Primer for detecting SIX6 methylation in cfDNA based on qPCR and application

Abstract

The invention discloses a primer for detecting methylation of SIX6 in cfDNA based on qPCR and application, and relates to the technical field of biological detection, the primer comprises a methylation primer and a non-methylation primer; the methylation primers are as shown in a sequence SEQ ID NO. 1 and a sequence SEQ ID NO. 2; the sequences of the non-methylated primers are as shown in SEQ ID NO. 3 and SEQ ID NO. 4. The invention further provides application of the primer for detecting SIX6 methylation in cfDNA based on qPCR as a detection kit. The invention provides a primer for detecting SIX6 methylation based on qPCR (quantitative polymerase chain reaction), the SIX6 methylation can be simply, quickly and repeatedly detected by using the primer, and the required sample size is small.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technology, and specifically to a primer and application for detecting SIX6 methylation in cfDNA based on qPCR. Background Art

[0002] Aberrant DNA methylation is involved in the occurrence, progression, and recurrence of cancer, making it an ideal cancer biomarker. Many studies have found that hypermethylated SIX6 has great potential as a "universal cancer marker" for early cancer screening, a precancerous marker, and a tumor metastasis tracking marker.

[0003] DNA (deoxyribonucleic acid) methylation detection methods generally use detection technologies based on the basic principle of bisulfite conversion, PCR (Polymerase Chain Reaction), sequencing technology, mass spectrometry, etc. qPCR (real-time fluorescence quantitative PCR) has the advantages of high efficiency, rapidity, and easy operation; DNA methylation detection based on the NGS (Next-Generation Sequencing) platform has high throughput, but the operation is complex and the cost is high; the nucleic acid mass spectrometry platform is a platform between PCR and NGS technology in terms of throughput, price, time, etc.

[0004] Molecular biomarkers circulating in peripheral blood have the advantages of easy access, reproducibility and early detection, so liquid biopsy has entered the diagnosis and prognosis of cancer in recent years. The main benefits of using liquid biopsy to screen cancer are the ease of use and non-invasiveness of the technology, while obtaining the real-time status of disease development. The detection and quantification of cfDNA (circulating free DNA) is a key link in the field of liquid biopsy. It has all the characteristics of an ideal early screening tumor marker and can be used as a non-invasive test for precancer and cancer molecular analysis, which helps to optimize medical practice, personalized medicine and improve the quality of life.

[0005] Zhao Y et al [1] The methylation-specific PCR (MSP) method was used to find that the methylation frequency of SIX6 (Homo sapiens SIX homeobox 6, cattle pituitary transcription factor) was significantly different between the stage I NSCLC (non-small cell lung cancer) group and the non-cancerous lung disease group. The primer sequences were:

[0006] Sense strand: 5′-TCAGCAGCTAGGCGCTGGGATC-3,

[0007] Antisense strand 5′-:CCTCTCGGGGTGGTTACTTTGCCG-3′.

[0008] The region amplified by the primers is partially located in the promoter of the SIX6 gene. The primers can only amplify methylated sequences but not non-methylated sequences, and therefore cannot determine the relative methylation level of the site.

[0009] Smetannikova NA et al. [2] The GLAD-PCR method was used to identify the abnormally methylated RCGY site in the SIX6 regulatory region in lung cancer tissue samples. The primer sequences were:

[0010] GTGGCAACTACCGCGAGCTCT-FAM,

[0011] ATCCTGGAAAACCACAAGTTCACCAAGGA-BHQ1.

[0012] The primers specifically recognize and cut the R(5mC)↓GY site mainly through the methyl-directed DNA endonuclease GlaI. This method relies on the methyl-directed DNA endonuclease GlaI and can only detect the methylation status of a single specific site. There is a problem of false positives caused by incomplete enzyme digestion. It requires an enzyme, a pair of primers, a probe and a corresponding connector, and the operation and design are complicated.

