An engineered cell-derived vesicle-encapsulated tumor immunotherapy nano-vaccine and its application

Abstract

The present invention discloses a tumor immunotherapy nano-vaccine encapsulated by engineered cell-derived vesicles and its application, belonging to the technical field of new dosage forms and preparation technologies of biology and medicine. The nano-vaccine is obtained by PEG-modifying the tumor cell membrane anchored with ANX5 protein on the surface and then reacting with a photosensitizer. Through genetic engineering technology, the nano-vaccine anchors ANX5 protein on the surface of the cell membrane-based drug delivery carrier to transform the traditional therapeutic immunogenicity, and further combines with the material engineering to modify the polymer chain disconnected by the reactive oxygen species response in the tumor microenvironment to shield the surface antigen of the carrier during in vivo circulation, improving the effectiveness and in vivo circulation safety of the nano-vaccine. The nano-vaccine can improve traditional cytotoxic chemotherapy drugs and photodynamic therapy, and thus be efficiently applied to cancer treatment.

Description

Technical Field

[0001] The present invention relates to the technical field of new dosage forms and preparation technologies of biology and medicine, and particularly relates to a nano-vaccine for tumor immunotherapy loaded with engineered cell-derived vesicles and its application. Background Art

[0002] In recent years, with the development of chimeric antigen receptor T cell therapy and immune checkpoint inhibitors, immunotherapy has shown great potential in cancer treatment. Cancer vaccines, namely active cancer immunotherapy, have also been deeply studied with the progress of the identification of tumor-specific neoantigens. However, in most cases, cancer vaccines are only effective in cancer prevention and are usually administered to healthy populations. Despite great efforts in the direction of developing cancer therapeutic vaccines, initiating a strong anti-tumor cytotoxic T cell immune response in patients who already have cancer remains a major challenge, mainly due to intra-tumor and inter-tumor heterogeneity, as well as the immunosuppressive tumor microenvironment (TME).

[0003] Autologous tumor cells are the best source for vaccination because they display the full spectrum of TAEs and can trigger an overall immune response, thus being superior to traditional vaccines containing limited antigen epitopes. The process of preparing autologous tumor cell vaccines in vitro is complex and requires sufficient tumor samples, which limits the application of this technology in certain tumor types or stages. Therefore, in-situ preparation of autologous tumor cell vaccines in vivo is a potentially attractive alternative, which can effectively target the tumors of individual patients and provide personalized vaccines.

[0004] Traditional therapies such as chemotherapy drugs (such as doxorubicin) and photodynamic therapy (PDT) can induce immunogenic cell death (ICD) of tumor cells, which is characterized by the exposure of calreticulin (CRT) on the surface of tumor cells and the release of DAMPs such as HMGB1, ATP, and tumor DNA. These DAMPs contribute to the activation of anti-tumor T cells, especially cytotoxic CD8 + T cells. Preparing in-situ cancer vaccines using the immunogenicity generated by such traditional therapies is a feasible option. However, when these traditional treatment methods cause a large amount of apoptosis, phosphatidylserine (PS) is exposed on the outer layer of the cell membrane of apoptotic cells as a major "eat me" signal, which is transmitted to phagocytes such as macrophages, triggering the release of immunosuppressive factors. These factors will inhibit inflammation and prevent the maturation of antigen-presenting dendritic cells (DCs) and inhibit subsequent T cell activation, thus leading to an immunosuppressive microenvironment and therefore hindering the effect of in-situ vaccines.

[0005] Delivery of drugs through specific nanomaterials can enhance the tumor-killing effect of traditional drugs, improve immunogenicity and biosafety, and thus more effectively activate immune pathways and the potential of cancer immunotherapy. The application of cell membranes as drug carriers in cancer treatment is a cutting-edge and active research field. In recent years, through genetic engineering modification of cell membranes, protein display on the cell membrane surface can flexibly improve the function of cell membrane carriers. However, there are still some problems with cell membranes as carriers, such as the lack of specific targeting to tumor tissues, and the exposure of surface proteins in the in vivo environment may cause immunity in normal organs and tissues, thus bringing adverse reactions.

