genes, genes for insect metabolic and immunosuppressive proteins; interfering molecules (such as shRNA, dsRNA, etc.) that target and interfere with essential insect genes; for example, the functional gene includes a perforator toxin protein gene, more specifically, hemolysin II.

[0018] In one or more embodiments, the reporter gene includes, but is not limited to, fluorescent protein-encoding genes, luciferase genes, or galactosidase genes.

[0019] In one or more embodiments, the fluorescent protein includes, but is not limited to: green fluorescent protein, yellow fluorescent protein, red fluorescent protein, cyan fluorescent protein, blue fluorescent protein, etc., or their enhanced proteins (such as enhanced green fluorescent protein).

[0020] In one or more embodiments, the target gene is located downstream of the promoter element and is spaced less than 2000 bp from the promoter.

[0021] In one or more embodiments, the target gene is located downstream of the promoter element and is spaced less than 1000 bp from the promoter; more preferably less than 500 bp, such as less than 200 bp, less than 100 bp, less than 50 bp, less than 30 bp, less than 20 bp, less than 10 bp, or no space.

[0022] In one or more embodiments, the expression construct includes an expression vector.

[0023] In one or more embodiments, the target gene is an exogenous gene.

[0024] In another aspect of the invention, a genetically engineered cell (strain cell) is provided, which contains any of the expression constructs described above; or the nucleic acid described above is integrated into its genome as a promoter element; preferably, a target gene is also integrated into its genome, the target gene being operatively linked to the promoter element.

[0025] In one or more embodiments, the cells are entomopathogenic fungi;

[0026] In another aspect of the present invention, a method for controlling insects (harmful insects) is provided, comprising: (1) providing an insect pathogenic fungus, the insect pathogenic fungus being able to infect the insect and enter its hemocoel using the insect as a host; (2) introducing the expression construct of claim 7 into the insect pathogenic fungus; and (3) applying the insect pathogenic fungus to the insect, thereby infecting the insect and entering its hemocoel, thereby inhibiting the insect.

[0027] Other aspects of the invention will be apparent to those skilled in the art from the disclosure herein. Attached Figure Description

[0028] Figure 1 This invention relates to the construction of the pMAA_06769::EGFP eukaryotic expression vector. ptrpc is the promoter of the tryptophan synthesis gene c of Aspergillus nidulans; Bar is the resistance gene for screening the drug glyphosate; EGFP is the gene for enhancing green fluorescent protein; and P319 / P617 / P911 are MAA_06769 promoters of different lengths.

[0029] Figure 2 Schematic diagram of the expression pattern of the MAA_06769 gene. Spores: Conidia grown on PDA plates for 14 days; Hyphae: Hyphae cultured on SDB for 3 days; Appressoria: Appressoria formed by induction of black soldier fly wings for 30 hours. Insect-fungal cells: Insect-fungal cells purified from *Metarhizium anisopliae*; Infecting fruit flies: *Metarhizium anisopliae* M23 (1x10⁻¹) 6 Fruit fly samples infected for 72 hours (number of flies / mL).

[0030] Figure 3 The expression analysis of MAA_06769 in Drosophila melanogaster during Metarhizium anisopliae infection.

[0031] Figure 4 A representative image of EGFP fluorescence detection at different developmental stages of Metarhizium anisopliae pMAA_06769::EGFP strain.

[0032] Figure 5 qPCR quantitative analysis of EGFP expression in Drosophila infected with Metarhizium anisopliae pMAA_06769::EGFP strain for 72 h was performed. Wild-type strain M23 was used as a negative control, and constitutively EGFP-expressing strain ptef::EGFP was used as a positive control. p319::EGFP, p617::EGFP, and p911::EGFP represent strains with different MAA_06769 promoter lengths fused to EGFP.

[0033] Figure 6 A representative figure shows the quantitative analysis of EGFP expression in *Metarhizium anisopliae* pMAA_06769::EGFP strain induced by infection with *Metarhizium anisopliae*. Wild-type strain M23 was used as a negative control, and constitutively EGFP-expressing strain ptef::EGFP was used as a positive control.

[0034] Figure 7 Construction of the pMAA_06769::HlyII eukaryotic expression vector. ptrpc is the promoter of the tryptophan synthesis gene c of Aspergillus nidulans; Bar is the resistance gene for glyphosate screening; HlyII is the hemolysin II protein gene; Mcl1(sp): the signal peptide sequence of Mcl1, which guides the secretion of HlyII into the extracellular space. P319 / P617 / are promoters of different lengths of MAA_06769.

[0035] Figure 8 Quantitative PCR validation of HlyII overexpressing strains. A. HlyII gene expression analysis of P319::HlyII overexpressing strains; B. HlyII gene expression analysis of P617::HlyII overexpressing strains.

[0036] Figure 9 Survival analysis of Drosophila infected with HlyII overexpressing strains. A. Survival curve of Drosophila infected with P319::HlyII overexpressing strains; B. Median lethal time (LT) of Drosophila infected with P319::HlyII overexpressing strains. 50 Statistical analysis; C. Survival curve of Drosophila infected with P617::HlyII overexpressing strain; D. Median lethal time (LT) of Drosophila infected with P617::HlyII overexpressing strain. 50 Statistical analysis. Detailed Implementation

[0037] The time it takes for entomopathogenic fungi to knock out insects is primarily determined by the duration of the immune battle between the fungus and the insect's immune system after the fungus enters the insect's hemocoel. Genetic engineering can be used to modify entomopathogenic fungi, enhancing their adaptation to the host environment, promoting their proliferation within the insect's hemocoel, and thus increasing their virulence. Through in-depth research, the inventors have, for the first time, revealed a promoter that controls the high expression (specific expression) of insecticidal pathogenic fungi in the insect's hemocoel. This promoter is specifically expressed during the fungal stage, meaning it drives the target gene to be efficiently expressed only after entering the insect (during the host infection stage). This invention not only provides new options for functional gene research and genetic engineering breeding of pathogenic fungi but also effectively ensures the environmental safety of genetically engineered strains, eliminating concerns about the potential environmental impact of genetically engineered strains. It has significant value for the application of entomopathogenic fungi.

[0038] the term

[0039] In this invention, "insect-pathogenic fungi" and "entomopathogenic fungi" can be used interchangeably.

[0040] As used in this invention, "entomopathogenic fungi" refers to a class of fungi whose cells, genes, or gene products, or their progeny (such as spores), can be used to reduce harmful organisms. Generally, the "entomopathogenic fungi" are fungi selected from those with the following characteristics: (a) capable of parasitizing the surface or interior of insects, and (b) capable of infecting and killing insects; preferably, they are a class of entomopathogenic fungi capable of infecting and parasitizing insects. For example, *Metarhizium anisopliae* and *Beauveria bassiana*, as entomopathogenic fungi, can penetrate the insect's surface, enter the hemocoel, inhibit host immunity and proliferation, kill the insect, and then produce spores on the insect's surface for the next round of infection.

[0041] As used in this invention, the "entomopathogenic fungus" is also known as "entomopathogenic fungus," which refers to fungi that can invade and parasitize insects, causing them to become diseased.

