Chain deoxyribozyme probe for identifying actinobacillus actinomycetes and application of chain deoxyribozyme probe
By obtaining a stranded deoxyribozyme probe that recognizes Actinomycetes, the problem of difficulty in detecting Actinomycetes in the prior art is solved, and a high-accurate biosensing application is achieved.
Patent Information
- Application Number
- CN202411859539.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-16
- Publication Date
- 2025-04-15
AI Technical Summary
The prior art is difficult to detect actinobacteria quickly and sensitively, which leads to difficulties in diagnosis and control of diseases such as periodontitis.
By designing an in vitro screening scheme, a stranded deoxyribozyme probe that can identify Actinobacteria co-actii is obtained. This probe has the characteristics of high stability, high sensitivity and good specificity.
It realizes rapid and sensitive detection of Actinobacteria co-acti, can give full play to its advantages in biosensing applications, and improves the diagnostic accuracy of diseases such as periodontitis.
Smart Images
Figure CN119823987A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of DNA enzyme probes, and in particular relates to a chain DNA enzyme probe for identifying Actinobacillus actinomycetemcomitans and an application thereof. Background Art
[0002] Since Watson and Crick verified the double helix structure of DNA in 1953, people's understanding of heredity has shifted from macroscopic appearance to molecular science. With the increasing advancement of molecular science and technology, research on DNA molecules has also continued to deepen. The DNA double helix structure is no longer just a carrier for storing and transporting genetic information. Researchers screened random DNA sequences in the library based on the systematic evolution of ligands by exponential enrichment (SELEX) or other methods to obtain DNA sequences with special functions. Such DNA is called functional nucleic acid.
[0003] Functional nucleic acids are mainly divided into two categories according to their different mechanisms of action: the first type of functional nucleic acids is called nucleic acid aptamers (Aptamer), which can play a similar recognition function to protein antibodies and can specifically recognize metal ions, small molecules, proteins, cells, tissues and even organs. Therefore, they are often used as recognition units for the construction of functional nucleic acid probes. Another type of functional nucleic acid is called deoxyribozyme (DNAzyme), which can bind to coenzyme factors and has a catalytic function similar to that of proteases. Deoxyribozyme is a single-stranded nucleic acid fragment screened by in vitro exponential enrichment ligand systematic evolution technology (SELEX technology), which can specifically recognize target molecules and has catalytic function. Among them, RNA-cleaving DNAzyme that cuts RNA substrates is the most widely used.
[0004] As one of the most common oral diseases, periodontitis is a chronic inflammatory disease that occurs in the periodontal supporting tissues. According to statistics from the World Health Organization, about 10-15% of the world's population suffers from severe periodontitis. Actinobacillus actinomycetemcomitans is one of the common pathogens in periodontal disease. As a facultative anaerobic Gram-negative bacterium, it is one of the main pathogens of the chronic inflammatory disease periodontitis. Actinobacillus actinomycetemcomitans has a variety of virulence factors, such as outer membrane proteins, cytolethal distending toxins, leukotoxins, lipopolysaccharides and heat shock proteins. Actinobacillus actinomycetemcomitans can use these virulence factors to evade the body's defense system, invade the host's epithelial cells, interfere with the remodeling and renewal of normal periodontal tissues, and ultimately lead to an imbalance in the homeostasis of periodontal tissues, resulting in serious consequences such as tooth loss, especially endangering the health of periodontal tissues in young patients, usually leading to the formation of deep periodontal pockets and rapid loss of alveolar bone attachment, and even having adverse effects on patients' psychology, physical and aesthetics. More seriously, evidence suggests that A. actinomycetemcomitans can cause serious infections such as soft tissue abscesses, systemic disease, and endocarditis.
[0005] Previously, researchers have obtained DNAzymes that respond to Escherichia coli, Helicobacter pylori, Staphylococcus aureus, etc. through in vitro screening and have applied them in the field of biosensors. Therefore, it is urgent to develop DNAzymes of Actinobacillus actinomycetemcomitans to achieve instant, rapid and sensitive detection in the environment. Summary of the invention
[0006] In order to achieve the purpose of rapid and sensitive detection of Actinobacillus actinomycetemcomitans, the purpose of the present invention is to provide a chain DNAzyme probe for identifying Actinobacillus actinomycetemcomitans and its application. The present invention obtains a chain DNAzyme probe that can identify Actinobacillus actinomycetemcomitans through a designed in vitro screening scheme. The DNAzyme probe obtained by the present invention has good stability, high sensitivity and good specificity, and can play an advantage in biosensor applications.