[0006] Annexin V (ANX5) protein can strongly bind to phosphatidylserine (PS) exposed on apoptotic cells, thus blocking the transmission of PS signals and their effects on phagocytic cells. Therefore, adding Annexin V to the drug system may increase the immunogenicity of killed tumor cells by blocking PS. However, in addition to apoptotic cells, PS is also exposed on some healthy cells, such as myoblasts, mast cells, and megakaryocytes. Therefore, the in situ immunization scheme by blocking PS with Annexin V still needs to improve its biosafety. Summary of the Invention

[0007] The object of the present invention is to provide an engineered cell-derived vesicle-encapsulated tumor immunotherapy nano-vaccine and its application to solve the problems existing in the above-mentioned prior art. The nano-vaccine significantly improves the tumor-killing effect and has high biosafety.

[0008] To achieve the above object, the present invention provides the following solutions:

[0009] The present invention provides an engineered cell-derived vesicle-encapsulated tumor immunotherapy nano-vaccine, which is obtained by PEG-modifying a tumor cell membrane anchored with ANX5 protein on its surface and then reacting with a photosensitizer.

[0010] Optionally, the nano-vaccine is prepared by the following method:

[0011] Connect the coding gene of ANX5 protein with a lentiviral expression vector to construct a recombinant lentiviral expression plasmid; then transfect the recombinant lentiviral expression plasmid into tumor cells to screen a stable cell line with overexpression of ANX5;

[0012] Introduce an N3 group onto the cell outer membrane of the stable cell line with overexpression of ANX5, then extract the cell membrane, and combine the cell membrane with PEG 5000-TK-DBCO to obtain an ANX5-anchored PEG-camouflaged nanoparticle through click chemistry reaction;

[0013] The ANX5-anchored PEG-concealed nanoparticles and photosensitizer nanoparticles are subjected to ultrasonic reaction and extruded through a polycarbonate membrane to prepare a nano-vaccine for tumor immunotherapy encapsulated by engineered cell-derived vesicles.

[0014] Optionally, the accession number of the coding gene of the ANX5 protein on NCBI is NM_009673.2, and the protein accession number is NP_033803.1; and / or the PEG includes PEG5000.

[0015] Optionally, the stable cell line overexpressing ANX5 is co-incubated with Ac4GalNAz to introduce an N3 group onto the cell outer membrane of the stable cell line overexpressing ANX5. The molar ratio of the N3 group in the cell membrane to the DBCO in the PEG 5000-TK-DBCO is 1:1; the time for the click chemical reaction is 10 - 12 hours.

[0016] Optionally, the mass-volume ratio of the ANX5-anchored PEG-concealed nanoparticles to the photosensitizer nanoparticles is (1 - 5) mg:1 mL.

[0017] The preparation method of the photosensitizer nanoparticles includes the following steps: Dissolve the photosensitizer molecule and DSPE-PEG2000 in tetrahydrofuran, stir, inject into deionized water, remove tetrahydrofuran, and then centrifuge to obtain the photosensitizer nanoparticles. The ratio of the photosensitizer molecule, DSPE-PEG2000, tetrahydrofuran, and deionized water is 1mg:4mg:600μL:6mL.

[0018] Optionally, the tumor cell membrane includes breast cancer cell membrane.

[0019] The present invention also provides the application of the nano-vaccine in any one of the following:

[0020] (1) Application in the preparation of tumor immunotherapy products;

[0021] (2) Application in the preparation of products for in-situ inhibiting tumor proliferation and growth;

[0022] (3) Application in the preparation of products for activating the function of immune cells.

[0023] Optionally, the tumor includes breast cancer.

[0024] The present invention also provides a product, including the nano-vaccine and pharmaceutically acceptable excipients and carriers, and the product is used for in-situ inhibiting tumor proliferation and growth and / or activating the function of immune cells.

[0025] Optionally, the tumor includes breast cancer.

