A SNP molecular marker for identifying the genetic sex of copper fish and its application

Abstract

The present invention discloses a SNP molecular marker for identifying the genetic sex of copper fish and its application. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1. The SNP molecular marker includes a SNP site, and the SNP site is located at the 501st base at the 5' end of the SNP molecular marker. The present invention can complete the identification of the sex of copper fish through PCR amplification and Sanger sequencing. Compared with other molecular identification methods that are cumbersome and time-consuming, the present invention is more suitable for rapid identification of large quantities of copper fish samples. More importantly, the SNP site according to the present invention can simply and accurately identify the sex of copper fish, and does not require dissection of the copper fish, and basically does not affect the health status of the copper fish samples being tested.

Description

Technical Field

[0001] The invention belongs to the technical field of fish sex identification, and particularly relates to a SNP molecular marker for identifying the genetic sex of copper fish and an application thereof. Background Art

[0002] Bleeker (Coreius heterodon (Bleeker)), a member of the genus Coreius, belongs to the Cypriniformes order, Cyprinidae family, subfamily Gobioninae. Commonly known as golden loach, pointed-headed loach, or oily copper, it is endemic to the Yangtze River and is found throughout the main stream and its tributaries. Bleeker is known for its high fat content, delicious flavor, and nutritional value, making it a promising and promising fish for development.

[0003] Currently, large-scale artificial domestication and breeding of copperfish has been achieved, and large-scale artificial aquaculture is in its infancy. The development and application of sex-specific molecular markers and the identification of sex-determining genes can help identify economic traits related to sex, providing essential tools for sex-controlled breeding. Furthermore, they lay the foundation for elucidating the molecular mechanisms of sex determination in fish. Sex molecular markers are an important tool in the development of sex control technologies and can also be used to determine the sex ratio of fish catches without dissecting experimental fish. Summary of the Invention

[0004] Based on the above-mentioned prior art, the present invention provides a SNP molecular marker for identifying the genetic sex of copper fish and its application. The present invention realizes accurate and rapid sex identification of copper fish samples without dissecting the copper fish.

[0005] The technical solution adopted to achieve the above-mentioned purpose of the present invention is:

[0006] A SNP molecular marker for identifying the genetic sex of copper fish, wherein the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO.1, the SNP molecular marker comprises a SNP site, and the SNP site is located at the 501st base at the 5' end of the SNP molecular marker.

[0007] Furthermore, when the 501st base is G / A heterozygous, the copper fish sample is female, and when it is G / G homozygous, the copper fish sample is male.

[0008] A primer for identifying the genetic sex of copper fish, comprising:

[0009] Upstream primer F: GACAGATGATGCCGCCTCCAC, SEQ ID NO.2

[0010] Downstream primer R: ACCTCGTCGTGTCGTGTTAT, SEQ ID NO.3.

[0011] A reagent or kit for identifying the genetic sex of copper fish comprises the primers.

[0012] The application of the SNP molecular marker, primer, reagent or kit in identifying the genetic sex of copper fish.

[0013] A method for identifying the genetic sex of copper fish comprises the following steps:

[0014] S1, collect copper fish sample to be tested, carry out DNA extraction on the copper fish sample to be tested, obtain genomic DNA of the copper fish sample to be tested;

[0015] S2. Using the DNA of the copper fish sample to be tested as a template, a PCR amplification reaction is performed using the primers described in claim 3;

[0016] S3. After the PCR amplification reaction is completed, the sequence information of the PCR amplification product is analyzed to determine the genotype of the copper fish sample to be tested and identify the sex;

[0017] When the 501st base at the 5' end of the nucleotide sequence shown in SEQ ID NO.1 in the amplified product is G / A heterozygous, the gender of the copper fish sample to be tested is female; when the 501st base is G / G homozygous, the gender of the copper fish sample to be tested is male.

[0018] Furthermore, in step S2, the PCR amplification system includes 15 μL of 2*Taq MasterMix, 2 μL of upstream primer F, 2 μL of downstream primer R, 10 μL of ddH2O, and 1 μL of DNA template.