[0007] The present invention achieves the purpose by the following methods:
[0008] The present invention provides a DNAzyme probe, wherein the nucleotide sequence of the DNAzyme probe is any one of the following sequences (1) to (3):
[0009] (1)5'-CTATGAACTGACFRQGACCTCACTACCAAGTGGGAGTGAGGTCATTAGGGCGTTATACCATACTAGCATAACCCCTTG-3';
[0010] (2)5'-CTATGAACTGACFRQGACCTCACTACCAAGTGGGTAGTGAGGTCATTAGGGGTTATACCATACTAGCATAACCCCTTG-3';
[0011] (3)5'-CTATGAACTGACFRQGACCTCACTACCAAGATCAGACCACAACGGTTTCCCTAAAGTAGTAATGTATTTATATTATTCATAGTCTATATCATAGCATAACCCCTTG-3';
[0012] wherein sequence (1), sequence (2) or sequence (3) constitutes a cis-structured deoxyribozyme;
[0013] Where R represents RNA base A, F represents T base containing a fluorescent group, and Q represents T base containing a quenching group.
[0014] Based on the above technical solution, further, the fluorescent group is FAM.
[0015] Based on the above technical solution, further, the quenching group is BHQ1.
[0016] The invention also provides a kit for identifying Actinobacillus actinomycetemcomitans, comprising the deoxyribozyme probe.
[0017] Based on the above technical solution, further, the kit includes an auxiliary factor, and the auxiliary factor is Mg 2+ .
[0018] The present invention also provides the application of the DNA enzyme probe or the kit in biosensing for specifically identifying Actinobacillus actinomycetemcomitans.
[0019] Based on the above technical solution, further, the specific process of the application is: the DNA enzyme probe, the supernatant of the sample to be tested and the buffer solution are mixed evenly, reacted for 1 to 3 hours, and the fluorescence intensity is detected.
[0020] Based on the above technical solution, further, the supernatant of the sample to be tested is obtained by centrifugation at 10000-15000g for 5-30 minutes.
[0021] Based on the above technical solution, further, the conditions for the DNA enzyme probe to specifically identify Actinobacillus actinomycetemcomitans are: pH 5.5-7.5, 20-45°C.
[0022] Based on the above technical solution, further, the response concentration of Actinobacillus actinomycetemcomitans is ≥10 5 CFU / 100μL.
[0023] Compared with the prior art, the present invention has the following beneficial effects:
[0024] 1. The present invention obtains multiple chain DNA enzyme probes, and the DNA enzyme probe signal increases with time.
[0025] 2. The DNA enzyme probe provided by the present invention has good stability, high sensitivity and good specificity, and can play an advantageous role in biosensor applications. BRIEF DESCRIPTION OF THE DRAWINGS
[0026] In order to more clearly illustrate the specific implementation of the present invention or the technical solution in the prior art, the drawings required for describing the specific implementation are briefly introduced below.
[0027] Figure 1 This is a schematic diagram of the screening process of chain DNA enzymes.
[0028] Figure 2 It is a statistical chart of the cutting rate in each round of screening.
[0029] Figure 3 This is a verification graph of the cutting activity of the first five DNAzyme sequences after sequencing.
[0030] Figure 4 This is a graph showing the characterization experimental results of DNAzyme LDD-5 at different pH values.
[0031] Figure 5 This is a graph showing the characterization experimental results of DNAzyme LDD-5 at different temperatures.
[0032] Figure 6 This is a characterization diagram of the specificity of DNAzyme LDD-5 in crude extracellular mixtures of different bacteria.
[0033] Figure 7 This is a graph showing the metal ion selectivity experimental results of the DNA enzyme LDD-5.
[0034] Figure 8 This is a graph showing the detection results of targets recognizable by DNAzyme LDD-5 after different treatments.
[0035] Fig. 9 This is a representation diagram of the different types of targets that can be recognized by the DNAzyme LDD-5.
[0036] Fig.10 This is a molecular weight representation of the target that can be recognized by the DNA enzyme LDD-5.
