Quadruple digital PCR (Polymerase Chain Reaction) detection kit for simultaneously detecting four intestinal bacterial pathogens in sewage and application of quadruple digital PCR detection kit

Abstract

The invention discloses a quadruple digital PCR (Polymerase Chain Reaction) detection kit for simultaneously detecting four intestinal bacterial pathogens in sewage and application of the quadruple digital PCR detection kit. The invention relates to a quadruple digital PCR (Polymerase Chain Reaction) detection kit, which comprises primers and probes, wherein the primers and the probes are respectively used for detecting salmonella spp., shigella spp., vibrio cholerae and vibrio parahaemolyticus, and the primers and the probes are respectively used for detecting salmonella spp., shigella spp., vibrio cholerae and vibrio parahaemolyticus. Furthermore, the invention also provides an application of the quadruple digital PCR detection kit in preparation of a reagent for simultaneously detecting salmonella, shigella, vibrio parahaemolyticus and vibrio cholerae. When the kit is used for detecting four intestinal bacterial pathogens in sewage, the detection flux is greatly improved, a technical means is provided for efficient development of large-scale sewage monitoring projects, and potential disease outbreak risks can be accurately recognized in the early stage.

Description

Technical Field

[0001] The present invention relates to a kit for simultaneously detecting Salmonella spp., Shigella spp., Vibrio cholerae and Vibrio parahaemolyticus in sewage based on digital PCR (dPCR) technology. The present invention belongs to the technical field of environmental microorganism detection. Background Art

[0002] Wastewater epidemiology (WBE) has become a key and cost-effective public health monitoring tool. It can evaluate the prevalence and spread of pathogens in community settings by analyzing sewage samples, achieving "one sample multiple analysis (OSMA)", and can simultaneously monitor health indicators such as antibiotic resistance genes, drug-resistant bacteria, target pathogens, and chemical pollutants, thereby significantly enhancing traditional monitoring techniques. During the COVID-19 pandemic, it has played an effective role in tracking the spread of SARS-CoV-2, and the monitoring of enteric pathogens has helped to understand foodborne and waterborne diseases, such as bacterial gastroenteritis caused by Salmonella typhimurium, bacterial dysentery caused by Shigella flexneri, and cholera caused by Vibrio cholerae. Monitoring of these pathogens is essential for tracking disease patterns, evaluating intervention effects, identifying pollution sources, quantifying disease burden, and strengthening targeted monitoring.

[0003] Current methods for detecting pathogens in sewage include traditional culture methods, molecular biology methods represented by polymerase chain reaction (PCR), and next-generation sequencing technology, but they are significantly insufficient in terms of sensitivity, specificity, and detection of low-concentration pathogens in complex sewage matrices. Digital polymerase chain reaction (dPCR) is to highly dilute samples containing nucleic acid molecules, and then divide the diluted samples into a large number of tiny reaction droplets, so that each droplet contains only one or zero target nucleic acid molecules as much as possible, and each droplet becomes an independent reaction unit, and then PCR amplification is performed. As a transformative technology, dPCR has advantages in sewage monitoring. It can achieve absolute quantitative analysis without the need for calibration curves, and can still maintain stable and reliable detection performance in the face of PCR inhibitors in complex environmental matrices. Summary of the invention

[0004] The object of the present invention is to provide a quadruple digital PCR detection kit and its application capable of simultaneously detecting four intestinal bacterial pathogens in sewage. The four intestinal bacterial pathogens include Salmonella spp., Shigella spp., Vibrio cholerae and Vibrio parahaemolyticus.

[0005] In order to achieve the above object, the present invention adopts the following technical means:

[0006] The present invention designs specific primers and probes for the invA gene of Salmonella typhimurium, the ipaH gene of Shigella flexneri, the tlh gene of Vibrio parahaemolyticus and the ctxA gene of Vibrio cholerae using Beacon Designer V8.20 software. During the reaction, the sample is first denatured at 95 ° C for 2 minutes, and then undergoes 40 cycles, each cycle including 95 ° C 15 seconds denaturation and 58 ° C 30 seconds annealing / extension steps. Based on the amplification of the target gene by Taq enzyme at a suitable temperature, when the target gene exists, the primer binds to the template and performs an amplification reaction with the assistance of the probe to generate a fluorescent signal. After the reaction is completed, the result is judged according to the set fluorescence threshold value. When the number of positive droplets reaches a certain standard (such as greater than or equal to 3), it is judged as a positive reaction, thereby determining whether the target pathogen is present in the sample and the approximate concentration range. Since the reaction in each droplet is independent, by detecting the number of positive droplets and combining the statistical principle of Poisson distribution, four bacteria can be detected and absolutely quantified at the same time without the need for a calibration curve. This effectively overcomes the interference of inhibitors in complex wastewater matrices on quantitative accuracy and accurately detects low-concentration pathogens.