[0042] As used in this invention, the terms "host" and "host organism" are used interchangeably and refer to insects that can be infected by the insect pathogenic fungi.

[0043] As used herein, a “promoter” or “promoter region” refers to a nucleic acid sequence that is typically located upstream (5' end) of the coding sequence of a target gene and guides the transcription of the nucleic acid sequence into mRNA. Generally, a promoter or promoter region provides recognition sites for RNA polymerase and other factors necessary for proper transcription initiation. In this document, the promoter or promoter region includes variants of the promoter, obtained through insertion or deletion of regulatory regions, random or site-directed mutagenesis, etc.

[0044] As used herein, the term "specific expression" refers to the expression of a target gene at a specific time and / or in a specific tissue. The promoter for "specific expression" may include "spatiotemporally specific expression," "organ-specific expression," or "tissue-specific expression" promoters. Under the regulation of these promoters, genes are often expressed only at certain specific stages or in specific organs or tissues. In this invention, the promoter is the insect hemocoel-specific expression promoter.

[0045] Generally, a promoter is considered organ- or tissue-specific if its mRNA is expressed in a tissue or organ at a level that is at least 5 times higher, preferably at least 10 times higher, more preferably at least 100 times higher, and even more preferably at least 1000 times higher than in other tissues or organs.

[0046] As used herein, "target gene" and "target gene" are used interchangeably and refer to genes that can be expressed under the guidance of the promoters of this invention. Suitable target genes include, but are not limited to, genes related to improving plant quality, traits, or metabolism.

[0047] As used in this article, "isolated" means that a substance has been separated from its original environment (in the case of a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in their natural state within living cells are not isolated and purified, but the same polynucleotides or polypeptides are isolated and purified if they are separated from other substances present in their natural state.

[0048] As used herein, “operationally linked” or “operationally connected” refers to a functional spatial arrangement of two or more nucleic acid regions or nucleic acid sequences. For example, a promoter region is placed at a specific position relative to the nucleic acid sequence of a target gene, such that transcription of the nucleic acid sequence is guided by the promoter region, thereby “operationally linked” to the nucleic acid sequence.

[0049] As used in this article, "exogenous" or "heterogeneous" refers to the relationship between two or more nucleic acid or protein sequences from different sources. For example, if the combination of a promoter and a target gene sequence is not naturally occurring, then the promoter is exogenous to the target gene. A particular sequence is "exogenous" to the cell or organism into which it is inserted.

[0050] Specific promoters and their directed gene expression

[0051] This invention provides a nucleic acid (pMAA_06769 gene promoter) that enables the expression of a target gene after the entomopathogenic fungus enters the hemocoel of an insect. The wild-type promoter is derived from the entomopathogenic fungus *Metarhizium anisopliae*, and this invention develops a promoter for entomopathogenic fungal cell-specific and highly efficient expression.

[0052] The nucleic acid has a sequence selected from the group consisting of: (1) a nucleic acid having SEQ ID NO:1 or containing the nucleotide sequence shown in positions 593 to 911 (-1 bp to -319 bp of the MAA_06769 gene); (2) a nucleic acid having more than 80% (preferably more than 85% or 90%, more preferably more than 95%) identity with the nucleotide sequence of (1) and having the function of guiding the expression of the target gene after the insect pathogenic fungus enters the insect hemocoel; (3) a nucleic acid that can hybridize with the nucleotide sequence of (1) under strict conditions and has the function of guiding the expression of the target gene after the insect pathogenic fungus enters the insect hemocoel.

[0053] The promoter sequence described in this invention contains conserved TATA box and CAAT box sequences; preferably, the nucleic acid also has a conserved GC box.

[0054] In this invention, the promoter is an insect hemocoel-specific expression promoter. It can be described as a spatiotemporally specific expression promoter, possessing spatiotemporal characteristics, and specifically expressed after pathogenic fungi infect the insect (entering the insect hemocoel); it can also be described as an organ or tissue-specific expression promoter, wherein the organ or tissue is the insect hemocoel.

[0055] The MAA_06769 gene promoter of this invention is active at -1bp to -319bp, -1bp to -617bp, and -1bp to -911bp before the translation initiation site, and its effect is to achieve specific and efficient expression in insect and fungal cells.

[0056] According to exemplary results from embodiments of the present invention, the MAA_06769 promoters P319, P617, and P911 can all be used. The appropriate choice can be made based on the target gene. For example, if the target gene is large, P617 or P911 can be used.

[0057] Hybridization of polynucleotides is a technique well known to those skilled in the art, and the hybridization characteristics of a particular pair of nucleic acids indicate their similarity or identity. Therefore, this invention also relates to polynucleotides that hybridize with the aforementioned specified nucleotide sequences and have at least 80%, preferably at least 85%, more preferably at least 90% (e.g., 92%, 95%, 96%, 97%, 98%, or 99%) identity between the two sequences. This invention particularly relates to polynucleotides that hybridize with the polynucleotides described herein under stringent conditions. “Identity” refers to the level of similarity (i.e., sequence homology, similarity, or identity) between two or more nucleic acids according to the percentage of positions they are identical.

[0058] “Strict conditions” refer to: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2×SSC, 0.1% SDS, 60℃; or (2) the addition of a denaturing agent during hybridization, such as 50% (v / v) formamide, 0.1% fetal bovine serum / 0.1% Ficoll, 42℃, etc.; or (3) hybridization only occurs when the similarity between the two sequences is at least 80%, preferably 85%, 90%, 92%, 95%, 92%, or 99%. Furthermore, hybridizable polynucleotides also have the function of guiding the specific expression of the target gene in the insect hemocoel.

[0059] The promoter of this invention can be operatively linked to a target gene, which can be exogenous (heterologous) relative to the promoter. There are no particular limitations on the nucleic acid sequence of the target gene; however, genes requiring strong entomological specificity for expression are preferred, such as functional genes (genes encoding proteins with specific functions) and structural genes.

[0060] Suitable target genes include, but are not limited to: reporter genes; genes for proteins that reduce insect survival ability, such as insecticidal toxin genes; genes for insect metabolic and immunosuppressive proteins; interfering molecules that target and interfere with essential insect genes (such as shRNA, dsRNA, etc.); for example, the functional genes include perforator protein genes, more specifically, hemolysin II. The target genes can be modified to produce various desired or improved properties.

[0061] Any of the aforementioned promoters and / or target gene sequences may be included in the expression construct (recombinant vector).

[0062] In one embodiment, the recombinant vector includes the promoter of the present invention, downstream of which is a multiple cloning site or at least one restriction enzyme site. When it is necessary to express the target gene, the target gene is ligated into a suitable multiple cloning site or restriction enzyme site, thereby operatively linking the target gene to the promoter.

[0063] Alternatively, the recombinant vector comprises (from 5' to 3' direction): a promoter to guide the transcription of the target gene, and the target gene. If desired, the recombinant vector may also include a 3' transcription terminator, a 3' polynucleotide signal, other untranslated nucleic acid sequences, transport and target nucleic acid sequences, resistance selection markers, enhancers, or operators.

[0064] Methods for preparing recombinant vectors are well known in the art. The term "recombinant expression vector" refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses, or other vectors well known in the art. In short, any plasmid and vector can be used as long as it can replicate and remain stable in the host.