[0026] The present invention discloses the following technical effects:

[0027] The present invention discloses a nano-vaccine for tumor immunotherapy encapsulated by engineered cell-derived vesicles, which is obtained by PEG-modifying the tumor cell membrane anchored with ANX5 protein on the surface and then reacting with a photosensitizer. The preparation method of this nano-vaccine is simple and efficient, synchronously realizing the genetic engineering modification and surface protein camouflage of the cell-derived nano-vaccine. In addition, this nano-vaccine can be used as a carrier for PDT or chemotherapeutic drugs to achieve specific targeted delivery and immunotherapy of drugs, and then be applied to cancer treatment.

[0028] Traditional chemotherapy and photodynamic therapy molecules act by directly killing cells. The novel nano-vaccine obtained in the present invention can utilize the cell membrane homologous targeting to improve the targeted delivery and enrichment of therapeutic molecules, thereby enhancing the killing effect. At the same time, by anchoring ANX5 protein on the surface to block the externalization of PS in apoptotic cells, the immunogenicity is improved after in-situ killing of tumor cells, thereby activating the body's immune response and further killing tumor cells at the lesion site. In addition, by modifying the cell membrane with a long-chain PEG that can be cleaved by ROS response, the surface proteins of the cell membrane can be hidden, preventing the non-specific targeting and killing of non-tumor cells by the cell membrane carrier during circulation. The high ROS level in the tumor microenvironment and the ROS generated by PDT treatment are used to cleave the long-chain PEG, exposing the ANX5 protein. This modification reduces the side effects of the nano-vaccine and improves the biosafety. Brief Description of the Drawings

[0029] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0030] Figure 1 It is a schematic flow chart of the construction process of breast cancer 4T1 cells engineered to express Annexin V (ANX5);

[0031] Figure 2 It is a confocal microscopy detection map of the membrane localization expression of ANX5 in 4T1-ANX5;

[0032] Figure 3 It is the detection result of ANX5 expression in 4T1-ANX5 by flow cytometry;

[0033] Figure 4 It is the detection of the expression level of ANX5 in the total protein (CL) of 4T1-ANX5 cells and control cells, as well as in the cell membrane (Mem) protein by Western blot experiment;

[0034] Figure 5 Confocal microscopy detection image of the binding of DBCO to N3 detected by FITC-DBCO after inserting the N3 group into the 4T1-ANX5 cell membrane;

[0035] Figure 6 Chemical structure of Compound 1;

[0036] Figure 7 For Compound 1 1 1H NMR spectrum;

[0037] Figure 8 For Compound 1 13 13C nuclear magnetic resonance spectrum;

[0038] Figure 9 Chemical structure of Compound 2;

[0039] Figure 10 For Compound 2 1 1H NMR spectrum;

[0040] Figure 11 For Compound 2 13 13C nuclear magnetic resonance spectrum;

[0041] Figure 12 Chemical structure of Compound 3;

[0042] Figure 13 For Compound 3 1 1H NMR spectrum;

[0043] Figure 14 For Compound 3 13 13C nuclear magnetic resonance spectrum;

[0044] Figure 15 Morphology images of NT@M, NT@ANX5, and NT@ANX5-P nanovaccines observed by transmission electron microscopy;

[0045] Figure 16 Particle size distributions of NT, NT@M, NT@ANX5, and NT@ANX5-P nanovaccines;

[0046] Figure 17 Zeta potentials of NT, NT@M, NT@ANX5, and NT@ANX5-P nanovaccines;

[0047] Figure 18 Analysis of the stability of nanoparticles by detecting the particle size at different time points after NT, NT@M, NT@ANX5, and NT@ANX5-P were placed in water for 7 days;

[0048] Figure 19Flow cytometry detection chart and statistical chart for verifying the correlation between ROS-responsive cleavage of TK bonds on the surface of nano-vaccines and ANX5 exposure in vitro;

[0049] Figure 20 Confocal microscopy images showing the intracellular localization of nano-vaccines in 4T1 cells after incubation for different times;

[0050] Figure 21 Fluorescence quantification chart of nano-vaccine accumulation in 4T1 cells after incubation for different times;