[0019] Furthermore, the reaction conditions for PCR amplification in step S2 are: pre-denaturation at 95°C for 5 min; then 35 cycles, including 94°C for 30 s, denaturation at 95°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s; then final extension at 72°C for 5 min; and finally, holding at 16°C for 1 min.

[0020] Furthermore, in step S3, the method for determining the genotype of the copper fish sample to be tested is Sanger sequencing.

[0021] Compared with the prior art, the advantages and beneficial effects of the present invention are:

[0022] 1. The present invention can complete the identification of copper fish sex through PCR amplification and Sanger sequencing. Compared with other molecular identification methods that are cumbersome and time-consuming, the present invention is more suitable for rapid identification of large quantities of copper fish samples. More importantly, the SNP loci based on the present invention can simply and accurately identify the sex of copper fish without the need for dissection of the copper fish and substantially does not affect the health of the copper fish samples being tested.

[0023] 2. The accuracy of the copper fish sex identification method of the present invention is very high. Experiments show that the accuracy rate can reach 100%.

[0024] 3. The present invention is an important method for developing sex control technology, which helps to optimize economic traits related to sex.

[0025] 4. The present invention discovered for the first time the SNP molecular marker for identifying the sex of copper fish, filling the gap in the sex marker gene of copper fish. DETAILED DESCRIPTION

[0026] The present invention will be described in detail below with reference to specific embodiments, which should not be construed as limiting the present invention.

[0027] Example 1 (Development and Verification of Sex-Specific SNP Molecular Markers in Copper Fish)

[0028] Comparative analysis of 2b-RAD sequencing data from 90 male and female copperfish from three farmed populations in Hubei Province revealed a large number of single-nucleotide polymorphisms (SNPs) between male and female fish. Screening and validation of SNP markers associated with sex differences in copperfish revealed one SNP located at base 46,620,661 on chromosome 4, which exhibited accurate male-female specificity.

[0029] The results are shown in Table 1, which shows that the sequences from female fish have two bases, G / A, at the SNP site shown in Table 1, while the sequences from male fish do not have SNP polymorphism at this site, and the base at this site in all sequences is G.

[0030] Table 1 Screened SNP molecular marker information

[0031]

[0032] The following primers were designed for the SNP molecular markers in Table 1:

[0033] Upstream primer F: GACAGATGATGCCGCCTCCAC, as shown in SEQ ID NO. 2;

[0034] Downstream primer R: ACCTCGTCGTGTCGTGTTAT, as shown in SEQ ID NO. 3;

[0035] PCR amplification was performed using the designed primers. The reaction system for PCR amplification was 30 μL, including 15 μL of 2*TaqMasterMix, 2 μL of upstream primer F (5 pmol / μL), 2 μL of downstream primer R (5 pmol / μL), 10 μL of ddH2O, and 1 μL of DNA template (20 ng). Reaction conditions included initial denaturation at 95°C for 5 min, followed by 35 cycles of 94°C for 30 s, denaturation at 95°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s; followed by a final extension at 72°C for 5 min; and a final hold at 16°C for 1 min.

[0036] The results showed that the sequence of the amplified target length was compared by Sanger sequencing. It was found that the sequence amplified using the DNA template of the female fish was shown in SEQ ID NO.1, in which the 501st base was G / A, and the sequence amplified using the DNA template of the male fish was shown in SEQ ID NO.1, in which the 501st base was G / G.

[0037] Example 2

[0038] In order to verify the accuracy of the SNP site in Example 1 in identifying the sex of copper fish, this example carried out verification of the SNP molecular marker, and verified whether the molecular marker of copper fish detection was accurate by PCR and Sanger sequencing methods.

[0039] Specifically, genomic DNA was extracted from the sample to be tested, and the specificity of the primers was verified by PCR and Sanger sequencing, and compared with the physiological sex of the copper fish sample to confirm whether the SNP molecular markers and primers in Example 1 can be used for copper fish sex identification.

[0040] 1. Sample preparation

[0041] On May 17, 2024, 60 copper fish samples, including 30 female samples and 30 male samples, were selected for verification.

[0042] 2. Extraction of genomic DNA:

[0043] The genomic DNA of the copper fish to be tested was extracted using a DNA extraction kit.