[0007] Based on the above research, the present invention proposes a quadruple digital PCR detection kit for simultaneously detecting four intestinal bacterial pathogens in sewage. The quadruple digital PCR detection kit contains primers and probes for detecting Salmonella, Shigella, Vibrio cholerae and Vibrio parahaemolyticus, respectively. The sequences of the primers and probes are as follows:

[0008] The forward primer used to detect Salmonella was 5′CCGCCAAACCTAAACCAG3′, the reverse primer was 5′GGCTCTTCGGCACAAGTA3′, and the probe was FAM-CGCCAATCAGTCCYAACGACGACCCTT-BHQ1;

[0009] The forward primer used to detect Shigella was 5′GCAGAGAACCTCAGCTCTC3′, the reverse primer was 5′CAGTGCGGAGGTCATTTG3′, and the probe was HEX-TCACTCCCGACACACATAGAACGC-BHQ1;

[0010] The forward primer used to detect Vibrio parahaemolyticus was 5′CGAACGGAACGCAGACATTA3′, the reverse primer was 5′GCAACCATTGTTTGATTTGATCT3′, and the probe was ROX-TTCTCGCCGCTGACAATCGCTTTCCA-BHQ2;

[0011] The forward primer used to detect Vibrio cholerae was 5'AGGGGCTACAGAGAGAGATATCA3', the reverse primer was 5'GCGGTGCATGATGAATCCA3', and the probe was Cy5-ACCTGCCATCCATAACCTCTGTGC-BHQ3.

[0012] Preferably, the quadruple digital PCR detection kit also contains dPCR TM Probe Supermix and

[0013] Among them, preferably, when the quadruple digital PCR detection kit is used to detect 4 enteric bacterial pathogens in sewage, it uses a multiplex QIAcuity digital PCR system and a matching QIAcuity probe PCR kit for detection.

[0014] Preferably, when the quadruple digital PCR detection kit is used to detect four enteric bacterial pathogens in sewage, each 40 μL reaction mixture contains 10 μL 4×dPCR TM probe supermix, 10 μL template DNA, 800 nM of each primer, 400 nM of each probe, and 6.25 units / mL of

[0015] Among them, preferably, when the quadruple digital PCR detection kit is used to detect 4 enteric bacterial pathogens in sewage, the reaction mixture is distributed into a 24-well 26k QIAcuity nanoplate, sealed and analyzed using a QIAcuity digital PCR instrument, and each sample is analyzed three times. The no-template control is set as the negative control, and the thermal cycle program is an initial denaturation at 95°C for 2 minutes, followed by 40 cycles, each cycle including denaturation at 95°C for 15 seconds and annealing / extension at 58°C for 30 seconds, and the positive result is determined based on the positive droplet.

[0016] Among them, preferably, when the number of positive droplets is greater than or equal to 3, it is considered positive, and when two or more of the three replicate wells of a sample are positive, the sample is determined to be a positive sample.

[0017] Furthermore, the present invention also proposes the use of the quadruple digital PCR detection kit in the preparation of a reagent for simultaneously detecting Salmonella, Shigella, Vibrio parahaemolyticus and Vibrio cholerae.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] 1. The kit of the present invention is used to perform quadruple dPCR detection, which integrates primers, probes and reaction reagents for four pathogens in the same reaction system, thereby realizing the simultaneous detection of Salmonella typhimurium, Shigella flexneri, Vibrio parahaemolyticus and Vibrio cholerae, greatly improving the detection efficiency, saving time and cost compared with the traditional one-by-one detection method, and reducing the sample usage and operation errors.

