DsRNA (double-stranded ribonucleic acid) of silkworm glucose regulatory protein 78 gene and preparation method of dsRNA
By preparing dsRNA of silkworm glucose regulatory protein 78 gene, RNA interference technology interferes with the BmGRP78 gene, the problem of interference with traditional chemical prevention and control on silk gland cells is solved, the silk production efficiency and disease resistance are improved, and the cleanliness of raw silk is ensured.
Patent Information
- Application Number
- CN202510424091.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-07
- Publication Date
- 2025-07-08
AI Technical Summary
Traditional chemical prevention and control has potential interference with the specific function of silk gland cells, and drug residues may affect the cleanliness of raw silk.
DsRNA of the silkworm glucose regulatory protein 78 gene was designed and prepared, and the BmGRP78 gene expression was interfered with RNA interference technology, optimize silk production and improve disease resistance.
Effectively reduce the expression of BmGRP78 gene, improve silk production efficiency and disease resistance, avoid side effects of chemical prevention and control, and ensure the cleanliness of raw silk.
Smart Images

Figure CN120272482A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of genetic engineering, and specifically relates to a dsRNA of the Bombyx mori glucose-regulated protein 78 gene and a preparation method thereof. Background Art
[0002] As the core bioreactor for silk production, the physiological health and silk gland development efficiency of Bombyx mori directly determine the yield and quality of textile raw materials. In large-scale breeding, the developmental retardation and metabolic disorders caused by pathogen infections not only lead to a thinner cocoon layer and hindered fibroin synthesis, but also cause significant fluctuations in the productivity of silkworms. Traditional chemical control has potential interference with the specific functions of silk gland cells, and drug residues may affect the cleanliness of raw silk, which has prompted the industrial community to focus on the development of precise regulation technologies at the gene level.
[0003] RNA interference (RNAi) technology provides an innovative tool for the directional optimization of the silk biosynthesis system. By designing double-stranded RNAs targeting silk gland development regulatory genes, precise improvement of key production traits such as extended silk protein secretion cycle and enhanced silk gland cell proliferation can be achieved. For example, RNAi intervention targeting the interaction mechanism between the BmNPV virus and GRP78 can not only effectively block pathogen replication, but also maintain the endoplasmic reticulum homeostasis of the silk gland, ensuring the correct folding and efficient secretion of fibroin proteins. The unique programmability of this technology supports the construction of multi-gene regulatory networks, enabling synchronous optimization of disease resistance traits and silk production performance - such as extending the larval growth period by interfering with genes related to juvenile hormone metabolism, significantly increasing the single-cocoon silk weight; or inhibiting the expression of sericin-degrading enzymes to improve the reelability of cocoon silk. Compared with traditional agents, the efficient metabolism characteristics of RNA molecules in silkworms can not only avoid the side effects of chemical control measures on silk substance synthesis, but also provide a customizable solution for the creation of high-yield and high-quality silkworm varieties through the flexible combination of gene editing breeding and feeding administration. Summary of the Invention
[0004] Aiming at the deficiencies of the prior art, the present invention provides a dsRNA of the Bombyx mori glucose-regulated protein 78 gene and a preparation method thereof, which solve the problems that traditional chemical control has potential interference with the specific functions of silk gland cells and drug residues may affect the cleanliness of raw silk.
[0005] To achieve the above objectives, the present invention is realized through the following technical solutions: A dsRNA of the Bombyx mori glucose-regulated protein 78 gene, wherein the nucleotide sequence of the dsRNA is SEQ ID NO:2.
[0006] A preparation method of a dsRNA of the Bombyx mori glucose-regulated protein 78 gene, comprising the following steps:
[0007] a) By analyzing the silkworm genome database and applying bioinformatics techniques, the BmGRP78 gene sequence was screened and obtained. After sequence alignment and splicing verification, specific amplification primers were designed and chemically synthesized.
