Nuclear localization signal sequence construction for improving tumor cell radiotherapy sensitivity through nuclear PTEN pathway and application of nuclear localization signal sequence construction

Abstract

The invention provides nuclear localization signal sequence construction for improving tumor cell radiotherapy sensitivity through a nuclear PTEN path and application thereof, and relates to the technical field of biology. The nuclear localization signal sequence construction method for improving the radiotherapy sensitivity of the tumor cells through the nuclear PTEN way specifically comprises the following steps: firstly, extracting total RNA (Ribonucleic Acid) of the cells according to a Trizol kit specification, quantifying the RNA, then searching a human wild type PTEN gene sequence according to NCBI-genebank, selecting a PMD-T vector and pcDNA3.1 as gene vectors, and designing an N-terminal nuclear localization signal according to a genetic code; carrying out RT-PCR (Reverse Transcription-Polymerase Chain Reaction) by using a primer 1 and a primer 2 according to extracted RNA (Ribonucleic Acid) as a template, and after a PCR product is subjected to 1% agarose gel electrophoresis, showing a specific band at about 1200bp; the PTEN gene fragment is subjected to gel cutting and recovery, and then is connected with a PMD-18T vector to construct the recombinant PMD-PTEN. PTEN low-expression tumor cells are transfected through nuclear PTEN, the tumor radiotherapy sensitivity is improved, and huge benefits can be brought to tumor patients.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to the construction of a nuclear localization signal sequence for improving the radiotherapy sensitivity of tumor cells through a nuclear PTEN pathway and its application. Background Art

[0002] Malignant tumors are a disease that seriously endangers human health. The characteristic that distinguishes tumors from normal tissues and cells is that they proliferate indefinitely until the function of normal tissues is destroyed. The traditional means of treating tumors now include surgery, radiotherapy, and chemotherapy. These treatments are not specific and inevitably bring certain side effects, which become the main obstacle to the efficacy of tumor treatment. Radiotherapy is an important means of tumor treatment, and about 70% of tumor patients need to receive radiotherapy. However, because there are some important organs around the tumor, the radiotherapy dose is subject to certain restrictions. At the same time, tumor cells have greater radiotherapy resistance, which limits the efficacy and application of radiotherapy. In recent years, with the development of molecular biology technology, the use of gene technology for tumor treatment has developed rapidly. Combining gene therapy with radiotherapy can improve the radiosensitivity of tumor cells, thereby improving the local control rate and long-term survival rate of tumor patients, becoming a new way to explore tumor treatment.

[0003] Tumor gene therapy is the use of genetic engineering methods to introduce exogenous functional genes into diseased tissues or cells for expression, replacing or neutralizing the expression of abnormal genes related to tumor occurrence and development, or by changing the biological characteristics of tumor cells, improving the sensitivity to radiotherapy and chemotherapy, or enhancing the host's immune function, so as to control tumor growth and treat tumors, and improve the cure rate and survival rate of patients. In the clinical trial program of malignant tumors, the treatment methods are divided into immune gene, suicide gene and tumor suppressor gene therapy. People have found that 10q23 heterozygosity loss in many tumor cells, suggesting that there may be tumor suppressor genes there. In 1997, oncologists isolated a new gene in this region, encoding protein tyrosine phosphatase. Because its gene product has a high degree of homology with the encoded protein, it was named gene for phosphatase and tesin homologue deleted on chromosome ten (PTEN). Because this gene is mutated in many advanced tumors, it is also called MMAC 1 (mutated in multiple advanced cancerrs), that is, multiple advanced cancer mutation gene. In addition, it was found that transfer growth factor β1 (TGF2β1) can rapidly reduce the expression of this gene in epithelial cells, so it is also called TGF2β1-regulated and epithelial cell enriched phosphatase 1 (TEP 1). Therefore, PTEN, MMAC 1, and TEP 1 are the same gene.