[0051] Figure 22 Flow cytometry analysis of the uptake of nano-vaccines by 4T1 cells;

[0052] Figure 23 CCK-8 analysis results showing the survival of 4T1 cells after light therapy with different nano-vaccines;

[0053] Figure 24 Representative CLSM images of live cells stained with Calcein-AM;

[0054] Figure 25 Flow cytometry analysis of the phagocytosis of apoptotic 4T1 cells by BMDM;

[0055] Figure 26 Flow cytometry analysis of the polarization level of BMDM into M2 macrophages;

[0056] Figure 27 ELISA analysis of the level of immunosuppressive factor TGF-β secreted by BMDM cells;

[0057] Figure 28 ELISA analysis of the level of immune activation factor IL-β secreted by BMDM cells;

[0058] Figure 29 Immunofluorescence analysis of the localization of ecto-CRT on the surface of 4T1 cells after nano-vaccine treatment;

[0059] Figure 30 Western blot analysis of the levels of HMGB1 and HSP70 in the cell supernatant after nano-vaccine treatment;

[0060] Figure 31 Tumor growth curve chart;

[0061] Figure 32 Picture of the final tumor size;

[0062] Figure 33 Flow cytometry detection chart and statistical chart for analyzing the maturation of DC cells in the draining lymph nodes of mice by flow cytometry;

[0063] Figure 34 Flow cytometry detection chart and statistical chart for analyzing T cell infiltration in mouse tumor tissues by flow cytometry;

[0064] Figure 35 HE staining of major organs of healthy mice after nano-vaccine treatment. Detailed implementation manners

[0065] Now, various exemplary implementation manners of the present invention will be described in detail. This detailed description should not be considered as a limitation to the present invention, but should be understood as a more detailed description of certain aspects, characteristics and implementation schemes of the present invention.

[0066] It should be understood that the terms described in the present invention are only used to describe specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0067] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0068] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific implementation manners of the present invention specification, which are obvious to those skilled in the art. Other implementation manners obtained from the present invention specification are obvious to those skilled in the art. The present invention specification and examples are only exemplary.

[0069] Regarding "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, meaning including but not limited to.

[0070] The present invention proposes a novel cell-derived nanovesicle that combines in-situ antigen generation induced by photodynamic therapy (PDT) or chemotherapeutic drugs with phosphatidylserine (PS) blockade to enhance antigen-specific immunization and overcome immune tolerance. (1) First, the present invention constructs tumor cells with surface-anchored ANX5 through engineering modification. (2) PEG5000 with a cleavable TK bond responsive to the reaction is inserted on the cell membrane surface through a bioorthogonal reaction to shield ANX5 on the cell membrane, preventing its non-specific binding to normal cells, minimizing off-target accumulation of nanoparticles, and ensuring safety after intravenous injection. (3) The cell vesicles modified on the surface are extracted and used to encapsulate photosensitizer molecules or chemotherapeutic drug nanoparticles to obtain the final therapeutic nano-vaccine. (4) After the nanoparticles accumulate at the tumor site, the ROS in the tumor microenvironment and the ROS generated by drug treatment jointly trigger the cleavage of the TK bond and the shedding of PEG, exposing ANX5 on the surface. (5) The cytotoxicity induced by the drug converts tumor cells into a library of tumor-specific antigens. At the same time, ANX5 on the cell membrane selectively blocks PS on the surface of apoptotic cells, inhibiting the early phagocytic clearance of apoptotic tumor cells, thereby enhancing the presentation of tumor antigens. The apoptotic cells blocked by the photosensitizer will further undergo secondary necrosis, which is a highly immunogenic form of cell death that can generate damage-associated molecular patterns (DAMPs) and further enhance the immune response. (6) In a mouse tumor model, these nanovesicles not only inhibited the growth of primary and metastatic tumors, but also prolonged the overall survival period and induced durable immune protection by restoring strong anti-tumor immunity. In addition, the nanovesicles reversed the immunosuppressive immune microenvironment and reprogrammed macrophage function, further amplifying the immunogenic effects induced by PDT or chemotherapeutic drugs. By combining the effects of traditional treatments (PDT or chemotherapeutic drugs) with genetically engineered membrane vesicles, this multifunctional nanoplatform significantly enhances the efficacy of personalized in-situ cancer vaccines.