[0008] b) Fifth-instar larvae with good physiological status and equal body size were selected. After being frozen and ground in liquid nitrogen, RNA was extracted. After obtaining the cDNA template by reverse transcription, PCR amplification was carried out using the upstream and downstream primers of the BmGRP78 gene. The obtained product was purified, cloned and transformed into Escherichia coli, and verified by sequencing. Finally, the complete gene sequence shown in SEQ ID NO:1 was obtained.
[0009] c) dsRNA amplification primers carrying the T7 promoter sequence were designed according to the sequence of the BmGRP78 gene (SEQ ID NO:1), and its upstream primer and downstream primer corresponded to SEQ ID NO:3 and SEQ ID NO:4 respectively.
[0010] d) Using the Escherichia coli of the BmGRP78 gene cloning vector as a template, SEQ ID NO:3 and SEQ ID NO:4 as the upstream and downstream primers, PCR amplification was carried out. The obtained product was purified and then subjected to in vitro transcription to obtain the target dsRNA.
[0011] Preferably, in step d, the purification treatment is carried out using the FastPure Gel DNA Extraction Mini Kit kit, and the in vitro transcription is carried out according to the operation specifications of the T7 RNAi Transcription Kit kit.
[0012] An application of dsRNA of the silkworm glucose-regulated protein 78 gene, which can specifically inhibit the expression of the BmGRP78 gene and is used for optimizing silk production and enhancing disease resistance innovation of silkworms.
[0013] The present invention provides a dsRNA of the silkworm glucose-regulated protein 78 gene and a preparation method thereof. It has the following beneficial effects:
[0014] 1. Compared with the prior art, the present invention has the outstanding effect of gene knockdown efficiency. The experimental results prove that this dsRNA can effectively reduce the expression of the BmGRP78 gene in silkworm ovarian cells (BmN) and silk glands. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] Figure 1 It is a result comparison diagram of the transcriptional influence of the BmGRP78 gene after the BmN cells in the test of the embodiment of the present invention are transfected with dsBmGRP78 and dsEGFP with the nucleotide sequence of SEQ ID NO:2 respectively for 48 hours.
[0016] Figure 2 This is a control chart of the results of the transcriptional influence of the BmGRP78 gene in the silk gland of silkworms 72 hours after injecting dsBmGRP78 with the nucleotide sequence of SEQ ID NO: 2 and dsEGFP into the fifth instar day-old silkworms in the experiment of the embodiment of the present invention.
[0017] Figure 3 This is a flow chart of the preparation method of the present invention. Detailed implementation manners
[0018] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.
[0019] Embodiment:
[0020] Please refer to the attached Figure 1 - attached Figure 3 In the embodiment of the present invention, a dsRNA of the glucose-regulated protein 78 gene of silkworms is provided, and the nucleotide sequence of the dsRNA is SEQ ID NO: 2.