[0004] The PTEN gene is the only tumor suppressor gene with dual phosphatase activity discovered so far, which can affect the signal transduction pathway in tumor cells. At the same time, people have found that the tumor suppressor effect of PTEN also has pathways that are independent of its phosphatase activity, the most important of which is the role of nuclear PTEN. The biological membrane divides cells into different subcellular spaces, and the subcellular localization of proteins in cells plays an important role in their biological functions. Nuclear PTEN protein plays a role in influencing tumor biology by promoting the expression of P53 protein, stabilizing P53 protein, and affecting cyclinD1. That is, the study found that the biological effect of PTEN does not completely rely on the phosphatase activity of its C-terminus, which may have important research prospects. Summary of the invention

[0005] 1. Technical solution To achieve the above objectives, the present invention is implemented by the following technical scheme: a method for constructing a nuclear localization signal sequence for improving the radiotherapy sensitivity of tumor cells through the nuclear PTEN pathway, specifically comprising the following steps: First, the total RNA of cells was extracted according to the instructions of the Trizol kit, and the RNA was quantified. Then, the human wild-type PTEN gene sequence was searched according to NCBI-genebank, and PMD-T vector and pcDNA3.1 were selected as gene vectors. According to the genetic code, the N-terminal nuclear localization signal was designed. Based on the extracted RNA as template, RT-PCR was performed with primers 1 and 2. After 1% agarose gel electrophoresis, a specific band was observed at about 1200bp for the PCR product. The above-mentioned PTEN gene fragment was recovered by gel excision and then ligated with the PMD-18T vector to construct recombinant PMD-PTEN. Using PMD-PTEN as a template, the nuclear localization signal was successfully added to the PTEN sequence using PCR technology. After the nuclear localization PTEN gene fragment was recovered by gel excision, it was ligated with the PMD-18T vector to construct recombinant PMD-NSL-PTEN.

[0006] Preferably, the N-terminal nuclear localization signal is: RRKKRK, and the N-terminal nuclear localization signal is designed according to the genetic code; the nuclear localization signal is added to the PTEN gene sequence using PCR technology; the nuclear localization signal 5-CGCGGATCCATGTCCTCTGCGTTGTCTGCGTATCCTCTTCTTTCGTCACAGCCATCATC' (containing EcoRI site).

[0007] Preferably, a method for constructing and identifying a human wild-type PTEN gene and a nuclear-localized PTEN gene comprises the following steps: using the extracted RNA as a template, performing RT-PCR with primers 1 and 2 to amplify a 1200 dp DNA fragment, ligating the recovered DNA fragment with a PMD-18T vector to construct a recombinant PMD-PTEN (human wild-type PTEN gene), performing molecular cloning and extracting plasmids, and then performing electrophoresis after EcoRI and BamHI double enzyme digestion to see that the excised fragment is 1200 dp and the sequencing is consistent; Using PMD-PTEN as a template, nuclear localization signals (NSLs) were successfully added to the PTEN sequence using PCR technology. After the nuclear localized PTEN gene fragment was excised and recovered, it was connected to the PMD-18T vector to construct recombinant PMD-NSL-PTEN (nuclear localized PTEN gene). After molecular cloning and plasmid extraction, EcoRI and BamHI double enzyme digestion and electrophoresis were performed, and the excised fragment was 1200dp, which was successfully sequenced.

[0008] Preferably, the primers 1 and 2 are designed according to the human wild-type PTEN gene sequence of gene bank, wherein primer 1, 5-CGCGGATCCATGACAGCCATCATCAAAGAG-3' (including EcoRI site); Primer 2, 5'-GGGCCGGAATTTCAGACTTTTGTAATTTGTG-3' (containing BamHI site).

[0009] Preferably, the construction method of the granulation and recombination of PMD-PTEN and PMD-NSL-PTEN includes: according to genetic engineering technology, PMD-PTEN and PMD-NSL-PTEN plasmids are double-digested with EcoRI and BamHI, and the digestion products are recovered by tapping; and they are respectively connected with pcDNA3.1 plasmids double-digested with EcoRI and BamHI to obtain pcDNA3.1-PTEN and pcDNA3.1-NSL-PTEN plasmids.

[0010] Preferably, a nuclear localization gene sequence and a nuclear localization gene obtained by the construction method according to any one of claims 1 to 5.

[0011] Preferably, the use of the nuclear localization gene sequence and the nuclear localization gene as claimed in claim 6 in the radiotherapy sensitivity of tumor cells.