[0013] Dong S et al [3] Reference Shihua Dong et al. [4] Research methods: Methylation was detected by methylation-sensitive restriction endonuclease combined with real-time fluorescence quantitative PCR (MSRE-qPCR) method, and SIX6 was found to be highly methylated in 10 cancer types. Highly methylated SIX6 was identified as a new UCOM for early cancer screening, and can also be used as an indicative marker for precancer staging and metastasis tracking. The primer sequences are not listed in the article. This method detects the methylation of SIX6. The target genomic region contains several cleavage sites. If the CpG dinucleotide within the restriction enzyme cleavage site is methylated, it cannot be digested; if not, it can be digested, but cannot be amplified and detected by subsequent qPCR.

[0014] Currently, the detection of SIX6 methylation mainly relies on PCR and sequencing methods. The above-mentioned public detection methods all have certain limitations, are complex to operate and are costly.

[0015] References:

[0016] [1]Zhao Y, et al.Abnormal methylation of seven genes and their associations with clinical characteristics in early stage non-small cell lungcancer.Oncol Lett.2013Jan 29;5(4):1211-1218.

[0017] [2]Smetannikova NA,et al.Application of GLAD-PCR Assay for StudyonDNA Methylation in Regulatory Regions of Some Tumor-Suppressor Genes inLungCancer.Zhongguo Fei Ai Za Zhi.2019Sep 20;22(9):551-561.

[0018] [3]Dong S, et al. Mutually exclusive epigenetic modification on SIX6withhypermethylation for precancerous stage and metastasis emergencetracing. SignalTransduct Target Ther. 2022Jul 6;7:208.

[0019] [4]Shihua Dong, et al. Hypermethylated PCDHGB7 as a universal canceronlymarker and its application in early cervical cancer screening. Clin TranslMed. 2021Jun 20;11(6):e457. Summary of the invention

[0020] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a primer and application for detecting SIX6 methylation in cfDNA based on qPCR. The primer can be used to detect SIX6 methylation simply, quickly and repeatably, and a small amount of sample is required.

[0021] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0022] A primer for detecting SIX6 methylation in cfDNA based on qPCR, including a methylation primer and a non-methylation primer;

[0023] The methylation primers are shown in SEQ ID NO.1 and SEQ ID NO.2;

[0024] The non-methylated primers are shown in sequences SEQ ID NO.3 and SEQ ID NO.4.

[0025] The present invention also provides the use of the above-mentioned primers for detecting SIX6 methylation in cfDNA based on qPCR as a detection kit.

[0026] Furthermore, the DNA in the sample is treated with bisulfite and then subjected to primer-specific PCR; the primers shown in the sequences SEQ ID NO.1 and SEQ ID NO.2 amplify the methylated DNA chain, and the primers shown in the sequences SEQ ID NO.3 and SEQ ID NO.4 amplify the unmethylated DNA chain; and the presence of methylation in the sample is determined based on the primer amplification CT value.

[0027] Furthermore, the PCR amplification system was: 1× dye method qPCR reaction buffer, 0.4 μM upstream and downstream primers; 1× background calibration dye I, 1-10 ng template, and nuclease-free water to 20 μL.

[0028] Furthermore, the PCR amplification reaction conditions were: 95°C for 3 min, followed by the following cycles: 95°C for 5 s, 60°C for 30 s, for a total of 45 cycles.

[0029] Furthermore, the sample is plasma free nucleic acid DNA or fresh tissue or paraffin section specimen.

[0030] Compared with the prior art, the present invention has the following beneficial effects:

[0031] (1) The present invention provides a primer for detecting SIX6 methylation based on qPCR. The primer can be used to detect SIX6 methylation simply, quickly and reproducibly, and a small amount of sample is required.