[0021] A preparation method of a dsRNA of the glucose-regulated protein 78 gene of silkworms includes the following key steps:
[0022] a. Gene sequence acquisition: Based on the silkworm genome database, the BmGRP78 gene is screened using bioinformatics technology, and the complete sequence of the BmGRP78 gene (SEQ ID NO: 1) is obtained through sequence alignment and splicing. The upstream primer sequence and the downstream primer sequence are designed using Primer Premier5 software and sent to Shanghai Sangon Biotech Co., Ltd. for synthesis;
[0023] b. Preparation of cDNA template: Healthy fifth-instar larvae were selected, frozen and ground in liquid nitrogen. RNA was extracted using the FastPure Cell / Tissue Total RNA Isolation Kit. The extracted RNA was reverse-transcribed into cDNA using the HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper). Using this cDNA as a template, upstream and downstream primers for the BmGRP78 gene were designed and used for PCR amplification to obtain the full-length fragment of the BmGRP78 gene. The resulting product was purified, cloned and transformed into Escherichia coli, and then sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The sequencing results were compared with the genomic search results to verify and obtain the full-length nucleotide sequence of this gene, and its nucleotide sequence is SEQ ID NO:1;
[0024] c. Design of dsRNA primers: According to the BmGRP78 gene sequence SEQ ID NO:1, the upstream and downstream primers for dsRNA were designed using Primer Premier 5 software, and their sequences are SEQ ID NO:3 and SEQ ID NO:4 respectively. Both the upstream and downstream primers carry the T7 promoter sequence, and all primers were sent to Shanghai Sangon Biotech Co., Ltd. for synthesis;
[0025] d. In vitro synthesis of dsRNA: PCR amplification was carried out using the Escherichia coli clone vector of the BmGRP78 gene as a template, with SEQ ID NO:3 and SEQ ID NO:4 as the upstream and downstream primers. After amplification by PCR, the amplified product was purified using the FastPure Gel DNA Extraction Mini Kit and then subjected to in vitro transcription synthesis of dsRNA according to the T7 RNAi Transcription Kit. It was quantified to 3.0 μg / μl using NanoDrop and stored in an -80°C ultra-low temperature freezer for later use (dsEGFP was used as a negative control).
[0026] This dsRNA molecule has application value in the fields of optimizing silk production and enhancing disease resistance in silkworms.
[0027] The gene silencing activity of BmGRP78 gene dsRNA was verified by the following experiment:
[0028] 1. Individual dsBmGRP78 interference experiment
[0029] Thirty healthy fifth-instar day-1 silkworm larvae were selected. Using a 25-μl micro-syringe, 5 μl of the synthesized dsBmGRP78 (1 ng / μl) was gently injected into the dorsal segments of the silkworm larvae. Meanwhile, 30 silkworms were selected as the control group, and the same volume and concentration of dsEGFP were injected into the control group. The experimental group and the control group were raised in a standard environment (25 ± 1 °C, 75% humidity, 12-hour light: 12-hour dark), and fresh mulberry leaves were fed every day.
[0030] After 72 hours, samples were taken from the silkworms in the experimental group and the control group. The midgut, fat body, and silk gland tissues of the silkworms were obtained by dissection, and total RNA was extracted after grinding with liquid nitrogen and then reverse-transcribed into the first-strand cDNA. The relative expression levels of the target gene BmGRP78 and the reference gene BmRP49 in each tissue of the silkworm were detected by RT-qPCR respectively.
[0031] 2. dsBmGRP78 interference experiment on silkworm ovarian cells
[0032] In this experiment, the experimental group (dsBmGRP78) and the control group (dsEGFP) were set up. BmN cells in the logarithmic growth phase were taken and inoculated into 6-well plates, and cultured in an incubator until 80% confluence. dsBmGRP78 and dsEGFP were transfected into BmN cells by liposome transfection. After 48 hours of transfection, the levels of the target gene BmGRP78 and the reference gene BmRP49 in the cells of the experimental group and the control group were detected by RT-qPCR respectively.
[0033] The experimental results showed that the RNA interference technology mediated by dsBmGRP78 could effectively down-regulate the expression level of GRP78 in BmN cells and silk glands of silkworms. The protection scope of the present invention is defined by the claims, and the embodiments in the specification shall not be construed restrictively.