[0012] (II) Beneficial effects The present invention provides a nuclear localization signal sequence construction and application for improving the radiotherapy sensitivity of tumor cells through the nuclear PTEN pathway, which has the following beneficial effects: The present invention uses PCR technology to add specific nuclear localization signals to the PTEN gene, and successfully constructs human wild-type PTEN gene and nuclear localization PTEN gene plasmid. By combining specific subcellular localization tumor suppressor genes with radiotherapy, the synergistic therapeutic effect of radiotherapy and gene therapy is exerted, providing a new approach for tumor treatment, and providing theoretical and experimental basis for the application of gene therapy-radiotherapy. By transfecting PTEN low-expressing tumor cells with nuclear PTEN, the sensitivity of tumor radiotherapy is improved, which can bring huge benefits to tumor patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 It is a schematic diagram of the sequence of the pMD-T vector of the present invention; Figure 2 It is a schematic diagram of the sequence of the pcDNA3.1 vector of the present invention; Figure 3 This is a schematic diagram of the electrophoresis results of the PTEN gene fragment of the present invention; Figure 4It is a schematic diagram of the restriction digestion results of PMD-PTEN and PMD-NLS-PTEN plasmids of the present invention; Figure 5 This is a schematic diagram of the first T-PTEN plasmid sequencing map of the present invention; Figure 6 This is a schematic diagram of the second T-PTEN plasmid sequencing map of the present invention; Figure 7-Figure 12 It is a schematic diagram of the PTEN gene sequence analysis of the present invention; Fig.13 This is a schematic diagram of the sequencing map of the first T-NSL-PTEN plasmid of the present invention; Fig.14 This is a schematic diagram of the sequencing map of the second T-NSL-PTEN plasmid of the present invention; Fig.15 The figure shows the restriction results of plasmid pcDNA3.1PTEN and plasmid pcDNA3.1NSL-PTEN of the present invention; Fig.16 This is a schematic diagram of the sequencing of the first plasmid pcDNA3.1-PTEN of the present invention; Fig.17 This is a schematic diagram of the sequencing of the second plasmid pcDNA3.1-PTEN of the present invention; Fig.18 This is a schematic diagram of the sequencing of the first plasmid pcDNA3.1-NSL-PTEN of the present invention; Fig.19 This is a schematic diagram of the sequencing of the second plasmid pcDNA3.1-NSL-PTEN of the present invention. DETAILED DESCRIPTION

[0014] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0015] The embodiment of the present invention provides a nuclear localization signal sequence construction and application thereof for improving the radiotherapy sensitivity of tumor cells through the nuclear PTEN pathway: like Figure 1-Figure 2 Choice of prokaryotic vector and eukaryotic expression vector: According to the human wild-type PTEN gene sequence searched in NCBI genebank, pMD-T vector and pcDNA3.1 were selected as gene vectors.

[0016] Design of nuclear localization signal: Based on the N-terminal nuclear localization signal: RRKKRK. According to the genetic code, the N-terminal nuclear localization signal was designed. The nuclear localization signal was added to the PTEN gene sequence using PCR technology. Nuclear localization signal 5-CGCGGATCCATGTCCTCTGCGTTGTCTGCGTATCCTCTTCTTTCGTCACAGCCATCATC' (including EcoRI site); like Figure 3 As shown, RT-PCR was performed using the extracted RNA as a template with primers 1 and 2. After 1% agarose gel electrophoresis of the PCR product, a specific band was observed at about 1200 bp, which was consistent with the predicted fragment size ( Figure 3 ). After the above PTEN gene fragment was excised and recovered, it was connected with the PMD-1 8T vector to construct recombinant PMD-PTEN. Using PMD-PTEN as a template, the nuclear localization signal (NSLs) was successfully added to the PTEN sequence using PCR technology. After the nuclear localization PTEN gene fragment was excised and recovered, it was connected with the PMD- 18T vector to construct recombinant PMD-NSL-PTEN. Among them, 1 is a 2000 base mark; 4 is a PCR product; like Figure 4 As shown in the figure, the recombinant plasmids PUM-PTEN and PUM-NSL-PTEN were double-digested with EcoRI and BamHI and then electrophoresed. The cut fragment was about 1200 bp, indicating that the PCR product had been inserted into the T vector. Figure 4 ;like Figure 5-6 The results showed that the human wild-type PTEN and nuclear localized PTEN sequences were successfully obtained. Figure 4 Middle: 1 is a 2000 base ruler; 2 is the result of restriction digestion of PUM-PTEN plasmid; 3 is the result of restriction digestion of PUM-NSL PTEN plasmid; 4 is a 10000 base ruler.