[0071] Example 1 Preparation of a tumor immunotherapy nano-vaccine (ANX5 nano-vaccine) encapsulated by engineered cell-derived vesicles

[0072] 1. Obtaining of ANX5 anchored on the cell membrane

[0073] The construction process of breast cancer 4T1 cells engineered to express Annexin V (ANX5) is as Figure 1 shown, and the specific operation steps are as follows:

[0074] First, a recombinant lentivirus (LV)-ANX5 expression plasmid (pCDH-CMV-ANX5) was constructed to express full-length ANX5 (Gene ID: 11747) on the cell membrane. The C-terminus of ANX5 was linked to the N-terminus of the PDGFR transmembrane domain, and an mCherry tag was inserted into the vector to facilitate the analysis of positive ANX5-overexpressing cells. Next, the LV-ANX5 plasmid was mixed with vesicular stomatitis virus G protein (VSVG) and cytomegalovirus (CMV) packaging plasmids at a mass ratio of 1:3:4 and transfected into HEK 293T cells using the PEI transfection reagent. The cells were replaced with fresh medium after 10 hours of incubation. After 48 hours of incubation, the medium containing lentivirus was collected, and the collected media were combined and centrifuged at 300 g for 10 minutes to remove cell debris.

[0075] To construct a stable cell line overexpressing ANX5, 2 mL of the infection medium containing LV-ANX5 and 0.5 mL of fresh medium were added to the target 4T1 cells cultured in a 6-well plate. After 24 hours of incubation, the virus-containing medium was replaced with fresh medium. After the cells showed fluorescence labeling, stable ANX5-overexpressing cells (4T1-ANX5) were selected by adding 2 μg / mL of puromycin, and then monoclonal cells were collected and amplified. The established ANX5-overexpressing cells were maintained in complete medium containing 1 to 2 μg / mL of puromycin. The ANX5-overexpressing cells were evaluated by flow cytometry and confocal laser scanning microscopy (CLSM).

[0076] The results are as Figures 2 - 3 shown, showing that 4T1 cells stably expressing ANX5 were successfully constructed.

[0077] The expression levels of ANX5 in the total proteins and cell membrane proteins of 4T1-ANX5 cells and control cells were detected by Western blot analysis. The results are as Figure 4 shown. The detection results of the total cell lysate samples (CL) and cell membrane samples (Mem) showed that both the total amount and cell membrane localization amount of ANX5 in 4T1-ANX5 cells were significantly higher than those in 4T1 cells.

[0078] The nucleotide sequence (SEQ ID NO:1) of the PDGFR transmembrane domain is as follows: AATGCTGTGG GCCAGGACAC GCAGGAGGTCATCGTGGTGCCACACTCCTTGCCCTTTAAGGTGGTGGTGATCTCAGCCATCCTGGCCCTGGTGGTGCTCACCATCATCTC CCTTATCATCCTCATCATGCTTTGGCAGAAGAAGCCACGTTAGGCGGCCG。

[0079] 2. ANX5 cell membrane surface modification

[0080] To obtain the DSPE-PEG-modified and camouflaged ANX5 nanocarrier, 4T1-ANX5 cells were incubated with 10 μM Ac4GalNAz to introduce the N3 group into the glycoconjugates on the outer membrane. After obtaining cells stably expressing membrane-anchored ANX5 and embedding the N3 group, the cell membrane was extracted using a hypotonic lysis solution and high-speed centrifugation method. The cell membrane vesicles containing the N3 group were combined with PEG 5000-TK-DBCO (5 mg / mL) (at a molar ratio of N3 to DBCO of 1:1), and through click chemistry reaction, ANX5-anchored PEG-camouflaged nanoparticles (ANX5-P) were formed between the N3 and DBCO functional groups, and the reaction time was 12 hours. Subsequently, the excess PEG 5000-TK-DBCO was removed by ultrafiltration.