[0032] (2) By using the primers provided in this application to detect SIX6 methylation, the CT value of the primer amplification can be used to determine whether the sample being tested is methylated, thereby performing early screening for cancer. The entire process is efficient and simple, and has potential clinical guidance significance. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 is the methylation primer qPCR result;

[0034] Figure 2 The results are for qPCR using non-methylated primers. DETAILED DESCRIPTION

[0035] The present invention is further described below in conjunction with the accompanying drawings and embodiments. The embodiments of the present invention include but are not limited to the following embodiments.

[0036] This embodiment provides a primer and method for detecting SIX6 methylation based on qPCR, which has the characteristics of being simple, rapid, repeatable, and requiring a small amount of sample.

[0037] Two pairs of primers are provided: a pair of methylated primers and a pair of unmethylated primers. The methylated primers are shown in the sequences SEQ ID NO.1 and SEQ ID NO.2, and the unmethylated primers are shown in the sequences SEQ ID NO.3 and SEQ ID NO.4. Before using the primers for amplification, the DNA to be detected is first treated with bisulfite, so that the unmethylated cytosine is converted into uracil, while the methylated one remains unchanged, and then primer-specific PCR is performed. SEQ ID NO.1 and SEQ ID NO.2 primers can amplify methylated samples, and SEQ ID NO.3 and SEQ ID NO.4 can amplify unmethylated samples. It is judged whether the sample to be tested is methylated based on the primer amplification CT value of the methylated or unmethylated DNA chain after treatment.

[0038] The detection method based on qPCR for detecting SIX6 methylation is as follows:

[0039] (1) Suitable samples

[0040] Plasma free nucleic acid DNA can also be used for fresh tissue and paraffin section specimens.

[0041] (2) Nucleic acid extraction

[0042] DNA can be extracted by purchasing commercially available or self-prepared fresh tissue genomic DNA extraction reagents, paraffin section tissue genomic DNA extraction reagents, or plasma free nucleic acid DNA extraction reagents.

[0043] In this example, the following method was used to extract plasma free nucleic acids:

[0044] a. Add 1 mL of plasma to the test tube, then add 40 μL of proteinase K and mix well (plasma and proteinase K need to be added and mixed well before adding lysis buffer) and then add 80 μL of lysis buffer (proteinase K cannot be added directly to the lysis buffer, otherwise it will cause proteinase K to lose its activity and affect the extraction efficiency);

[0045] b. After adding the three components, vortex and mix for 5 seconds and incubate at 60℃ for 20 minutes;

[0046] c. After the incubation, wait for the sample to return to room temperature, add 1.2 mL of binding buffer and 40 μL of magnetic beads (the magnetic beads need to return to room temperature in advance), invert and mix 10 times, and shake and mix at room temperature at medium speed (400-500 rpm) for 6 minutes (invert and mix several times during this period);

[0047] d. Divide the sample into two low-absorption tubes, place them on a magnetic rack, and let them stand for 3-5 minutes. After the liquid becomes clear, carefully remove the supernatant.

[0048] e. Add 2 mL of washing solution I to each low-absorption tube (distribute as evenly as possible), mix well and centrifuge, then combine into one tube, continue vortexing for 30 seconds, centrifuge, place on a magnetic rack, wait for the solution to become clear, and discard the supernatant;

[0049] f. Add 2 mL of washing solution II to the low adsorption tube, vortex for 30 seconds, centrifuge, place on a magnetic stand, wait for the solution to become clear, and discard the supernatant;

[0050] g. Briefly centrifuge, place on a magnetic rack and let stand, carefully remove the remaining supernatant, dry, and air dry for 5-10 minutes until the surface of the magnetic beads is matte (the drying time can be adjusted according to the ambient humidity. If the magnetic beads are not completely dried, it will affect the downstream experiments. If the magnetic beads are cracked, it will affect the DNA yield and quality);

[0051] h. After the magnetic beads are dried, add 25-50 μL of elution buffer, vortex to disperse the magnetic beads, and gently shake 1-2 times to accelerate DNA dissolution;

[0052] i. Place on a magnetic rack and let stand for 3 minutes. After the solution is clarified, carefully transfer the DNA solution to a new low-adsorption tube (a second transfer is required to absorb the remaining magnetic beads);

[0053] j. Store at -20℃.