[0017] according to Figure 7-12 The results obtained are: The M-sequencing results are completely consistent with the base numbers around 337 to 1212 of the target gene. Combining the bidirectional sequencing results, the sequencing results are completely correct, and the human wild-type PTEN gene is successfully retrieved. Figure 13-14 It can be seen that according to the results of bidirectional sequencing, the nuclear localization signal (NSL) has been successfully added to the T-NSL-PTEN plasmid.

[0018] The recombinant plasmid includes: constructing and identifying pcDNA3.1PTEN and pcDNA3.1NSL-PTEN. Double-digesting pcDNA3.1 plasmid with EcoRI and BamHI, and recovering it by tapping. At the same time, tapping and recovering PTEN and NSL-PTEN fragments, connecting them, and constructing recombinant plasmids pcDNA3.1PTEN and pcDNA3.1NSL-PTEN. Double-digesting opcDNA3.1PTEN and pcDNA3.1NSL-PTEN with EcoRI and BamHI, and electrophoresis, it can be seen that the cut fragment is about 1200bp, indicating that the PTEN gene fragment and the NSLPTEN gene fragment have been inserted into the vector pcDNA3.1. Fig.15 ,in Fig.15 1 is a 2000 base ruler; 2 is the result of restriction digestion of PUM-PTEN plasmid; 3 is the result of restriction digestion of PUM-NSL-PTEN plasmid; 4 is a 10000 base ruler. Figure 16-19 It can be seen that according to the results of bidirectional sequencing, the pcDNA3.1-PTEN plasmid was successfully constructed. Specific embodiment 1 Plasmid extraction: reagent preparation Storage solution: 0.5 mol / L EDTA: weigh 4.65 g of EDTA and dissolve it in 20 ml, adjust the pH to 8.0 with NaOH, and make up to 25 ml; 1 mol / L Tris-HCl: weigh 6.057 g of Tris base and dissolve it in 40 ml, adjust pH to 8.0 with HCl, and make up to 50 ml; 10% SDS: weigh 10g SDS and dissolve it in 90ml water, add HCl to adjust pH to 7.2, and make up to 100ml; 2 mol / L NaOH: Weigh 4 g of NaOH and dissolve it in 50 ml of high-pressure double-distilled water; 5 mol / L KAc: weigh 24.57 g of KAc and dissolve it in 100 ml high pressure double distilled water; 0.1 mol / L NaCl: weigh 4.68 g NaCl and dissolve it in 50 ml double distilled water; 3 mol / L NaAc: weigh 6.16 g of NaAc and dissolve it in 20 ml. Adjust the pH to 7.0 with glacial acetic acid and make the volume 25 ml. TE: add 1 mol / L Mix 1 ml Tris-HCl and 200ul 0.5 mol / L EDTA and adjust the volume to 100 ml; 10mg / ml RNaseA stock solution: Weigh 25 mg of RNase A, dissolve it in 2 ml of double distilled water, inactivate it at 100°C for 10 min, and then dilute it with double distilled water to 1 mg / ml. Aliquot and store at -20℃.

[0020] Application fluid: STE: 0.1 mol / L NaCl, 10 mmol / L Tris-Cl (pH 8.0), 1 mmol / L EDTA; Solution I: 50 mmol / L glucose, 25 mmol / LTris-HCl (pH 8.0), 10 mmol / L EDTA; Solution II: 0.2 mol / L NaOH, 1% SDS (freshly prepared); Solution III: 5 mol / L KAc 60 ml, glacial acetic acid 11.5 ml, dissolved in 28.5 ml double distilled water.

[0021] Plasmid extraction (Aixijin plasmid extraction kit) Pick a single clone colony and place it in 3ml LB medium, shake it in a 37℃ water bath overnight (180r / min), take 3ml bacterial solution at 12000r / min, centrifuge for 1 minute, discard the supernatant, and collect the bacteria; resuspend the bacteria with 250μl solution I to ensure that the bacteria are completely suspended; add 250ul freshly prepared solution II, cover the centrifuge tube tightly, and gently turn the centrifuge tube upside down to mix; after the wire drawing phenomenon is seen, add 350ul ice-cold solution II, turn it upside down to mix, and centrifuge at 10000 r / min for 10 min; place the centrifuge column in a 2ml centrifuge tube, transfer the supernatant into the centrifuge column, and centrifuge at 12000 r / min, centrifuge for 1 min; discard the filtrate, add 500ul elution buffer W1, 12000r / min, centrifuge for 1 min; discard the filtrate, add 700μl elution buffer W2, 12000r / min, centrifuge for 1 min; place the centrifuge column in a 1.5ml centrifuge tube, add 80ul Eluent, let stand at room temperature for 1 min, 12000r / min, centrifuge for 1 min, and perform electrophoresis and enzyme digestion identification.