[0065] Methods well known to those skilled in the art can be used to construct expression vectors containing the promoter and / or target gene sequence described in this invention. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.

[0066] In addition, the expression vector preferably contains one or more selective marker genes to provide phenotypic traits for selecting transformed cells, such as dihydrofolate reductase, neomycin resistance, hygromycin resistance, and green fluorescent protein (GFP).

[0067] In addition to the promoter of this invention, the recombinant vector may also contain one or more other promoters. These other promoters are, for example, tissue-specific, constitutive, or inducible promoters. Examples include mannitol synthase-containing cauliflower mosaic virus 19S and 35S (CaMV19S, CaMV35S), enhanced CaMV, and tobacco RB7.

[0068] A vector containing the aforementioned suitable promoter and target gene can be used to transform suitable cells to enable them to express proteins. Considering the characteristics of the promoter, the cells are preferably insecticidal fungal cells.

[0069] The entomopathogenic fungi described in this invention are fungi that can parasitize insect hosts and thus inhibit the insect hosts, or produce metabolic products that cause disease in the insect hosts.

[0070] Insect pathogenic fungi and their modification

[0071] Various entomopathogenic fungi can be used in this invention, provided that they can transform expression constructs (such as expression vectors) containing the promoter of this invention and a target gene operatively linked to the promoter element; and that they can parasitize a host or influence the host with their metabolites.

[0072] The entomopathogenic fungus carrying the expression construct (referred to as the modified fungus or recombinant fungus) can be applied to the insect, infecting it and entering its hemocoel, thereby inhibiting the insect at a specific time. Therefore, this promoter can be used for genetic modification of entomopathogenic fungi, adding a controllable switch to the expression of target genes. It can regulate gene expression after entry into the host, effectively ensuring the environmental safety of genetically engineered strains and eliminating concerns about the potential environmental impact of genetically engineered strains.

[0073] The insects involved in this invention are generally hosts / parasites of the entomopathogenic fungi described herein. These insects include naturally occurring insects susceptible to infection by the entomopathogenic fungi, as well as some insects that have developed drug resistance based on their natural habitat. In a preferred embodiment, the insects include: Homoptera, Orthoptera, Lepidoptera, Diptera, Coleoptera, Hemiptera, Hymenoptera, etc. Since these insects themselves fall within the broad-spectrum insecticidal range of wild-type *Metarhizium anisopliae* / *Beauveria bassiana*, it is understood that this invention can also be broadly applied to these insects.

[0074] In some preferred embodiments, the entomopathogenic fungus is an entomopathogenic fungus. In some relatively specific preferred embodiments, the entomopathogenic fungus includes fungi selected from the group consisting of: *Metarhizium anisopliae*, *Beauveria bassiana*, *Polytrichum tomentosa*, *Verticillium chrysogenum*, *Paecilomyces pulvinus*, *Paecilomyces lilacinus*, *Paecilomyces ciliata*, *Paecilomyces fumigatus*, *Trichoderma spp.*, *Trichoderma spp.*, *Cladosporium fusilli*, *Nomura fusilli*, *Chaetoceros macrocarpa*, and *Pythium guiyangense*.

[0075] Metarhizium anisopliae belongs to the kingdom Fungi, phylum Ascomycota, class Sordariomycetes, order Hypocreales, and family Clavicipitaceae. It is a broad-spectrum entomopathogenic fungus that parasitizes approximately 200 species of insects across multiple orders and families, including mites. It induces green muscardine disease in insects. The colonies of Metarhizium anisopliae are fluffy or cottony, initially white, turning green when spores are produced, hence the name "green muscardine." Metarhizium anisopliae invades insects via spore germination, multiplies within the insect, and produces toxins, leading to insect death. It is not toxic to plants. The spores formed on the surface of dead insects can be released and reinfect other healthy insects, creating repeated infections within the insect population and causing death within a certain timeframe. Metarhizium anisopliae infects insects by first attaching conidia to the host's surface. After germination, the conidia produce hyphae, which invade the insect's body through mechanical force and enzymatic decomposition. The fungus secretes toxins that paralyze or kill the insect, eventually producing a large amount of mycelium and conidia. Common hosts include scarab beetles, weevils, wireworms, lepidopteran insect larvae, and stink bugs. However, naturally occurring Metarhizium anisopliae has some drawbacks, such as slow insecticidal effects or insufficient toxicity, which require improvement.

[0076] Beauveria bassiana belongs to the kingdom Fungi, phylum Ascomycota, class Sordariomycetes, order Hypocreales, family Cordycipitaceae, and genus Beauveria. It is a fungus with septate and branched hyphae. Beauveria bassiana can infect over 700 species of insects and mites belonging to 149 families and 15 orders, multiplying rapidly, consuming nutrients, damaging insect tissues, and producing toxins that disrupt metabolism, leading to insect death. The infection process of Beauveria bassiana generally includes: conidial attachment; spore germination; germ tube penetration of the epidermis; hyphal growth in the hemocoel; toxin production; killing / damaging the host; hyphal invasion of all host organs; hyphal emergence from the epidermis; conidial production; and conidial dispersal. Beauveria bassiana primarily invades through the body wall, but can also invade or kill insects through spiracles, wounds, or the digestive tract. However, it has also been found in the field that the insecticidal speed of natural Beauveria bassiana strains is not fast enough or their toxicity is insufficient, which requires improvement. In addition, after long-term application, engineered Beauveria bassiana strains may evolve resistance in target insects to insecticidal proteins or toxins.

[0077] Although preferred targets for the control of Metarhizium anisopliae are listed in the embodiments of the present invention, it should be understood, based on the disclosure of the present invention, that other insect hosts of Metarhizium anisopliae / Beauveria bassiana can also be used in the present invention.

[0078] The present invention also provides an insect control composition (such as a pesticide composition) containing: an effective amount of the recombinant fungus or its conidia. More preferably, the composition further contains a pesticide-acceptable carrier.

[0079] The insect control composition of the present invention can be formulated into any suitable dosage form. For example, the composition may be in the form of (but is not limited to): powder, granules, oil, emulsion, wettable powder, microcapsule, or nonwoven fabric microbial agent.

[0080] Suitable solid diluents for preparing the composition include (but are not limited to): diatomaceous earth, corn husks, tricalcium phosphate, cork powder, clays such as kaolin, bentonite or magnesia, or water-soluble polymers.

[0081] The present invention also provides a method for controlling insects, the method comprising: administering an effective amount of the modified entomopathogenic fungus or spores produced therefrom to the target of insect control. In a preferred embodiment, the composition is administered directly to the target of insect control.

[0082] Suitable methods for applying the spore composition described above to growing plants include: solid seeding, foliar spraying, liquid irrigation, etc.

[0083] The beneficial effects of this invention are as follows:

[0084] The MAA_06769 gene promoter, specifically expressed in entomopathogenic fungi during the entomopathogenic stage, was developed. This promoter allows the target gene to be expressed only after the pathogenic fungus enters the insect's hemocoel, adding a controllable switch to the target gene expression. This overcomes the limitation of constitutive expression promoters in effectively controlling the spatiotemporal expression of target genes, providing a new option for the genetic modification of entomopathogenic fungi. Comparative analysis with the entomopathogenic gene MCL1, previously reported in *Metarhizium anisopliae*, revealed that MAA_06769 exhibits higher expression levels than MCL1. Therefore, this promoter has greater application potential in genetically modified engineered fungi.