[0037] Fig.11 This is a graph representing the sensitivity of the target that can be recognized by the DNAzyme LDD-5.
[0038] Fig.12 This is a diagram verifying the cleavage activity of the deoxyribozyme LDD-5.1 and the deoxyribozyme LDD-5.2.
[0039] Fig.13It is the kinetic curve fitting diagram of DNAzyme LDD-5.2. DETAILED DESCRIPTION
[0040] The following embodiments of the technical solution of the present invention are described in detail. The following embodiments are only used to more clearly illustrate the technical solution of the present invention, and are therefore only used as examples, and cannot be used to limit the protection scope of the present invention.
[0041] The examples include construction of a DNA library, reverse screening, forward screening, PCR amplification, etc. The names and sequences of the nucleic acids involved in the examples are shown in Table 1.
[0042] Table 1. Nucleic acid names, sequences and uses
[0043]
[0044]
[0045] Example 1 Construction of DNA library
[0046] The synthesized enzyme chain LDD library (SEQ ID NO: 3) was mixed with PNK enzyme (T4 polynucleotide kinase), incubated at 37°C for 40min to 60min, and then an equimolar amount of substrate chain FQ30 (SEQ ID NO: 2) and 1.2 times of the connecting chain (SEQ ID NO: 4) and T4 ligase were added, mixed evenly, and reacted at room temperature for 2 to 3h. After the reaction, 2.5 times the volume of 100% cold ethanol, 0.1 times the volume of 3 mol / L sodium acetate and 2μL 1μg / μL glycogen were added, and placed in a -20°C refrigerator for 30min to precipitate DNA. The precipitated mixture was centrifuged at low temperature and high speed (4°C, 14000rpm, 20min), the supernatant was removed, and a solid product was obtained after vacuum drying for 5min. Add 20 μL ultrapure water to reconstitute, purify by 10% denatured polyacrylamide gel electrophoresis (dPAGE), determine the position of the target band by gel imaging, and cut the gel for recovery. Add Elution Buffer (5M NaCl, 1M Tris (pH7.5), 0.5M EDTA (pH 8.0)) to the recovered target band for DNA elution. After cold ethanol precipitation, vacuum drying and ultrapure water reconstitution of the eluate, the library required for screening is obtained. The sequence of the screened library is shown in SEQ ID NO: 8.
[0047] DNA library system:
[0048] 1) Library phosphorylation
[0049] Table 2. Library phosphorylation reaction components
[0050] Reagents Volume (μL) LDD library (100 μM) 5 ATP(100mM) 2 10×PNKbuffer 5 PNK (10U / μL) 2 water Fill up to 50
[0051] 2) Library ligation substrate
[0052] Table 3. Ligation reaction components
[0053] Reagents Volume (μL) Substrate chain FQ30 (100 μM) 5 Linker (100μM) 6 Phosphorylated library 50 T4 ligase (10U / μL) 3 10×T4 ligase buffer 10 water Fill to 100
[0054] Example 2 Bacterial CEM Preparation
[0055] Inoculate A. actinomycetemcomitans into 5 mL of Brain-Heart Infusion Broth (BHI) liquid culture medium, shake and culture at 37°C overnight for 24 hours, take 100 ul of the above and add it to 5 ml of BHI culture medium for 48 hours, and spread the plate to determine the number of bacteria. Take 1 mL of it and centrifuge it at 11000g for 10 minutes at 4°C. Take the supernatant, which is the crude extracellular mixture of bacteria CEM, and place it in a 1.5 mL EP tube and store it at -20°C for subsequent experiments.
[0056] Example 3 In vitro screening
[0057] In vitro screening is divided into reverse screening, forward screening, PCR amplification, and library connection. Cloning and sequencing are performed after 14 rounds of screening. The specific screening steps include:
[0058] 1. Reverse screening
[0059] The chain library (SEQ ID NO: 8) purified in Example 1 was dissolved by adding 20 μL of ultrapure water and reacted in a reaction buffer solution.
[0060] Table 4. Anti-screening reaction components
[0061]
[0062]
[0063] Before the reaction, the dissolved library was heated at 90°C for 2 min and cooled to room temperature. Then 2× reaction buffer solution and water were added and the reaction lasted for 5 h.