[0022] Embodiment 2 Construction of recombinant expression vector: extraction of total RNA from tissues and cells; Extract total cellular RNA according to the instructions of the Trizol kit. The specific steps are as follows: Take fresh placental tissue, take 100 mg, add 1 ml of Trizol, grind with a grinder, incubate at room temperature for 5 minutes. Note that the total volume of the sample cannot exceed 10 times the volume of Trizol used, add 200 ul of chloroform: isoamyl alcohol (24:1), cover the centrifuge tube tightly, shake the centrifuge tube vigorously by hand for 15 seconds, and place it at room temperature for 10 minutes. Centrifuge at 4℃, 10000 r / min for 20 minutes, and aspirate the supernatant into another eppendorf tube. Add 0.6 times the volume of isopropanol, place it at room temperature for 10 minutes, centrifuge at 4℃, 10000 r / min for 20 minutes, discard the supernatant, add at least 1 ml of 75% ethanol per ml of Trizol solution, vortex to mix, centrifuge at 7500g for 5 minutes at 4℃, carefully discard the supernatant, and then dry it at room temperature or in a vacuum for 5~10 minutes. Be careful not to dry it too much, otherwise it will reduce the solubility of RNA. Then dissolve the RNA in water, and if necessary, dissolve it in water at 55~60℃ for 10 minutes. RNA can be separated from mRNA, or stored in 70% ethanol and stored at -70℃. The homogenate before adding chloroform can be stored at -70℃ for more than one month, and the RNA precipitate in 70% ethanol can be stored at 4℃ for one week and -20℃ for one year. Discard the cell culture medium, wash twice with PBS, add 1ml Trizol to each two wells, blow off the cells, collect them in a 1.5ml EP tube, aspirate repeatedly, let it stand at room temperature for 5 minutes, add 200ul chloroform: isoamyl alcohol (24:1), shake the centrifuge tube vigorously by hand for 15 seconds, and let it stand at room temperature for 10 minutes. Centrifuge at 4℃ and 10000 r / min for 20 minutes, and aspirate the supernatant into another eppendorf tube. Add 0.6 times the volume of isopropanol, let it stand at room temperature for 10 minutes, centrifuge at 4℃ and 10000r / min for 20 minutes, and aspirate the supernatant. Wash the precipitate with 1 ml 75% ethanol, centrifuge for 10 min as above, discard the supernatant, dry the precipitate at room temperature for 15 min, dissolve it in RNase-free water, and store it at -70°C for later use.

[0023] Quantification of RNA: Take 1 μl RNA, dilute it 100 times, and use a UV-visible spectrophotometer to detect the absorbance values ​​of A260 and A280. If the ratio of A260 / A280 is between 1.8 and 2.0, it means that the RNA purity is high. At this time, 1A260 is equivalent to 40ug / ml single-stranded DNA or RNA. The RNA concentration is calculated as follows: Concentration (ug / ml) = A260 x dilution times x 40. After quantification, store it at -20°C.

[0024] Embodiment 3 Primer design and synthesis: PCR primers were designed according to the human wild-type PTEN gene sequence in the gene bank: primer 1, 5-CGCGGATCCATGACAGCCATCATCAAAGAG-3' (containing EcoRI site); primer 2, 5'-GGGCCGGAATTTCAGACTTTTGTAATTTGTG-3' (containing BamHI site); nuclear localization signal 5-CGCGGATCCATGTCCTCTGCGTTGTCTGCGTATCCTCTTCTTTCGTCACAGCCATCATC' (containing EcoRI site) The wild-type PTEN gene was obtained by RT-PCR: Template RNA 5 μl; Ologo(dT)18 Primer(50μM) 1μl; After keeping at 70℃ for 10 minutes, quickly cool on ice for more than 2 minutes; centrifuge for a few seconds to allow the denatured solution of template RNA / primer to accumulate at the bottom of the centrifuge tube; follow the following reaction system Template RNA / primer denaturation solution 6 μl 5×M-MLV Buffer 2μl dNTP Mixture (10μM) 10μl RNase Inhibitor 0.25μl RTase M-MLV 1 μl RNase free dH2O 0.75μl Incubate at 42℃ for 1 hour; incubate at 70℃ for 15 minutes and then quickly cool on ice. The total volume of PCR reaction is 25μl: template 1μl, upper and lower primers of human PTEN gene 0.5μl, 10×PCR buffer 2.5μl, dNTP 2.5μl, MgCl2 1.5μl, sterile ddH2O 16μl, Taq DNA polymerase 0.5μl. Reaction conditions: 94℃, 40s, 57℃, 30s, 72℃, 72s, 30 cycles, and then extend at 72℃ for 30 minutes.