[0085] The MAA_06769 gene promoter of this invention has good specificity, expressing specifically only in entomopathogenic fungi. It can regulate the efficient expression of specific genes in entomopathogenic fungi after the pathogenic fungus enters the insect body. This promoter provides a new option for improving and utilizing entomopathogenic fungi through molecular biology. It can be used to regulate gene expression after entering the host, effectively controlling the leakage expression of exogenous genes (target genes) before infecting the host. It can effectively ensure the environmental safety of genetically engineered strains and eliminate people's concerns about the potential environmental impact of genetically engineered strains.

[0086] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions such as those described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Edition, Science Press, or according to the manufacturer's recommendations.

[0087] Example 1: MAA_06769 gene promoter (pMAA_06769) and its functional analysis

[0088] 1. MAA_06769 gene promoter sequence

[0089] The nucleotide sequence of the promoter of the MAA_06769 gene (SEQ ID NO:1; 911bp):

[0090] Attagaatggaaagcaa gggcggtatacgagcttgtcgggaaaggaccggagtattccacagaaatagacaagtatccatcttgggggcgctgcttctgacttttgcgaaaataattgagtggtagaagtgcggctccaaagtaacatggtcctgtctgtgtatctaaacgcgctggaaaccgtgcaagaggatc caat cgactagtagtatttaatccctgttatattaataacgactcataattagcagctaaattacctatacagccaggggaccctgctctattaaccttgtcaggttacgggtagttcattatacaggggttggaatgtaacgctcgagttggtagactccaaggg gggcgg tgtccatgactggggtatagtagtttgccgcgttgccctgtgccgagcaacactccttccagaaattgataggcaccgcggtagggcaagtaagttaatatagtgagatgttcccgtgtaaatagagatttttatccgtataaatactaatactctatagaatataggcagaaaagcctacttcgtga caat acaagctagacaggagcacgttatgctagggcaaaatgaggcgtttatgcgtccttaaaaatacaaacacatgactcatatttttcgtaagttacgactggtaacttgattcctactcatgcccggccccacgttactaggattcgcttcgcctcacctaccttacgcggcgtctctacgcaacttcgtctatagcgtttgagcgctatagtagtaattagtaacaagcttggagggcacg tataaaa tgggcatgcccgaccttggagggtgttcaacgt caat ttcctcagcttactatccgctgcattctcctactatccgctcactttttgctacacgtacatacatg(SEQ ID NO:1)

[0091] 2. Cloning and Vector Construction of the Promoter of MAA_06769 Gene

[0092] Artificially synthesized primer pairs P319F / PR (amplifies the upstream region of the MAA_06769 gene, i.e., positions -319 to -1; corresponding to positions 593 to 911 in SEQ ID NO:1; yielding p319), P617F / PR (amplifies the upstream region of the MAA_06769 gene, i.e., positions -617 to -1; corresponding to positions 295 to 911 in SEQ ID NO:1; yielding p617), and P911F / PR (amplifies the upstream region of the MAA_06769 gene, i.e., positions -911 to -1; corresponding to positions 1 to 911 in SEQ ID NO:1; yielding p911).

[0093] Specifically, P319F / PR amplifies the upstream region of the MAA_06769 gene, i.e., positions -319 to -1; corresponding to positions 593 to 911 in SEQ ID NO:1; thus obtaining p319.

[0094] P617F / PR amplifies the upstream region of the MAA_06769 gene, i.e., positions -617 to -1; corresponding to positions 295 to 911 in SEQ ID NO:1; thus obtaining p617.

[0095] P911F / PR amplifies the upstream region of the MAA_06769 gene, i.e., positions -911 to -1; corresponding to positions 1 to 911 in SEQ ID NO:1; thus obtaining p911.

[0096] Using wild-type Metarhizium anisopliae genomic DNA as a template, we amplified MAA_06769 gene promoter fragments of different lengths, aiming to develop a specific promoter with activity and the shortest fragment.

[0097] The PCR amplification system was as follows: 25 μl of 2×Phanta Max Master Mix (vazyme), 1 μl of each of 10 μmol / L primers, 1 μl of genomic DNA template (10 ng / μl), and water added to a final volume of 50 μl.

[0098] PCR reaction parameters: 95℃ pre-denaturation for 5 min; 30 cycles: 95℃ (30 sec), 58℃ (30 sec), 72℃ (30 sec); 72℃ (15 min). The MAA_06769 promoter fragment was recovered by 1.2% agarose gel electrophoresis. The P319F / PR amplification product fragment was approximately 320 bp, the P617F / PR amplification product fragment was approximately 620 bp, and the P911F / PR amplification product fragment was approximately 920 bp.

[0099] Using the primer pair PegF / PegR, and with the pk2-bar-EGFP plasmid (obtained by adding bar-EGFP elements to the pk2 backbone vector) as a template, the EGFP fragment was amplified by PCR.

[0100] The P319::EGFP fusion fragment was amplified using primers P319F / PegR and templates (P319F / PR amplification fragment and EGFP fragment).

[0101] The P617::EGFP fusion fragment was amplified using primers P617F / PegR and templates (P617F / PR amplification fragment and EGFP fragment).

[0102] The P911::EGFP fusion fragment was amplified using primer 911F / PegR and template (P911F / PR amplification fragment and EGFP fragment).

[0103] The amplification system consisted of 25 μl of 2×Phanta Max Master Mix (vazyme), 1 μl of each of the 10 μmol / L primers, 1 μl of plasmid template (10 ng / μl), and water to a final volume of 50 μl.

[0104] PCR reaction parameters: 95℃ (5 min); 30 cycles: 95℃ (30 sec), 58℃ (30 sec), 72℃ (30 sec); 72℃ (15 min).

[0105] EGFP fragments were recovered by gel excision. Fragments fused with EGFP at different promoter lengths of MAA_06769 were obtained by overlap PCR amplification.

[0106] Reclaim the corresponding fragments.

[0107] The plasmid pDht-bar (obtained by adding a bar element to the pDht backbone vector) was digested with SpeI, and the pDht-bar fragment was recovered. Fragments fused with EGFP at different lengths of the MAA_06769 promoter were seamlessly cloned with the pDht-bar fragment. The kit used was from Vazyme (a company in Japan). IIOne Step Cloning Kit, C112).

[0108] Vectors constructed by fusing MAA_06769 promoters of different lengths with EGFP were named pDht-bar-P319::EGFP, pDht-bar-P617::EGFP, and pDht-bar-P911::EGFP, respectively. Figure 1 This is a schematic diagram of the construction carrier of the present invention.