[0044] 3. PCR amplification

[0045] Using the genomic DNA of the copper fish to be tested as a template, the upstream primer F

[0046] PCR amplification reaction was performed using the downstream primer R (ACCTCGTCGTGTCGTGTTAT, SEQ ID NO. 3).

[0047] Reaction system: The reaction system for PCR amplification was 30 μL, including 15 μL of 2*Taq MasterMix, 2 μL of upstream primer F (concentration 5 pmol / μL), 2 μL of downstream primer R (concentration 5 pmol / μL), 10 μL of ddH2O, and 1 μL of DNA template (20 ng).

[0048] Reaction conditions: pre-denaturation at 95°C for 5 min; then 35 cycles, including 94°C for 30 s, denaturation at 95°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s; then final extension at 72°C for 5 min; and finally, hold at 16°C for 1 min.

[0049] 4. Combined with Sanger sequencing analysis, determine the genotype of the copper fish sample to be tested and identify the gender

[0050] When the 501st base is G / A heterozygous, the copper fish sample to be tested is female, and when it is G / G homozygous, the copper fish sample to be tested is male.

[0051] The identification results of 60 copper fish samples are shown in Table 1 below:

[0052] Table 1 Comparison of genotyping and anatomical and physiological sex determination results of copper fish samples

[0053]

[0054]

[0055]

[0056]

[0057] The results in Table 1 above indicate that the sex information derived from the SNP site is consistent with the sex information confirmed by physiological anatomy. This means that the primers and SNP sites of the present invention can accurately identify the sex of copper fish with an accuracy rate of 100%. Compared to traditional anatomical and physiological sex identification, no biological dissection is required.

Claims

1. A SNP molecular marker for identifying the genetic sex of copper fish, characterized by: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO. 1, and the SNP molecular marker includes a SNP site, and the SNP site is located at the 501st base at the 5' end of the SNP molecular marker; When the 501st base is G / A heterozygous, the copper fish sample is female, and when it is G / G homozygous, the copper fish sample is male.

2. A primer for identifying the genetic sex of copper fish, characterized in that include: Upstream primer F: GACAGATGATGCCGCCTCCAC, SEQ ID NO. 2 Downstream primer R: ACCTCGTCGTGTCGTGTTAT, SEQ ID NO.

3.

3. A reagent or kit for identifying the genetic sex of copper fish, characterized in that: Comprising the primer according to claim 2.

4. Use of the SNP molecular marker according to claim 1, the primer according to claim 2, or the reagent or kit according to claim 3 in identifying the genetic sex of copper fish.

5. A method for identifying the genetic sex of copper fish, characterized in that The steps include: S1, collect copper fish sample to be tested, carry out DNA extraction on the copper fish sample to be tested, obtain genomic DNA of the copper fish sample to be tested; S2, using the DNA of the copper fish sample to be tested as a template, using the primers described in claim 2, performing a PCR amplification reaction; S3. After the PCR amplification reaction is completed, the sequence information of the PCR amplification product is analyzed to determine the genotype of the copper fish sample to be tested and identify the sex; When the 501st base at the 5' end of the nucleotide sequence shown in SEQ ID NO.1 in the amplified product is G / A heterozygous, the gender of the copper fish sample to be tested is female; when the 501st base is G / G homozygous, the gender of the copper fish sample to be tested is male.

6. The method for identifying the genetic sex of copper fish according to claim 5, wherein: In step S2, the PCR amplification system includes 15 μL of 2*Taq MasterMix, 2 μL of upstream primer F, 2 μL of downstream primer R, 10 μL of ddH2O, and 1 μL of DNA template.

7. The method for identifying the genetic sex of copper fish according to claim 5, wherein: The reaction conditions for PCR amplification in step S2 are: pre-denaturation at 95°C for 5 min; then 35 cycles, including 94°C for 30 s, denaturation at 95°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s; then final extension at 72°C for 5 min; and finally, holding at 16°C for 1 min.

8. The method for identifying the genetic sex of copper fish according to claim 5, wherein: In step S3, the method for determining the genotype of the copper fish sample to be tested is Sanger sequencing.

Images