[0025] Among them, rubber tapping recovery (Aixijin rubber tapping recovery kit): Cut the DNA agarose containing the target fragment under UV light, absorb the liquid on the surface of the gel with a paper towel and chop it. Calculate the weight of the gel (record the weight of the 1.5ml centrifuge tube in advance), and use this weight as a gel volume (100mg=100μl volume); add 3 gel volumes of Buffer DE-A, mix well, and heat at 75℃, mixing intermittently until the clot is completely melted; add 0.5 Buffer DE-A of Buffer DE-B, mix well; transfer the liquid to the DNA preparation tube, centrifuge at 12000r / min for 1min, and discard the filtrate; return the preparation tube to the centrifuge tube, add 500μl of elution buffer W1, centrifuge at 12000r / min for 30 seconds, and discard the filtrate; return the preparation tube to the centrifuge tube, add 700μl of elution buffer W2, centrifuge at 12000r / min for 30 seconds, discard the filtrate; add 700μl elution buffer buffer W2, 12000r / min, centrifuge for 1min, discard the filtrate; put the preparation tube back into the 2ml centrifuge tube, 12000r / min, centrifuge for 1min; put the preparation tube back into the 1.5ml centrifuge tube, add 30μl deionized water preheated to 65℃ in the center of the DNA preparation tube, let stand at room temperature for 1 minute, 12000r / min, centrifuge for 1min, elute DNA.

[0026] And the T carrier connection: Add 5 μl (equal amount) of Solution I; react at 16°C for 60 minutes; add the full amount (10 μl) to 100 μl JM109 competent cells and place on ice for 30 minutes; heat at 42°C for 45 seconds, and place on ice for 1 minute; add 890 μl SOC medium and culture at 37°C with shaking for 60 minutes; culture on L-agar plate medium containing Amp to form single colonies, count the colonies, select the colonies, and use PCR to confirm the length of the inserted fragment in the vector.

[0027] Ligation reaction: Mix the plasmid vector DNA (cut with appropriate restriction enzymes and dephosphorylated if necessary) with the insert DNA fragment to prepare a 5-10 μl DNA solution (TE solution or aqueous solution). The molar ratio of vector DNA to insert DNA is generally 0.1-0.3 pmol. 0.03 pmol of pUC18 DNA is approximately 50 ng; add an equal volume (5-10 μl) of Solution I to the above DNA solution and mix thoroughly. React at 16°C for 30 minutes; the reaction solution can be used directly for bacterial transformation. Add 10-20 μl of the reaction solution to 100 μl of competent cells.

[0028] Identification of recombinants: Rapid colony PCR identification of recombinants; Transform the ligation product into DH5α, spread it evenly on a solid culture medium containing ampicillin, and culture it at 37°C for 12-16h. Pick up the ampicillin-resistant colonies with a sterile toothpick, inoculate them into the corresponding numbered culture tubes containing 5ml LB containing ampicillin, and culture them overnight on a shaker at 37°C with vigorous shaking (250 r / min). The next day, use 5μl of bacterial solution as a template and add the primers of the target gene for colony PCR. Perform 1.0% agarose gel electrophoresis on the PCR product. When the bromophenol blue indicator electrophoreses to 2 / 3 of the total length of the gel, observe the position of the PCR product fragment under ultraviolet light. When the size of the DNA-specific band indicated by the DL2000 marker is basically consistent with that of the target gene fragment, it can be preliminarily determined that the target gene has been successfully cloned.

[0029] Recombinant digestion screening and identification: Extract a small amount of plasmid DNA from the positive recombinants identified above. Select EcoRI and BamHI restriction endonucleases for double digestion at 30°C, and analyze by 1% agarose gel electrophoresis. The digestion fragments obtained are exactly the same length as the target gene, which is the target recombinant plasmid.