[0109] The primers used for vector construction are as follows:

[0110] P319F: 5'-accgagatctgatgaactagtaaatgaggcgtttatgcgtc-3' (SEQ ID NO: 2);

[0111] P617F: 5'-accgagatctgatgaactagtgtcaggttacgggtagttca-3' (SEQ ID NO: 3),

[0112] P911F: 5'-accgagatctgatgaactagtattagaatggaaagcaaggg-3' (SEQ ID NO: 4);

[0113] PR: 5'-gcccttgctcaccatcatgtatgtacgtgtagcaa-3' (SEQ ID NO: 5);

[0114] PegF: 5'-acacgtacatacatgatggtgagcaagggcgagga-3' (SEQ ID NO: 6);

[0115] PegR: 5'-ggcggccgctctgaactagtttacttgtacagctcgtcca-3' (SEQ ID NO: 7).

[0116] 3. Agrobacterium genetic transformation

[0117] Remove 100 μL of Agrobacterium competent cells stored at -80℃ and thaw on ice for 10 min. Add 1 μL of pDht-bar-P319::EGFP, pDht-bar-P617::EGFP, and pDht-bar-P911::EGFP plasmids, mix by pipetting, incubate on ice for 30 min, flash freeze in liquid nitrogen for 5 min, incubate in a 37℃ water bath for 5 min, and immediately incubate on ice for 2 min. Add 1 mL of YEB liquid (antibiotic-free) in a clean bench and incubate at 28℃ and 150 rpm for 3 h. Centrifuge at 5000 rpm for 5 min, discard the supernatant, and reserve 100 μL. Apply half of this supernatant to a YEB plate (containing Kan+Carb), dry, and incubate upside down at 28℃ for 2-2.5 days. Aspirate 3-5 single colonies into 1 μL using a pipette tip, inoculate into 3 mL of YEB liquid (containing Kan+Carb), and incubate at 28℃ and 220 rpm for 14-20 h. Take 1 μL of the bacterial culture in a clean bench for PCR.

[0118] PCR amplification system: 10 μl of 2×Taq Master Mix (vazyme, P112), 0.5 μl each of different promoter primers (P319F, P617F and P911F) and primer PegR (downstream of EGFP), 0.5 μl of template bacterial culture, and water added to a total of 20 μl.

[0119] The P319F / PegR amplification fragment is approximately 1 kb, the P617F / PegR amplification fragment is approximately 1.4 kb, and the P911F / PegR amplification fragment is approximately 1.7 kb.

[0120] Amplification program: 95℃ pre-denaturation for 5 min, 30 cycles: 95℃ (30 sec), 56℃ (30 sec), 72℃ (2 min), 72℃ extension for 10 min. YEB liquid medium (200 mL): sucrose 1 g, bacterial peptone 2 g, yeast extract 0.2 g, MgSO4·7H2O 0.1 g. Add 3 g agar to make it a solid medium.

[0121] 4. Genetic transformation and screening of Metarhizium anisopliae (Roberts)

[0122] Wild-type Metarhizium anisopliae was used as the transformation recipient, and transformation was carried out using Agrobacterium tumefaciens-mediated genetic transformation. The culture medium and specific transformation method are as follows:

[0123] The culture medium used in the transformation process:

[0124] YEB liquid medium (200mL): sucrose 1g, bacterial peptone 2g, yeast extract 0.2g, MgSO4·7H2O 0.1g.

[0125] IM solid medium (1L): 400mL 2.5×mm salt solution / L, 5mL glycerol / L, glucose 0.9g / L, agar powder 15g / L (add 200μmol / L acetylsalicylic acid and 40mmol / L LMES before use), sterilize at 121℃ for 15min.

[0126] IM liquid culture medium (1L): 400mL 2.5×mm salt solution / L, 5mL glycerol / L, glucose 1.8g / L (add 200μmol / L acetylsalicylic acid and 40mmol / L LMES before use), store protected from light.

[0127] M-100 solid culture medium (200mL): 100×salt solution 12.5mL, glucose 2g, KNO3 0.6g, agar 2g, water 187.5mL.

[0128] 2.5×MM salts (liquid, 1L): KH2PO4 3.625g, K2HPO4 5.125g, MgSO4·7H2O 1.250g, NaCl 0.375g, CaCl2·2H2O 0.165g, FeSO4·7H2O 0.0062g, (NH4)2SO4 1.250g, water 1L.

[0129] M-100trace element solution (liquid, 500mL): H3BO3 30mg, MnCl2 4H2O 70mg, ZnCl2200mg, Na2MoO4.2H2O 20mg, FeCl3.6H2O 50mg, CuSO4.5H2O 200mg, water 500mL.

[0130] M-100Salt solution (liquid, 1L): KH2PO4 16g, Na2SO4 4g, KCl 8g, MgSO4.7H2O2g, CaCl2 1g, M-100trace element solution 8mL, water 992mL.

[0131] Single colonies of *Agrobacterium tumefaciens* containing plasmid vectors were inoculated into YEB liquid medium (containing 50 μg / mL carbenicillin and 50 μg / mL kanamycin) and cultured overnight (16–20 h) at 28°C and 200 rpm with a shaker. 3 mL of the bacterial culture was centrifuged at 6000 rpm for 10 min, the supernatant was discarded, and the cells were resuspended in an equal volume of IM liquid medium. The concentration was adjusted to an OD600 of 0.15, and then cultured at 28°C and 180 rpm with a shaker for 6 h. During this period, a 2 × 10⁻⁶ colony of *Agrobacterium tumefaciens* was prepared using Tween-80 (0.5% v / v). 5 A spore suspension of 1 / mL was prepared. An equal volume of the spore suspension and the pre-cultured Agrobacterium tumefaciens culture was mixed, and 200 μl of the culture was spread onto an IM solid medium plate and co-cultured at 22°C for 48 h. The plate was then covered with 20 mL of M-100 solid medium containing 200 μg / mL GA (Glufosinate ammonium) and 300 μg / mL Cef (Cefotaxim sodium salt), and incubated at 25°C for 6–7 days until resistant colonies appeared. Single colonies were then picked with a toothpick and transferred to a PDA plate. After incubation at 25°C for 4 days, the genome was extracted using the CTAB method and verified by PCR. The transformants amplified approximately 800 bp fragments.

[0132] Genomic DNA extraction using the CTAB method: Place the mycelium into a Beads FastPrep tube, set the FastPrep mixer to 60 Hz and 60 sec, and repeat the shaking twice. Add 500 μL of CTAB extraction buffer, mix well, and incubate at 55°C for 15 min. Add an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1), invert to mix, centrifuge at 10,000 rpm for 5 min, collect the supernatant, add an equal volume of cold anhydrous ethanol, invert 3-5 times, place in a -20°C freezer for 30 min, centrifuge at 12,000 rpm for 10 min, discard the supernatant, centrifuge for 10 sec, shake off the liquid from the tube wall, aspirate with the pipette tip, open the cap at room temperature and let stand for 5 min to evaporate the excess water, add 100 μL of ddH2O, and place in a 4°C freezer for 3 h to dissolve the DNA precipitate. CTAB extraction buffer (200 mL): CTAB 4 g, NaCl 16.364 g, 1M Tris-HCl 20 mL (pH 8), 0.5M EDTA 8 mL. PCR amplification system: 2×Taq Master Mix (vazyme, P112) 10 μl, primer PegF 0.5 μl, primer PegR 0.5 μl, genomic DNA template 1 μl (50 ng), water added to a final volume of 20 μl. Amplification program: 95℃ pre-denaturation for 5 min, 32 cycles: 95℃ (30 sec), 56℃ (30 sec), 72℃ (1 min), 72℃ extension for 10 min.