[0020] 2. The kit of the present invention contains primers and probes designed for specific gene targets of four enteric bacterial pathogens in sewage, and optimizes the reaction conditions (such as annealing temperature of 58°C). Combined with the high-fidelity QIAcuity Probe PCRKit and the precise QIAcuity Digital PCR system, it exhibits high sensitivity and specificity in complex environmental samples. Verification of 88 bacterial strains (51 target strains and 37 non-target strains) showed no cross-reaction. In artificially spiked wastewater samples, the detection limit for Salmonella was 390CFU / 100mL, Shigella 11CFU / 100mL, Vibrio cholerae 660CFU / 100mL, and Vibrio parahaemolyticus 640CFU / 100mL. It can effectively identify low-concentration pathogens. The detection rate of Shigella was as high as 78 in 60 municipal sewage samples. .3% (47 / 60), with a concentration range of 100.9-14,560 copies / 100mL; the detection rate of Salmonella was 46.7% (28 / 60), with a concentration of 86.5-7,329 copies / 100mL; the detection rate of Vibrio parahaemolyticus was 33.3% (20 / 60), with a concentration of 84.5-865.7 copies / 100mL. Therefore, it can effectively monitor the situation of pathogens in sewage and provide a basis for public health.

[0021] 3. This invention is the first to simultaneously monitor four important enteric bacterial pathogens in sewage environments: Salmonella, Shigella, Vibrio parahaemolyticus and Vibrio cholerae through multiplex dPCR technology. The constructed quadruple dPCR method greatly improves the detection throughput and provides solid technical support for the efficient implementation of large-scale sewage monitoring projects. The method's efficient detection capability for low-concentration pathogens helps to accurately identify potential disease outbreak risks at an early stage. The study aims to improve the speed and efficiency of pathogen identification and establish detection limits for these bacterial pathogens in order to more effectively track the spread and risks of waterborne diseases in public health monitoring. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 It is used for detecting the fluorescence intensity of target genes by quadruple digital PCR;

[0023] Among them, A: ipaH gene of Shigella SH1; B: invA gene of Salmonella typhimurium LT2; C: cholera toxin gene ctxA of Vibrio cholerae N16961; D: tlh gene of Vibrio parahaemolyticus ICDC-VP1329; 1, 2, 3: three replicates; NTC: non-template control; the red horizontal line indicates the fluorescence threshold, and the partitions represented by the blue points above the threshold line are interpreted as positive, while the partitions represented by the gray points below the threshold line are classified as negative;

[0024] Figure 2 Whisker plots of target gene concentrations in nucleic acids extracted from 100 mL of wastewater samples from different sampling points measured by quadruplex digital PCR;

[0025] The upper and lower fences show the 5th and 95th percentiles, and the boxes show the interquartile range and median. DETAILED DESCRIPTION

[0026] The technical solution of the present invention will be described clearly and completely in conjunction with the embodiments below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0027] Example 1 Establishment and application of quadruple digital PCR detection method

[0028] 1. Sample collection and processing:

[0029] Sewage sample collection: In November 2024, 60 sewage samples were collected from large residential areas, subway stations, educational institutions and hospital sewage pipe networks in Chaoyang, Haidian, Daxing and Fengtai districts of Beijing, including 27 samples from residential areas, 18 samples from medical institutions and 15 samples from other places. These samples represent the sewage conditions in areas where different groups of people live, providing a multi-sample basis for subsequent testing.

[0030] Preparation of artificially spiked wastewater samples: Fresh colonies of Vibrio cholerae N16961, Salmonella typhimurium serotype LT2, Shigella flexneri SH1, and Vibrio parahaemolyticus ICDC-VP1329 (all strains were preserved and provided by the Chinese Center for Disease Control and Prevention) were washed three times with phosphate buffered saline (PBS, pH 7.4) and then serially diluted twice in PBS. 1 mL of bacterial solution of each dilution was added to 100 mL of wastewater that was pre-screened negative for the four target pathogens to construct artificially spiked samples containing different concentrations of target pathogens for the performance test of the detection method.

[0031] 2. Primer and probe design and synthesis

[0032] Based on the comprehensive sequence alignment of the National Center for Biotechnology Information's non-redundant nucleic acid database (https: / / www.ncbi.nlm.nih.gov / nucleotide / ), the Salmonella invA gene, Shigella ipaH gene, Vibrio parahaemolyticus tlh gene, and Vibrio cholerae ctxA gene were selected as target gene sequences. Primers and probes were designed using BeaconDesigner V8.20 software and synthesized by Shanghai Sangon Biotechnology Co., Ltd. The primer and probe sequences used for pathogen detection are shown in Table 1 below:

[0033] Table 1 Primer and probe sequences

[0034]

[0035]

[0036] 3. Bioinformatics analysis:

[0037] The designed primer and probe sequences were specifically analyzed using the BLASTn algorithm (in a non-redundant nucleic acid database) and Primer-BLAST (in a non-redundant database limited to the order Enterobacteriaceae) (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) to ensure that they were highly matched with the target gene sequence and significantly different from other non-target sequences.