[0054] (3) Bisulfite treatment

[0055] The extracted DNA can be treated with a commercially available or self-prepared bisulfite treatment reagent.

[0056] In this embodiment, the following steps are used to treat bisulfite:

[0057] 3.1. Thaw the DNA for bisulfite reaction. Ensure that all reagents for bisulfite conversion are fully dissolved. If necessary, heat at 60°C and vortex until completely dissolved. This process takes up to 5 minutes.

[0058] 3.2. Prepare the bisulfite reaction in a 200 μL PCR tube. Add each component in the order listed in Table 1. Mix thoroughly after adding the sample according to Table 1, transfer to the PCR instrument, and perform the transformation according to the program in Table 2. This process takes 30 minutes.

[0059] Table 1

[0060]

[0061] Note: The total volume of the high concentration sample DNA solution and RNase-free water must be 20 µL.

[0062] Note: The total volume of the low concentration sample DNA solution and RNase-free water must be 40 µL.

[0063] Table 2

[0064] step time temperature transsexual 5min 95℃ Incubation 10min 60℃ transsexual 5min 95℃ Incubation 10min 60℃ Hold unlimited 20℃

[0065] 3.3. Purification of sulfite-converted DNA:

[0066] a. After bisulfite conversion is complete, briefly centrifuge the PCR tube containing the bisulfite reaction and transfer the entire bisulfite reaction (140 μL) to a clean 1.5 mL microcentrifuge tube.

[0067] b. Add 310 μL of freshly prepared Buffer BL, mix thoroughly, and centrifuge briefly. Note: When the starting DNA content is less than 100 ng, carrier RNA solution needs to be added to Buffer BL. When the starting DNA content is greater than 100 ng, Buffer BL can be used directly without the need for carrier RNA solution. The preparation ratio of carrier RNA solution and Buffer BL is shown in Table 3 below.

[0068] Table 3

[0069] Sample size 1 4 8 16 24 48 Buffer BL volume 350μL 1.4mL 2.8mL 5.6mL 8.4mL 16.8mL Carrier RNA solution volume 3.5μL 14μL 28μL 56μL 84μL 168μL

[0070] c. Add 250 μL of ethanol (96–100%), vortex to mix for 15 seconds, and centrifuge briefly.

[0071] d. Transfer all the solution obtained in the previous step to the DNA purification column provided with the kit.

[0072] e. Centrifuge at maximum speed for 1 min, discard the waste liquid, and put the purification column back into the collection tube.

[0073] f. Add 500 μL Buffer BW (wash buffer) to the purification column and centrifuge at maximum speed for 1 min, discard the waste liquid, and return the purification column to the collection tube.

[0074] g. Add 500 μL of Buffer BD (desulfurization buffer) to the purification column, cover the lid (Buffer BD should be exposed to air as little as possible), and let it stand at room temperature (15-25°C) for 15 minutes.

[0075] h. Centrifuge at maximum speed for 1 minute, discard the waste liquid, and put the purification column back into the collection tube.

[0076] i. Add 500 μL Buffer BW to the purification column and centrifuge at maximum speed for 1 min. Discard the waste liquid and return the purification column to the collection tube.

[0077] j. Repeat the above steps.

[0078] k. Add 250 μL of ethanol (96–100%) to the purification column and centrifuge at maximum speed for 1 min.

[0079] l. Place the purification column into a new 2 mL collection tube and centrifuge the purification column at maximum speed for 1 min to remove all residual liquid.

[0080] Optional: Place the column into a clean 1.5 mL microcentrifuge tube and incubate in a metal bath at 60°C for 5 min. This step will evaporate any remaining liquid.