[0133] 5. Analysis of the expression of genes driven by the MAA_06769 promoter at different developmental stages of Metarhizium anisopliae.

[0134] Conidia of *Metarhizium anisopliae* M23 (Wang, B. et al., P Natl Acad Sci USA 109:1287-1292) grown on PDA plates for 14 days, hyphae cultured on SDB for 3 days, appressoriums induced by insect wings for 30 hours, insect-bacterial cells induced by the hemocoel of *Metarhizium anisopliae* larvae, and *Drosophila melanogaster* infected with *Metarhizium anisopliae* for 72 hours were collected. RNA was extracted and reverse transcribed into cDNA (TAKARA, PrimeScript). TM The expression pattern of the MAA_06769 gene was determined by qPCR using an RT reagent kit with gDNA Eraser, with the MCL1 gene, which is specifically expressed only in worm cells, as a control.

[0135] The MAA_06769 primer pair is:

[0136] rt06769FA: 5'-tgaggaggataaagacgcc-3' (SEQ ID NO: 8);

[0137] rt06769RA: 5'-tttccaccgaggagttga-3' (SEQ ID NO: 9);

[0138] The MCL1 gene primer pair is:

[0139] rtmclF: 5'-tgaacgacgactggatcactg-3' (SEQ ID NO: 10);

[0140] rtmclR: 5'-tgtcggacttggcatagacg-3' (SEQ ID NO: 11);

[0141] The tublin gene of Metarhizium anisopliae is used as an internal control gene, and the primer sequence is as follows:

[0142] ptubF: 5'-ggtcgctatgaaggaggttga-3' (SEQ ID NO: 12);

[0143] ptubR: 5'-tcctggatggaggtggagtta-3' (SEQ ID NO: 13).

[0144] qPCR reaction system: 5.0 μl 2x qPCR SYBR Green Master Mix (Yeasen Biotechnology (Shanghai) Co., Ltd), 0.1 μl cDNA, 0.2 μl each primer pair, total volume 10 μl.

[0145] qPCR reaction parameters: 95℃ (5 min); 40 cycles: 95℃ (15 sec), 60℃ (25 sec), 60℃ (30 sec).

[0146] qPCR results showed that MAA_06769 was not expressed in conidia, hyphae, and appressoria, but was specifically highly expressed in insect cells. Figure 2 ).

[0147] Notably, comparative analysis with the previously reported insect-specific gene expression (MCL1) in *Metarhizium anisopliae* revealed that MAA_06769 exhibited a higher expression level than MCL1. Analysis of MAA_06769 expression at different time points in *Metarhizium anisopliae*-infected *Drosophila* showed that MAA_06769 expression began 36 hours after infection, increasing with time and peaking at 72 hours. Figure 3This coincides with the timeframe at which *Metarhizium anisopliae* infects fruit flies and forms worm-bacterial cells within them. This result suggests that MAA_06769 is a gene specifically or highly expressed in worm-bacterial cells, playing a crucial role in the infection process of *Metarhizium anisopliae*. Therefore, researching and developing a promoter for MAA_06769 holds significant promise for future applications.

[0148] Example 2: Detection of EGFP fluorescence signals at different developmental stages of pMAA_06769::EGFP strain

[0149] The MAA_06769 gene is separated from the previous gene (MAA_11631) by 968 bp. Analysis of this sequence revealed that it has typical TATA box (-111 bp; corresponding to positions 801-807 in SEQ ID NO:1), CAAT box (-71 bp, -356 bp, -716 bp; corresponding to positions 841-844, 556-559, and 196-199 in SEQ ID NO:1, respectively), and GC box (-550 bp, -894 bp; corresponding to positions 362-367 and 18-23 in SEQ ID NO:1, respectively; eukaryotic GC box sequence characteristics (GGGCGG or GGGCGGGG), often located on both sides of the CAAT box. These three locations meet the above characteristics and are analyzed to be GC boxes, etc., which are promoter core element motifs.

[0150] To investigate the shortest active region of the gene promoter, three vectors (named P319, P617, and P911, respectively) of different lengths (319 bp, 617 bp, and 911 bp) were constructed based on the distribution of the promoter core elements and fused with EGFP to detect the optimal promoter activity. The constructed fungal expression vectors were then transformed into *Metarhizium anisopliae* using an Agrobacterium-mediated genetic method.

[0151] Conidia, hyphae, appressoria, and larval cells of the pMAA_06769::EGFP Metarhizium anisopliae strain were collected. Fluorescence was observed at different developmental stages to investigate the expression pattern of the MAA_06769 promoter and its optimal promoter activity.

[0152] The detection method is as follows: using the enhanced green fluorescent protein (EGFP) gene as a reporter gene, transformant strains containing pMAA_06769::EGFP fusion genes with promoters of different lengths are constructed. When the promoter is expressed, the EGFP reporter gene is expressed, and green fluorescent protein is produced in the spores of recombinant Metarhizium anisopliae. Under long-wave ultraviolet light irradiation, the recombinant strains can emit bright green fluorescence, i.e., EGFP green fluorescent signal.

[0153] The observation results showed that no EGFP signal was detected in conidia, hyphae, or appressoria of the pMAA_06769::EGFP strain; it was only specifically highly expressed in the insect cells. Figure 4 As shown.

[0154] Observations on pMAA_06769::EGFP strains with different promoter lengths revealed that all promoters with lengths between 319bp and 911bp exhibited transcriptional activity, and there was no significant difference in transcriptional activity within this range.

[0155] It is generally believed that the promoter of fungal genes is located 1000-1500 bp before the ATG. However, Metarhizium anisopliae MAA_06769 has promoter activity in the 319 bp region before its ATG, which is relatively rare.

[0156] Example 3: Detection of EGFP gene expression in pMAA_06769::EGFP strain during Metarhizium anisopliae infection of host.

[0157] Metarhizium anisopliae infection begins with spores attaching to the host's body wall, subsequently multiplying in the host's hemocoel as worm-bacterial cells. Under normal circumstances, 72 hours after infection with Drosophila, Metarhizium anisopliae primarily exists in the Drosophila's body as worm-bacterial cells. To analyze the expression of the MAA_06769 promoter in the pathogenic host process of Metarhizium anisopliae, the pMAA_06769::EGFP strain was inoculated into the Diptera insect Drosophila melanogaster. After 72 hours of infection, RNA was extracted from the Drosophila and detected by qPCR (egfp primers rtegfpF: 5'-gcagaagaacggcatcaa-3' (SEQ ID NO:14), rtegfpR: 5'-ggtgctcaggtagtggttgt-3' (SEQ ID NO:15)), with tublin from Metarhizium anisopliae used as an internal control gene. qPCR results showed that the pMAA_06769::EGFP strain expressed EGFP at all host sites for 72 hours after infection. There was no significant difference in EGFP expression levels compared to strains transformed with the ptef::EGFP constitutive promoter, and no significant difference in EGFP expression was observed among the three different promoter lengths. Figure 5 ).