[0038] 4. Quadruple digital PCR detection:

[0039] Reaction system configuration: Multiplex QIAcuity Digital PCR System (Qiagen, Hildesheim, Germany) and matching QIAcuity Probe PCR Kit were used for detection. Each 40 μL reaction mixture contained 10 μL 4× dPCR TM Probe Supermix (Qiagen), 10 μL template DNA, 800 nM of each primer, 400 nM of each probe, and 6.25 units / mL of (Product of New England Biolabs, UK).

[0040] Experimental operation flow: The reaction mixture was distributed into a 24-well 26k QIAcuity nanoplate (Qiagen product), sealed and analyzed using a QIAcuity digital PCR instrument (Qiagen product). Each sample was analyzed in triplicate, and a no-template control (NTC) was set as a negative control. The thermal cycle program was an initial denaturation at 95°C for 2 minutes, followed by 40 cycles, each cycle including 95°C denaturation for 15 seconds and 58°C annealing / extension for 30 seconds, and positive results were determined based on positive droplets.

[0041] 5. Bacterial strain specificity verification:

[0042] A comprehensive strain panel containing 88 bacterial strains was used to verify the specificity of the detection method, of which 51 were target strains, such as 16 Salmonella (including 5 Enteritidis Salmonella, 5 Typhimurium Salmonella, and 6 Salmonella Typhimurium), 9 Shigella (2 Shigella flexneri and 7 Shigella sonnei), etc., see Table 2; 37 were non-target strains, covering a variety of bacteria that may have similarities with the target pathogens or coexist in sewage environments, such as Vibrio alginolyticus and enteroinvasive Escherichia coli. The genomic DNA of these strains was extracted respectively, and the genomic DNA of the 88 bacterial strains was used as a template for quadruple digital PCR detection. The amplification of primers and probes in target strains and non-target strains was observed. If the expected amplification signal appeared only in the target strain, and there was no amplification or the signal was very weak in the non-target strain, it proved that the specificity was good.

[0043] Results: Validation of 88 bacterial strains (51 target strains and 37 non-target strains) showed that the results were fully consistent with the expected results for the target organisms, and no cross-reactions or false-positive results were observed in the entire test strain panel (Table 2).

[0044] Table 2 Bacterial strain specificity verification

[0045]

[0046]

[0047]

[0048]

[0049] 6. Limit of Detection (LOD) Determination:

[0050] The detection limit was determined using artificially spiked wastewater samples. Colony forming units (CFU) were counted on LB agar plates for each dilution to quantify bacterial concentrations. The spiked wastewater was centrifuged at 10,000 g for 30 minutes and the precipitate was collected for DNA was extracted using the PowerSoil kit (Qiagen, USA), resuspended in 100 μL of nuclease-free water, and 10 μL was used as a template for quadruple digital PCR detection, and the whole process was repeated three times. The lowest CFU concentration at which all replicates were positive was used as the detection limit, and the coefficient of variation (CV) of the copy number of each reaction was calculated to evaluate the repeatability.

[0051] The results are shown in Table 3 and Figure 1 shown.

[0052] Table 3 dPCR results for detecting artificially spiked wastewater samples

[0053]

[0054]

[0055] Mean, average copy number in a final reaction volume of 40 μL (n=3). CV between replicates (n=3); CV=SD / Mean×100%. CV, coefficient of variation; LOD, limit of detection; Expected CFU / mL for wastewater samples: bacterial concentration calculated from colony count results; CFU: colony forming unit.

[0056] Among the three replicates, one negative well appeared. Positive well: When the number of positive droplets is greater than or equal to 3, it is considered positive. Positive sample: When two or more of the three replicate wells of a sample are positive, the sample is determined to be positive.

[0057] The results in Table 3 show that the quadruple digital PCR detection method established in the present invention has a detection limit of 11 CFU / 100 mL for Shigella flexneri SH1 strain, a detection limit of 390 CFU / 100 mL for Salmonella typhimurium serotype LT2 strain, a detection limit of 660 CFU / 100 mL for Vibrio cholerae N16961 strain, and a detection limit of 640 CFU / 100 mL for Vibrio parahaemolyticus ICDC-VP1329 strain.