[0081] m. Place the purification column in a clean 1.5 mL microcentrifuge tube. Add 15 μL Buffer EB (elution buffer) directly to the center of each purification column membrane, gently close the lid, and let the purification column stand at room temperature for 1 minute;

[0082] n. Centrifuge at 15,000 x g (12,000 rpm) for 1 min to elute the DNA.

[0083] Note: If a higher DNA concentration is required, only 10 μL of Buffer EB can be used for elution, but the yield will be reduced by approximately 20%. Do not elute with less than 10 μL of Buffer EB because the purification column membrane will not be fully hydrated.

[0084] o. Quantitative.

[0085] Note: Purified DNA can be stored at 2-8°C for 24 hours. For storage longer than 24 hours, it is recommended to store at -15 to -30°C.

[0086] 3.4. Notes:

[0087] a. The kit is shipped at room temperature (15-25°C). Upon arrival, DNA purification columns, DNA Protect Buffer, and Buffer BD should be stored at 2-8°C. However, short-term storage (up to 4 weeks) at room temperature will not affect their performance. All other buffers and bisulfite mixtures should be stored at room temperature and are stable under these conditions for at least 6 months.

[0088] b. Lyophilized carrier RNA can be stored at room temperature for 1 year. Carrier RNA can only be dissolved in RNase-free water. Dissolved carrier RNA should be added immediately to buffer BL, which should be freshly prepared and stable at 2-8°C for 48h. Unused carrier RNA dissolved in RNase-free water should be frozen in aliquots at -15°C to -30°C and can be stored for up to 1 year.

[0089] c. Due to the sensitivity of nucleic acid amplification technology, care should be taken to avoid cross-contamination between sample preparations when handling DNA purification columns.

[0090] (4) Primer design

[0091] In order to make the primers relatively quantitative of the methylation level, more CpG sites can be covered without relying on enzymes, and the primer design is relatively simple. The promoter region DNA sequence of SIX6 was selected, and the sequences of the promoter regions of these genes can be found through the link http: / / www.genome.ucsc.edu / cgi-bin / hgGateway. The online methylation primer design software (http: / / www.urogene.org / methprimer) was used to design primers, one pair of methylation primers and one pair of non-methylation primers.

[0092] Methylation Primers:

[0093] SEQ ID NO.1(SIX6-Left M):CGGTTTTTTGTTTTTATCGT

[0094] SEQ ID NO.2(SIX6-Right M):GATACGTTATCTCGATCGAA

[0095] Unmethylated primers:

[0096] SEQ ID NO.3(SIX6-Left U):TTGGTTTTTTGTTTTTATTGT

[0097] SEQ ID NO.4(SIX6-Right U):TTAAAACAATACATTATCTCAATCA

[0098] (5) qPCR amplification

[0099] Amplification reaction system: 1× dye method qPCR reaction buffer, 0.4μM upstream and downstream primers (1:1); 1× background calibration dye I, 1-10ng template, nuclease-free water to 20μL. The dye method qPCR reaction buffer and background calibration dye I were purchased directly from a commercial company, and the template was the DNA of the sample to be tested after sulfite treatment.

[0100] Amplification reaction conditions: 95°C for 3 min, followed by the following cycles: 95°C for 5 s, 60°C for 30 s, for a total of 45 cycles.

[0101] (6) Result determination

[0102] The methylation status can be determined based on the Ct value.

[0103] After the PCR reaction is completed, the Ct threshold is set in the exponential amplification interval (in this embodiment, the fluorescence intensity ΔRn is set to 1), and the amplification with a Ct value less than 40 is considered positive. The value of ΔRn represents the amount of PCR product during the PCR process. A curve is drawn with the value of ΔRn versus the number of cycles, and a fluorescence threshold is selected. The number of cycles at which the fluorescence reaches the fluorescence threshold is called the threshold cycle number, which is also the CT value. The value of ΔRn is the optimal value automatically set by the software, and can also be manually changed according to the experimental requirements. It is generally set in the middle or end of the exponential amplification interval.