[0158] In addition, the pMAA_06769::EGFP strain was used to infect the lepidopteran insect *Hemiberlesia lataniae*, and RNA was extracted from the purified insect cells for qPCR detection (egfp primers were the same as before). The qPCR results showed that the pMAA_06769::EGFP strain expressed a high level of EGFP, which was not significantly different from strains transformed with the tef::EGFP constitutive promoter. This result was consistent with that of *Drosophila* infected for 72 hours. Figure 6 ).

[0159] The expression pattern determination results of the MAA_06769 promoter in Metarhizium anisopliae indicate that the promoter of this gene has good specificity, is specifically expressed during the infection process of Metarhizium anisopliae (in the worm-bacterial cell), and has transcriptional activity from before the translation start site to positions 319 bp to 911 bp. That is, as long as the bases contained in positions 1 (-1) to 319 (-319) before the translation start site (corresponding to positions 593 to 911 in SEQ ID NO:1) are present, the aforementioned activity can be achieved.

[0160] Therefore, the MAA_06769 promoter has important application value, as it can regulate the efficient expression of specific genes only during the host infection stage, thereby effectively controlling the leakage expression of exogenous genes before infecting the host and not endangering environmental safety.

[0161] Example 4: Analysis of the insecticidal ability of Metarhizium anisopliae strain enhanced by expressing the exogenous gene HlyII (pMAA_06769::HlyII) using the MAA_06769 gene promoter.

[0162] Haemolysin II (HlyII) is a perforating toxin protein found in Bacillus. It can induce apoptosis in phagocytes (insect hemocytes, mouse macrophages, human monocytes, and dendritic cells) through its perforating activity, thereby exerting toxicity on the animal immune system. To investigate whether expressing the exogenous gene HlyII via the MAA_06769 gene promoter could enhance the insecticidal ability of *Metarhizium anisopliae*, the codon for the mature HlyII encoding gene was optimized and artificially synthesized. The signal peptide sequence of the *Metarhizium anisopliae* MCL1 gene was then added before it, making it suitable for expression in *Metarhizium anisopliae* insect cells and secretion into the insect's hemocoel. Hly II expression was driven using the MAA_06769 gene promoter P319 (-1bp to -319bp of the MAA_06769 gene), which contains one TATA box and one CAAT box regulatory element, and the MAA_06769 gene promoter P617 (-1bp to -617bp of the MAA_06769 gene), which contains TATA box, CAAT box, and GC box regulatory elements. Vector construction was as follows... Figure 7 .

[0163] Nucleotide sequences encoding the artificially synthesized mature HlyII protein and the signal peptide encoding sequence of Mcl1:

[0164] atgcgtgaactttcttcggttctcgccctttcgggcttgctggccctggcgtcggca

[0165] The sequence marked with a lowercase letter (underline, 57bp) at the 5' end is the signal peptide coding sequence of Mcl1, and the other sequences (uppercase) are the coding gene sequences of the mature HlyII protein.

[0166] 1. Construction of pMAA_06769::HlyII overexpression vector

[0167] Artificial primer pairs P319F / PhyR were used to amplify the upstream region of the MAA_06769 gene, i.e., positions -319 to -1; corresponding to positions 593 to 911 in SEQ ID NO:1; yielding p319) and P617F / PhyR were used to amplify the upstream region of the MAA_06769 gene, i.e., positions -617 to -1; corresponding to positions 295 to 911 in SEQ ID NO:1; yielding p617. The MAA_06769 gene promoter fragment was amplified using wild-type Metarhizium anisopliae genomic DNA as a template.

[0168] The PCR amplification system consisted of 25 μl of 2×Phanta Max Master Mix (vazyme), 1 μl each of 10 μmol / L primers, 1 μl of genomic DNA template (10 ng / μl), and water to a final volume of 50 μl. PCR reaction parameters were: 95℃ (5 min); 30 cycles: 95℃ (30 sec), 58℃ (30 sec), 72℃ (30 sec); 72℃ (15 min). The MAA_06769 promoter fragment was recovered by 1.2% agarose gel electrophoresis. The P319F / PhyR amplification product was approximately 320 bp, and the P617F / PR amplification product was approximately 620 bp.

[0169] Using primers HLYIIF / HLYIIR and synthetically produced HlyII as a template, the HlyII fragment was amplified by PCR. The HlyII fragment was then recovered from the gel. The P319::HlyII fusion fragment was amplified using primers P319F / HLYIIR and template (P319F / PhyR amplified fragment and HlyII fragment), and the P617::HlyII fusion fragment was amplified using primers P617F / HLYIIR and template (P617F / PhyR amplified fragment and HlyII fragment).

[0170] The PCR amplification system consisted of 25 μl of 2×Phanta Max Master Mix (vazyme), 1 μl each of 10 μmol / L primers, 1 μl of plasmid template (10 ng / μl), and water to a final volume of 50 μl. PCR reaction parameters were: 95℃ (5 min); 30 cycles: 95℃ (30 sec), 58℃ (30 sec), 72℃ (1 min); 72℃ (15 min). The P319::HlyII fusion fragment was recovered from the gel. The P319::HlyII fusion fragment and the P617::HlyII fusion fragment were seamlessly cloned with pDht-bar (SpeI-digested plasmid fragment), using a kit from vazyme (Vazyme Inc.). IIOne Step Cloning Kit (C112). Vectors constructed by fusing HlyII with promoters of different lengths from MAA_06769 were named pDht-bar-P319::HlyII and pDht-bar-P617::HlyII, respectively.

[0171] 2. Obtaining Metarhizium anisopliae pMAA_06769::HlyII overexpression transformants

[0172] The constructed pDht-bar-P319::HlyII and pDht-bar-P617::HLYII plasmids were transformed using Agrobacterium-mediated Metarhizium anisopliae (as before) to obtain P319::HLYII and P617::HLYII genetically transformed strains. Genomic DNA was extracted using the CTAB method and verified by PCR; the transformants amplified approximately 600 bp fragments.

[0173] PCR amplification system: 10 μl of 2×Taq Master Mix (vazyme, P112), 0.5 μl each of primer pairs (YZHLYF / YZHLYR), 1 μl (50 ng) of genomic DNA template, and water to a final volume of 20 μl. Amplification program: 95℃ pre-denaturation for 5 min, 32 cycles: 95℃ (30 sec), 56℃ (30 sec), 72℃ (1 min), 72℃ extension for 10 min.

[0174] The obtained transformants were used to infect Drosophila for 72 hours, RNA was extracted, and reverse transcribed into cDNA (TAKARA, PrimeScript). TM The RT reagent kit with gDNA Eraser was used to identify strains with overexpression of the HlyII gene using qPCR.

[0175] qPCR reaction system: 5.0 μl 2x qPCR SYBR Green Master Mix (Yeasen Biotechnology (Shanghai) Co., Ltd), 0.1 μl cDNA, 0.2 μl each of primer pairs (rtHLYF / rtHLYR), total volume 10 μl.

[0176] qPCR reaction parameters: 95℃ (5 min); 40 cycles: 95℃ (15 sec), 60℃ (25 sec), 60℃ (30 sec).