[0064] The components of the 2× reaction buffer solution are: HEPES: 100 mM (pH 7.0), NaCl: 300 mM MgCl2: 20 mM Tween 20: 0.02% (volume fraction).
[0065] The reaction product was separated and purified by 10% denaturing polyacrylamide gel electrophoresis, and the uncut linear library was obtained by cold ethanol precipitation.
[0066] 2. Positive screening
[0067] The uncut chain library (SEQ ID NO: 8) obtained in the reverse screening was dissolved by adding 20 μL of ultrapure water, and the reaction was carried out in a reaction buffer solution containing the crude extracellular mixture.
[0068] Table 5. Positive Screening Reaction Components
[0069] Reagents Volume (μL) Chain library 20 2× reaction buffer solution 50 CEM 25 water Fill to 100
[0070] Before the reaction, the dissolved chain library was heated at 90°C for 2 min, cooled to room temperature, and then 2× reaction buffer solution, CEM and water were added. The reaction time was 2 h.
[0071] The components of the 2× reaction buffer solution are: HEPES: 100 mM (pH 7.0), NaCl: 300 mM MgCl2: 20 mM Tween 20: 0.02% (volume fraction).
[0072] The product after the reaction was separated and purified by 10% denaturing polyacrylamide gel electrophoresis, and a DNA sequence capable of cleavage was obtained by cold ethanol precipitation.
[0073] 3. PCR amplification
[0074] The DNA sequence capable of cleavage recovered by forward screening was used as a template, and the upstream primer FP and the downstream primers RP1 and RP2 were used to amplify the target sequence in large quantities by two-step PCR. The PCR product was separated and purified by 10% dPAGE. Since the downstream primer RP2 was modified with a spacer, a sense strand (76nt) and an antisense strand (96nt) of different lengths were obtained after PCR amplification. The sense strand was recovered by gel cutting and the content was determined. Among them, the sequence of the upstream primer FP is shown in SEQ ID NO: 5, and the sequences of the downstream primers RP1 and RP2 are shown in SEQ ID NO: 6 and SEQ ID NO: 7, respectively.
[0075] PCR amplification conditions
[0076] Table 6. PCR amplification conditions
[0077]
[0078]
[0079] PCR reaction system:
[0080] 1) PCR1
[0081] Table 7. PCR1 reaction conditions
[0082] Reagents Volume (μL) library 1 Upstream primer FP (100 μM) 0.5 Downstream primer RP1 (100 μM) 0.5 10× PCR buffer 5 dNTPs (2.5 mM) 1 Taq enzyme (5U / μL) 1 water Fill up to 50
[0083] 2) PCR2
[0084] Table 8. PCR2 reaction conditions
[0085] Reagents Volume (μL) Library (PCR1 product) 1 Upstream primer FP (100 μM) 0.5 Downstream primer RP2 (100 μM) 0.5 10× PCR buffer 5 dNTPs (2.5 mM) 1 Taq enzyme (5U / μL) 1 water Fill up to 50
[0086] 4. Connect to library
[0087] The positive chain (enzyme chain, PCR2 product) after PCR amplification was mixed with PNK enzyme (T4 polynucleotide kinase), incubated at 37°C for 40min to 60min, and then an equimolar amount of the synthetic substrate chain FQ30 (SEQ ID NO: 2), 1.2 times the connecting chain (SEQ ID NO: 4) and T4 ligase were added, mixed evenly, reacted at room temperature for 2 to 3h, and the DNA sequence for the next round of screening was obtained after separation and purification.
[0088] The cleavage percentage (Clv%) was calculated using the following formula to characterize the enrichment of the DNA library after each round of screening. Figure 2 After multiple rounds of screening, the cutting percentage of the forward screening showed a significant increasing trend over time. The cutting rate of the chain library in the 15th round of forward screening was about 1.3%, and the DNA library enrichment was completed.
[0089]
[0090] Where Clv% is the cleavage percentage, Clv is the amount of the cleaved band in the dPAGE gel image, and unClv is the amount of the uncut band in the dPAGE gel image. After the RNA site is broken, the fluorescence intensity of the fluorescent group in the cleaved band is amplified 6 times, so when calculating the cleavage rate, the fluorescence intensity of the cleaved band needs to be divided by 6.