[0104]

[0105] When partial methylation occurs, relative quantitative judgment is performed using the following formula:

[0106]

[0107] in:

[0108] N m : Copy number after amplification using methylated primers;

[0109] N u : The copy number after amplification using non-methylated primers;

[0110] N m0 : Initial methylation substrate copy number;

[0111] N uo : Initial unmethylated substrate copy number;

[0112] e x : Amplification efficiency;

[0113] ct m : Ct value of methylation primer amplification;

[0114] ct u : Ct value of amplification using non-methylated primers.

[0115]

[0116] The methylation status of the SIX6 gene promoter region can be determined based on the amplified CT value.

[0117] The following is described with specific embodiments:

[0118] The above test was performed using plasma free nucleic acid samples from advanced lung cancer, early lung cancer and healthy subjects. The test results were as follows Figure 1 , 2 As shown, Figure 1 This is the result of methylation primer qPCR test. The CT value of methylation (late-stage lung cancer sample) is 28.86, and the CT value of partial methylation (early-stage lung cancer sample) is 33.93. The sample without amplification curve is a healthy sample. Figure 2 The qPCR test results of non-methylated primers show that the CT value of unmethylated (healthy samples) is 31.672, and the CT value of partially methylated (early lung cancer samples) is 33.93. The samples without amplification curves are late-stage lung cancer samples. Figure 1 , Figure 2 Substitute the partially methylated CT value into the formula for calculation ((When ΔRn=1, the copy numbers of the two amplified genes are equal, that is, N m =N u ), calculate N m0 / N m0 +N uo *100% = 50%. The higher the percentage of partial methylation detection, that is, the higher the degree of methylation, usually indicates a higher risk of malignant transformation of cells, which has a more direct guiding significance for the progression of the disease and prognosis assessment.

[0119] The above embodiment is only one of the preferred implementation modes of the present invention and should not be used to limit the protection scope of the present invention. Any changes or modifications that are made to the main design concept and spirit of the present invention and have no substantive significance, and the technical problems they solve are still consistent with the present invention, should be included in the protection scope of the present invention.

Claims

1. A primer for detecting SIX6 methylation in cfDNA based on qPCR, characterized in that: Includes methylated primers and non-methylated primers; The methylation primers are shown in SEQ ID NO.1 and SEQ ID NO.2; The non-methylated primers are shown in sequences SEQ ID NO.3 and SEQ ID NO.

4.

2. Use of the primers for detecting SIX6 methylation in cfDNA based on qPCR as described in claim 1 as a detection kit.

3. The use of primers for detecting SIX6 methylation in cfDNA based on qPCR according to claim 2, characterized in that: After treating the DNA in the sample with bisulfite, primer-specific PCR is performed; the primers shown in the sequences SEQ ID NO.1 and SEQ ID NO.2 amplify the methylated DNA chain, and the primers shown in the sequences SEQ ID NO.3 and SEQ ID NO.4 amplify the unmethylated DNA chain; The presence of methylation in the sample was determined based on the primer amplification CT value.

4. The use of primers for detecting SIX6 methylation in cfDNA based on qPCR according to claim 3, characterized in that: The PCR amplification system was: 1× dye method qPCR reaction buffer, 0.4 μM upstream and downstream primers; 1× background calibration dye I, 1-10 ng template, and nuclease-free water to 20 μL.

5. The use of primers for detecting SIX6 methylation in cfDNA based on qPCR according to claim 4, characterized in that: The PCR amplification reaction conditions were: 95°C for 3 min, followed by the following cycles: 95°C for 5 s, 60°C for 30 s, for a total of 45 cycles.

6. The use of primers for detecting SIX6 methylation in cfDNA based on qPCR according to claim 5, characterized in that: The sample is plasma free nucleic acid DNA or fresh tissue or paraffin section specimen.

Images