[0030] The present invention uses PCR technology to add a nuclear localization signal to the PTEN sequence, so that the PTEN protein is specifically expressed in the cell nucleus, and combined with ionizing radiation, the differences in biological effects between control cells and transfected wild-type PTEN tumor cells are compared, and its biological mechanism is explored, so as to explore new ways for gene combined with radiation therapy and provide theoretical basis and experimental basis.

[0031] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A method for constructing a nuclear localization signal sequence that improves the radiotherapy sensitivity of tumor cells through the nuclear PTEN pathway, characterized in that: The specific steps include: First, total cellular RNA was extracted and quantified according to the Trizol kit instructions. The human wild-type PTEN gene sequence was then searched in NCBI-genebank. PMD-T vector and pcDNA3.1 were selected as gene vectors. The N-terminal nuclear localization signal was designed based on the genetic code. RT-PCR was performed using extracted RNA as a template with primers 1 and 2. After electrophoresis on a 1% agarose gel, a specific band was observed at approximately 1200 bp. The PTEN gene fragment was recovered from the gel and ligated with the PMD-18T vector to construct recombinant PMD-PTEN. Using PMD-PTEN as a template, a nuclear localization signal was successfully added to the PTEN sequence using PCR. The nuclear-localized PTEN gene fragment was recovered from the gel and ligated with the PMD-18T vector to construct recombinant PMD-NSL-PTEN.

2. The method for constructing a nuclear localization signal sequence for enhancing the radiotherapy sensitivity of tumor cells via the nuclear PTEN pathway according to claim 1, characterized in that: The N-terminal nuclear localization signal: RRKKRK, according to the genetic code, the N-terminal nuclear localization signal is designed; the nuclear localization signal is added to the PTEN gene sequence using PCR technology; the nuclear localization signal 5-CGCGGATCCATGTCCTCTGCGTTGTCTGCGTATCCTCTTCTTTCGTCACAGCCATCATC' (containing the EcoRI site).

3. A method for constructing and identifying a human wild-type PTEN gene and a nuclear-localized PTEN gene, characterized by: The following steps are included: Using the extracted RNA as a template, RT-PCR was performed with primers 1 and 2 to amplify a 1200 dp DNA fragment. The recovered DNA fragment was ligated into the PMD-18T vector to construct recombinant PMD-PTEN (human wild-type PTEN gene). Molecular cloning and plasmid extraction were performed, followed by EcoRI and BamHI double enzyme digestion and electrophoresis. A 1200 dp fragment was excised, which was consistent with sequencing results. Using PMD-PTEN as a template, nuclear localization signals (NSLs) were successfully added to the PTEN sequence using PCR technology. After gel excision and recovery, the nuclear-localized PTEN gene fragment was ligated with the PMD-18T vector to construct recombinant PMD-NSL-PTEN (nuclear-localized PTEN gene). After molecular cloning and plasmid extraction, EcoRI and BamHI double enzyme digestion and electrophoresis were performed, and the excised fragment was 1200dp, which was successfully sequenced.

4. The method for constructing and identifying a human wild-type PTEN gene and a nuclear-localized PTEN gene according to claim 3, characterized in that: The primers 1 and 2 were designed based on the human wild-type PTEN gene sequence in the gene bank, wherein the primer 1 was 5-CGCGGATCCATGACAGCCATCATCAAAGAG-3' (containing the EcoRI site); Primer 2, 5'-GGGCCGGAATTTCAGACTTTTGTAATTTGTG-3' (containing BamHI site).

5. The method for constructing and identifying a human wild-type PTEN gene and a nuclear-localized PTEN gene according to claim 3, characterized in that: The method for constructing the granulation and recombinant PMD-PTEN and PMD-NSL-PTEN comprises: according to genetic engineering technology, performing EcoRI and BamHI double enzyme digestion on the PMD-PTEN and PMD-NSL-PTEN plasmids, respectively, and recovering the digestion products by tapping; and respectively connecting with the pcDNA3.1 plasmid double enzyme digestion with EcoRI and BamHI to obtain pcDNA3.1-PTEN and pcDNA3.1-NSL-PTEN plasmids.

6. A nuclear localization gene sequence and a nuclear localization gene obtained by the construction method according to any one of claims 1 to 5.

7. Use of the nuclear localization gene sequence and the nuclear localization gene according to claim 6 in sensitizing tumor cells to radiotherapy.

Images