[0091] After high-throughput sequencing, the top five sequences were selected for experimental verification. The DNA enzyme sequences LDD-3 (SEQ ID NO: 9) and LDD-5 (SEQ ID NO: 10) that met the target requirements were found and connected with the substrate chain FQ30 to form the corresponding probes.
[0092] Example 4 DNAzyme performance characterization
[0093] 1. Cutting ability characterization
[0094] The first five sequences obtained by sequencing were selected and linked to the fluorescent substrate FQ30 to form a chain, and then incubated in a reaction buffer solution containing the crude extracellular mixture. The samples of different enzyme chains were separated by 10% dPAGE gel, and the cleavage rate was calculated, as shown in Figure 3As shown in the gel electrophoresis diagram, it can be found that the sequences that meet the target requirements are LDD-3' (SEQ ID NO: 13) and LDD-5' (SEQ ID NO: 1).
[0095] 2. pH characterization and temperature characterization
[0096] Taking the chain DNAzyme LDD-5 as an example, at the metal ion concentration (Mg 2+ ) Under the same conditions, 6 reaction buffers with different gradient pH values, such as pH 3.5-8.5, were prepared. An equal amount of crude extracellular mixture CEM was added to each reaction buffer and incubated for 2 h. The mixture was separated by 10% dPAGE gel. Figure 4 As shown in the gel electrophoresis diagram, it can be found that the DNAzyme has a strong response to Actinobacillus actinomycetemcomitans at pH 6.5, and the response signal weakens at pH 7.5 and pH 8.5; therefore, 6.5 is selected as the pH of the buffer solution. At the same time, under the same detection conditions as above, the effect of temperature on the detection performance of the DNAzyme is evaluated, and the results are shown in Figure 5 As shown, although the cleavage activity at 45°C was improved compared with that at 37°C, considering the actual situation, 37°C was selected as the reaction condition.
[0097] 3. Specificity characterization
[0098] Taking the chain DNAzyme LDD-5 as an example, different types of bacteria were cultured to OD 600 =1, according to Example 2, crude extracellular mixtures of Gram-negative bacteria (Escherichia coli, Pseudomonas aeruginosa, Acinetobacter baumannii, Yersinia enterocolitica, Shigella dysenteriae) and Gram-positive bacteria (Bacillus cereus, Streptococcus mutans) were prepared respectively, and the chain DNA enzymes were incubated in the buffer solutions containing different crude extracellular mixtures for 2 h, and a certain amount of RNase inhibitor was added during the process. The DNA enzymes were separated by 10% dPAGE gel. Figure 6 As shown in the figure, the gel electrophoresis diagram shows that the DNAzyme has good specificity for Actinobacillus actinomycetemcomitans and has no response signal to other bacteria.
[0099] 4. Metal ion selectivity characterization
[0100] Taking the chain DNA enzyme LDD-5 as an example, after incubation in a buffer solution containing different divalent metal ions for 2 h, it was separated by 10% dPAGE gel, such as Figure 7 As shown in the gel electrophoresis diagram, it can be found that the DNAzyme is sensitive to Mg 2+ It has a strong response to other divalent metal ions, but a low response to other divalent metal ions. This shows that the action of DNAzyme requires Mg 2+ Acts as a cofactor.
[0101] 5. Target property characterization
[0102] Taking the chain DNAzyme LDD-5 as an example, the crude extracellular mixture of Actinobacillus actinomycetemcomitans was treated with SDS, EDTA, RNase inhibitor, protease and heating respectively, incubated in the reaction buffer containing DNAzyme for 2 h, and separated by 10% dPAGE gel, as shown in FIG. Figure 8 As shown in the figure, the gel electrophoresis diagram shows that after SDS and protease treatment, the DNAzyme has no signal response to Actinobacillus actinomycetemcomitans, indicating that the target that the DNAzyme can recognize is a protein; in the reaction after EDTA treatment, the response signal of the DNAzyme weakened, indicating that the action of the DNAzyme depends on divalent metal ions; in the reaction with the addition of RNase inhibitor, the DNAzyme still maintains a strong corresponding signal, indicating that the target of the crude extracellular mixture that the DNAzyme can recognize is a non-RNase protein.