[0058] 7. Actual sewage sample testing:

[0059] The quadruple digital PCR method established in the present invention was used to detect 60 municipal sewage samples collected, and the results are shown in Table 4 and Figure 2 shown.

[0060] Table 4 Comparison of quadruple dPCR testing of 60 different types of wastewater samples collected from Beijing (community n=27, hospital n=15, others n=18).

[0061]

[0062]

[0063] POS: number of positive samples; SUM: sum of positive and negative samples.

[0064] The results in Table 4 show that the detection rate of Shigella flexneri is the highest, which is 78.3% (47 / 60), with a concentration range of 100.9-14560 copies / 100mL; the detection rate of Salmonella typhimurium is 46.7% (28 / 60), with a concentration of 86.5-7329 copies / 100mL; the detection rate of Vibrio parahaemolyticus is 33.3% (20 / 60), with a concentration of 84.5-865.7 copies / 100mL; Vibrio cholerae was not detected in the samples. This test demonstrates the application effect of this method in actual sewage monitoring and can provide data support for public health risk assessment.

Claims

1. A quadruple digital PCR detection kit for simultaneous detection of four enteric bacterial pathogens in sewage, characterized in that: The quadruple digital PCR detection kit contains primers and probes for detecting Salmonella spp., Shigella spp., Vibrio cholerae and V. parahaemolyticus, respectively. The sequences of the primers and probes are as follows: The forward primer used to detect Salmonella was 5′CCGCCAAACCTAAACCAG3′, the reverse primer was 5′GGCTCTTCGGCACAAGTA3′, and the probe was FAM-CGCCAATCAGTCCYAACGACGACCCTT-BHQ1; The forward primer used to detect Shigella was 5′GCAGAGAACCTCAGCTCTC3′, the reverse primer was 5′CAGTGCGGAGGTCATTTG3′, and the probe was HEX-TCACTCCCGACACACATAGAACGC-BHQ1; The forward primer used to detect Vibrio parahaemolyticus was 5′CGAACGGAACGCAGACATTA3′, the reverse primer was 5′GCAACCATTGTTTGATTTGATCT3′, and the probe was ROX-TTCTCGCCGCTGACAATCGCTTTCCA-BHQ2; The forward primer used to detect Vibrio cholerae was 5'AGGGGCTACAGAGAGAGATATCA3', the reverse primer was 5'GCGGTGCATGATGAATCCA3', and the probe was Cy5-ACCTGCCATCCATAACCTCTGTGC-BHQ3.

2. The quadruple digital PCR detection kit according to claim 1, characterized in that: The quadruple digital PCR detection kit also contains dPCR TM Probe Supermix and 3. The quadruple digital PCR detection kit according to claim 1, characterized in that: When the quadruple digital PCR detection kit is used to detect four enteric bacterial pathogens in sewage, it uses a multiplex QIAcuity digital PCR system and a matching QIAcuity probe PCR kit for detection.

4. The quadruple digital PCR detection kit according to claim 3, characterized in that: When the quadruple digital PCR detection kit is used to detect four enteric bacterial pathogens in sewage, each 40 μL reaction mixture contains 10 μL 4×dPCR TM probe supermix, 10 μL template DNA, 800 nM each of the primers described in claim 1, 400 nM each of the probes described in claim 1, and 6.25 units / mL of 5. The quadruple digital PCR detection kit according to claim 4, characterized in that: When the quadruple digital PCR detection kit is used to detect four enteric bacterial pathogens in sewage, the reaction mixture is distributed into a 24-well 26k QIAcuity nanoplate, which is sealed and analyzed using a QIAcuity digital PCR instrument. Each sample is analyzed three times, and a no-template control is set as a negative control. The thermal cycle program is an initial denaturation at 95°C for 2 minutes, followed by 40 cycles, each cycle including denaturation at 95°C for 15 seconds and annealing / extension at 58°C for 30 seconds. Positive results are determined based on positive droplets.

6. The quadruple digital PCR detection kit according to claim 5, characterized in that: When the number of positive droplets was greater than or equal to 3, it was considered positive, and when two or more of the three replicate wells of a sample were positive, the sample was determined to be a positive sample.

7. Use of the quadruple digital PCR detection kit according to any one of claims 1 to 6 in the preparation of a reagent for simultaneously detecting Salmonella, Shigella, Vibrio parahaemolyticus and Vibrio cholerae.

Images