[0034] Sequence Listing
[0035] SEQ ID NO:1
[0036]
[0037] SEQ ID NO:2
[0038] TCCAGTCACCAGGTCAAGATCGAAATTGAATCATTCTTTGAAGGTGATGACTTCTCTGAAACCCTCACCAGAGCTAAATTTGAAGAATTGAACATGGACCTCTTCAGATCCACTTTGAAACCTGTGCAGAAAGTATTAGAAGATGCTGACATGAACAAGAAGGATGTTGATGAAATTGTGTTAGTAGGAGGCTCTACCCGTATCCCTAAGGTTCAACAACTGGTCAAGGAATTCTTCAATGGCAAGGAACCATCTCGTGGAATTAACCCTGATGAGGCTGTCGCATATGGTGCTGCTGTGCAGGCTGGTGTACTCAGTGGTGAACAAGATACTGATGCTATTGTCTTGCTTGATGTCAACCCTCTGACCATGGGTATTGAAACTGTTGGTGGAGTGATGACCAAACTGATTCCTCGTAACACTGTCATTCCAACTAAGAAATCTCAGATCTTCTCTACTGCCAGTGACAACCAACACACTGTCACTATCCAAGTGTACGAGGGTGAGCGACCAATGACCAAGGACAATCATTTACTTGGTAAATTTGACTTAACTGGGATCCCTCCTGCTCCTCGTGGTATTCCACAAATTGAAGTCACATTTGAAATTGATGCCAACGGTATTTTGCAAGTGTCTGCTGAAGATAAGGGAACAGGAAACAGGGAAAAGATTGTAATCACTAATGACCAGAACAGACTGACACCTGAAGATATTGAAAGAATGATTAAGGATGCTGAGAAGTTTGCCGAT
[0039] SEQ ID NO:3
[0040] TAATACGACTCACTATAGGGTCCAGTCACCAGGTCAAGATC
[0041] SEQ ID NO:4
[0042] TAATACGACTCACTATAGGGATCGGCAAACTTCTCAGCATC
[0043] Although embodiments of the present invention have been shown and described, it will be understood by those of ordinary skill in the art that various changes, modifications, substitutions and variations can be made to these embodiments without departing from the principles and spirit of the present invention, and the scope of the present invention is defined by the appended claims and their equivalents.
Claims
1. A dsRNA of the Bombyx mori glucose-regulated protein 78 gene, characterized in that, The dsRNA molecule contains the nucleotide sequence shown in SEQ ID NO:
2.
2. The preparation method of the dsRNA of the Bombyx mori glucose-regulated protein 78 gene according to claim 1, characterized in that, It includes the following steps: S1. Gene sequence screening and specific primer design: By analyzing the silkworm genome database and using bioinformatics techniques, the BmGRP78 gene sequence was screened. After sequence alignment and splicing verification, specific amplification primers were designed and chemically synthesized. S2. RNA extraction and gene cloning sequencing verification: Fifth-instar larvae with good physiological status and equal body size were selected. After grinding in liquid nitrogen and quick-freezing, RNA was extracted. After obtaining the cDNA template by reverse transcription, PCR amplification was carried out using the upstream and downstream primers of the BmGRP78 gene. The obtained product was purified, cloned and transformed into Escherichia coli, and verified by sequencing. Finally, the complete gene sequence shown in SEQ ID NO: 1 was obtained. S3. Specific dsRNA primer design and T7 promoter integration: According to the sequence of the BmGRP78 gene (SEQ ID NO: 1), dsRNA amplification primers carrying the T7 promoter sequence were designed, and its upstream primer and downstream primer corresponded to SEQ ID NO: 3 and SEQ ID NO: 4 respectively. S4. In vitro transcription and preparation of dsRNA: Using the Escherichia coli of the BmGRP78 gene cloning vector as the template, SEQ ID NO: 3 and SEQ ID NO: 4 as the upstream and downstream primers, PCR amplification was carried out. The obtained product was purified and then subjected to in vitro transcription to obtain the target dsRNA.
3. The preparation method of dsRNA of the Bombyx mori glucose-regulated protein 78 gene according to claim 2, characterized in that, In step d, the purification treatment uses the FastPure Gel DNA Extraction Mini Kit kit, and the in vitro transcription is carried out according to the operation specifications of the T7 RNAi Transcription Kit kit.
4. Use of the dsRNA of the Bombyx mori glucose-regulated protein 78 gene according to claim 1, characterized in that, This dsRNA can specifically inhibit the expression of the BmGRP78 gene and is used for optimizing silk production in silkworms.