[0103] Taking the chain DNAzyme LDD-5 as an example, the crude extracellular mixture and intracellular mixture of Actinobacillus actinomycetemcomitans were incubated in the reaction buffer for 2 h, and then separated by 10% dPAGE gel. Fig. 9 As shown in the figure, the gel electrophoresis shows that the response signal of DNAzyme to the intracellular mixture is weakened, indicating that its recognizable target is the protein excreted by bacteria.
[0104] 6. Target molecular weight characterization
[0105] Taking the chain DNAzyme LDD-5 as an example, ultrafiltration tubes of different sizes were used to separate the crude extracellular mixture of Actinobacillus actinomycetemcomitans into different molecular weights. After incubation in the reaction buffer containing the crude extracellular mixture of different molecular weights for 2 h, the mixture was separated by 10% dPAGE gel. Fig.10 As shown in the gel electrophoresis diagram, it can be found that the target size of Actinobacillus actinomycetemcomitans that can be recognized by the DNAzyme is between 30kDa and 100kDa.
[0106] 7. Sensitivity characterization
[0107] Taking the chain DNA enzyme LDD-5 as an example, after incubation in a buffer solution containing different concentrations of crude extracellular mixture for 2 h, it was separated by 10% dPAGE gel, as shown in FIG. Fig.11 As shown in the gel electrophoresis diagram, it can be found that the detection signal of the DNA enzyme for Actinobacillus actinomycetemcomitans in the actual reaction system can reach 10 5 CFU.
[0108] 8. Sequence truncation optimization experiment
[0109] The obtained sequence LDD-5 was simulated by software to obtain its secondary structure, and a sequence deletion experiment was performed to delete some loops therein to obtain different sequences (LDD-5.1, LDD-5.2). After incubation in a reaction buffer solution containing a crude extracellular mixture of Actinobacillus actinomycetemcomitans for 2 h, they were separated by 10% dPAGE gel, as shown in FIG. Fig.12 As shown. The cleavage rate was calculated and found to be almost the same as the original sequence. The kinetics are shown in Fig.13 shown.
[0110] The above experimental chain DNA enzymes LDD-3 and LDD-5 have similar properties.
[0111] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. A DNA enzyme probe, characterized in that: The nucleotide sequence of the DNAzyme probe is any one of the following sequences (1) to (3): (1)5'-CTATGAACTGACFRQGACCTCACTACCAAGTGGGAGTGAGGTCATTAGGGCGTTATACCATACTAGCATAACCCCTTG-3'; (2)5'-CTATGAACTGACFRQGACCTCACTACCAAGTGGGTAGTGAGGTCATTAGGGGTTATACCATACTAGCATAACCCCTTG-3'; (3)5'-CTATGAACTGACFRQGACCTCACTACCAAGATCAGACCACAACGGTTTCCCTAAAGTAGTAATGTATTTATATTATTCATAGTCTATATCATAGCATAACCCCTTG-3'; In sequence (1), sequence (2) or sequence (3), R represents RNA base A, F represents T base containing a fluorescent group, and Q represents T base containing a quenching group.
2. The DNA enzyme probe according to claim 1, characterized in that The fluorescent group is FAM.
3. The DNA enzyme probe according to claim 1, characterized in that The quenching group is BHQ1.
4. A kit for identifying Actinobacillus actinomycetemcomitans, characterized in that: The invention comprises the DNA enzyme probe according to any one of claims 1 to 3.
5. The kit according to claim 4, characterized in that The kit includes a cofactor, which is Mg 2+ .
6. Use of the DNA enzyme probe according to any one of claims 1 to 3 or the kit according to claim 4 or 5 in biosensing, characterized in that: Used to specifically identify Actinobacillus actinomycetemcomitans.
7. The use according to claim 6, characterized in that: The specific process of the application is: the DNA enzyme probe, the supernatant of the sample to be tested and the buffer solution are mixed evenly, reacted for 1 to 3 hours, and the fluorescence intensity is detected.
8. The use according to claim 7, characterized in that: The supernatant of the sample to be tested is obtained by centrifugation at 10000-15000g for 5-30 minutes.
9. The use according to claim 7, characterized in that: The conditions for the DNA enzyme probe to specifically identify Actinobacillus actinomycetemcomitans are: pH 5.5-7.5, 20-45°C.
10. The use according to claim 6, characterized in that: The response concentration of Actinobacillus actinomycetemcomitans is ≥10 5 CFU / 100μL.