[0177] qPCR results showed that, compared with the wild-type strain M23, the HlyII gene was highly expressed in strains P319::HlyII / 23-48, P319::HlyII / 23-54, P617::HlyII / M23-8, and P617::HlyII / M23-9 (e.g., ...). Figure 8 ).

[0178] The primers for vector construction and strain validation are as follows:

[0179] P319F: 5'-accgagatctgatgaactagtaaatgaggcgtttatgcgtc-3' (SEQ ID NO: 2);

[0180] P600F: 5'-accgagatctgatgaactagtgtcaggttacgggtagttca-3' (SEQ ID NO: 3);

[0181] PhyR: 5'-cgaagaaagttcacgcatcatgtatgtacgtgtagcaa-3' (SEQ ID NO: 17);

[0182] HLYIIF: 5'-ctacacgtacatacatgatgcgtgaactttcttcgg-3' (SEQ ID NO: 18);

[0183] HLYIIR: 5'-ggcggccgctctagaactagtttagatcttcttgatctcgat-3' (SEQ ID NO: 19);

[0184] YZHLYF: 5'-tcggcttccagagcttcaact-3' (SEQ ID NO: 20);

[0185] YZHLYR: 5'-ttcagctggttgccgttca-3' (SEQ ID NO: 21);

[0186] rtHLYF: 5'-caagctcgactggaagaacca-3' (SEQ ID NO: 22);

[0187] rtHLYR: 5'-ttctcgccgttgacgaaga-3' (SEQ ID NO: 23).

[0188] Detection method: Using adult Drosophila melanogaster as test insects, the virulence of the strain was determined by infection through the body wall, and the half-lethal time (LT) was compared. 50 The effect of heterologous overexpression of the HlyII gene on the pathogenicity of the strains was characterized. The HlyII-overexpressing Metarhizium anisopliae transformants P319::HlyII / M23 and P617::HlyII / M23 were formulated into 1x10⁻¹⁰ samples. 5 1 spore / ML was used to infect Drosophila melanogaster, with wild-type strain M23 as a control. The number of dead flies was counted every 12 hours. The median lethal time (LT) was compared. 50 To characterize the virulence of the strain. LT 50 The smaller the value, the stronger the insecticidal ability of the strain.

[0189] Insect bioassays showed that, compared with wild-type strain M23, overexpression of HlyII-transformed strains P319::HlyII / M23 and P617::HlyII / M23 led to a faster mortality rate and a longer median lethal time (LT) in infected fruit flies. 50 Significantly reduced ( Figure 9 ).

[0190] These results indicate that the MAA_06769 gene promoter driving HlyII can significantly enhance the pathogenicity of the strain to host insects; these results also further demonstrate that the MAA_06769 gene promoter has transcriptional activity as long as it includes the upstream region, i.e., -319 to -1 positions.

[0191] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of this patent should be determined by the appended claims. Furthermore, all documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference.

Claims

1. The purpose of the promoter of the MAA_06769 gene, to serve as a specific expression promoter to guide the expression of the target gene after the entomopathogenic fungus enters the hemocoel of the insect; the nucleotide sequence of the promoter of the MAA_06769 gene is as shown in SEQ ID NO: 1 or as shown in positions 593 to 911 therein; the entomopathogenic fungus is an insect-infecting fungus, namely Metarhizium anisopliae.

2. The use as described in claim 1, characterized in that, The insects mentioned are those susceptible to the insect pathogenic fungi, including Lepidoptera, Diptera, Homoptera, Orthoptera, Coleoptera, Hemiptera, or Hymenoptera.

3. A method for expressing a target gene after an entomopathogenic fungus enters the hemocoel of an insect, comprising: (a) The promoter of the MAA_06769 gene is operatively linked to the target gene to form an expression cassette; the expression cassette is introduced into an entomopathogenic fungus; the nucleotide sequence of the promoter of the MAA_06769 gene is as shown in SEQ ID NO: 1 or as shown in positions 593 to 911 therein; (b) Infecting insects with the entomopathogenic fungus described in (a), and after the fungus enters the insect's hemocoel, the target gene is expressed; The entomopathogenic fungus is a fungus that infects insects, specifically Metarhizium anisopliae.

4. The method as described in claim 3, characterized in that, The insects mentioned are those susceptible to the insect pathogenic fungi, including Lepidoptera, Diptera, Homoptera, Orthoptera, Coleoptera, Hemiptera, or Hymenoptera.

5. An isolated nucleic acid, having a nucleotide sequence as shown in SEQ ID NO: 1 or as shown in positions 593 to 911 therein.

6. The isolated nucleic acid as described in claim 5, characterized in that, The nucleic acid also has a conserved GC box.

7. The isolated nucleic acid as described in claim 5, characterized in that, The nucleic acid is selected from: The nucleic acid of the nucleotide sequence shown in positions 593-911 of SEQ ID NO: 1; The nucleic acid of the nucleotide sequence shown in positions 295-911 of SEQ ID NO: 1; The nucleic acid of the nucleotide sequence shown in positions 1 to 911 of SEQ ID NO:

1.

8. An expression construct comprising the nucleic acid of claim 5 or 7 as a promoter element.

9. The expression construct as described in claim 8, characterized in that, The expression construct also contains a target gene operatively linked to the promoter element.

10. The expression construct as described in claim 9, characterized in that, The target genes include: functional genes and structural genes.

11. The expression construct as described in claim 10, characterized in that, The functional genes include: reporter genes, genes for proteins that reduce insect survival ability, genes for insect metabolic and immunosuppressive proteins, and interfering molecules that target and interfere with essential insect genes.

12. The expression construct as described in claim 11, characterized in that, The functional gene is the perforation toxin protein gene.

13. The expression construct as described in claim 12, characterized in that, The functional gene is hemolysin II.

14. A genetically engineered cell comprising the expression construct according to any one of claims 8 to 13; or Its genome integrates the nucleic acid described in any one of claims 5-7 as a promoter element.

15. The genetically engineered cell as described in claim 14, characterized in that, Its genome also integrates a target gene, which is operatively linked to the promoter element.

16. The cell as claimed in claim 14, characterized in that, The cells are entomopathogenic fungi, and the insects are insects susceptible to the entomopathogenic fungi, including Lepidoptera, Diptera, Homoptera, Orthoptera, Coleoptera, Hemiptera, or Hymenoptera; the entomopathogenic fungi are fungi that infect insects, specifically fungi of the genus Metarhizium or Beauveria bassiana.

17. A method for controlling insects, comprising: (1) Provide insect pathogenic fungi, which can infect the insect and enter its hemocoel by using the insect as a host; (2) The expression construct of claim 8 is introduced into the entomopathogenic fungus; the functional genes include: reporter genes, genes for proteins that reduce insect survival ability, genes for insect metabolic and immunosuppressive proteins, etc. Interference molecules that target and disrupt essential genes in insects (3) The insect pathogenic fungus is applied to the insect, which infects the insect and enters its hemocoel, thereby inhibiting the insect.

18. The method as described in claim 17, characterized in that, The gene for the protein that reduces the survival ability of insects is an insecticidal toxin gene.

19. The method as described in claim 17, characterized in that, The functional gene is the perforating toxin protein gene, and the gene is hemolysin II.

Images