[0081] The confocal microscopy detection image for detecting the binding of DBCO and N3 using FITC-DBCO is shown in Figure 5 . The results showed that co-incubation of 4T1 cells with Ac4GalNAz enabled the intercalation of N3 into the cell membrane. Subsequently, after treatment with FITC-DBCO, it bound to N3 on the cell membrane through click chemistry reaction, and green fluorescence of FITC was observed on the cell membrane under the microscope, while no fluorescence labeling was observed in the cells treated with PBS.

[0082] 3. Preparation of ANX5 nano-vaccine

[0083] Preparation of the photosensitizer drug molecule (NTPN):

[0084] (1) Dissolve bromoaniline (2 g, 11.63 mmol) and 1-methylnaphthol (3.3 g, 23.25 mmol) in toluene (30 mL). Subsequently, add tris(dibenzylideneacetone)dipalladium(0) (212.96 mg, 0.23 mmol) and tributylphosphine tetrafluoroborate (168 mg, 0.58 mmol). Under an argon atmosphere, heat the system to 110 °C for an overnight reaction. After the reaction is complete, cool to room temperature and add ultrapure water (30 mL) to terminate the reaction. The resulting two-phase mixture is extracted three times with dichloromethane (CH₂Cl₂). The combined organic phases are dried over anhydrous magnesium sulfate (MgSO₄) and concentrated under reduced pressure. The crude product is purified by silica gel column chromatography using dichloromethane / hexane (volume ratio 1:4) as the elution solvent to obtain Compound 1, whose chemical structure is as Figure 6 shown.

[0085] The 1 ¹H NMR spectrum of Compound 1 in 13 CDCl₃, and its Figure 7 ¹³C nuclear magnetic resonance spectrum are shown in Figure 8 . 1 ¹H NMR (400 MHz, Chloroform-d) δ 8.00 (d, J = 7.4 Hz, 2H), 7.88 (d, J = 7.9 Hz, 2H), 7.71 (d, J = 8.2 Hz, 2H), 7.47 (t, J = 6.9 Hz, 2H), 7.41 – 7.32 (m, 4H), 7.24 (d, J = 6.2 Hz, 2H), 7.21 – 7.16 (m, 2H), 6.59 – 6.53 (m, 2H). 13 ¹³C NMR (101 MHz, Chloroform-d) δ 144.29, 138.08, 134.74, 132.17, 128.63, 126.30, 126.02, 125.95, 123.90, 121.94, 118.45, 117.14, 111.99).

[0086] (2) Dissolve compound 1 (2 g, 4.73 mmol) and 4,4,4',4',5,5,5',5'-octamethyl-2,2'-bi(1,3,2-dioxaborolane) (3 g, 11.82 mmol) in tetrahydrofuran (THF, 30 mL). Subsequently, add [1,1'-bis(diphenylphosphino)ferrocene] palladium(II) dichloride dichloromethane complex (127.47 mg, 0.16 mmol) and potassium acetate (1.96 g, 20.01 mmol), and heat to 65 °C under an argon atmosphere for an overnight reaction. After the reaction is completed, cool to room temperature and add ultrapure water (30 mL) to terminate the reaction. The resulting mixture is extracted three times with dichloromethane (CH2Cl2). The combined organic phases are dried over anhydrous MgSO4 and concentrated. The crude product is purified by silica gel column chromatography using dichloromethane / hexane (volume ratio 1:1) as the elution solvent to obtain compound 2 (yield: 34%). The chemical structural formula of compound 2 is shown in Figure 9 .

[0087] The 1 1H NMR spectrum of compound 2 in CDCl3 at 298 K, 13 and the Figure 10 13C nuclear magnetic resonance spectrum are shown in Figure 11 . 1 1H NMR (400 MHz, Chloroform-d) δ 8.01 (d, J = 8.5 Hz, 2H), 7.87 (d, J = 8.2 Hz, 2H), 7.71 (d, J = 8.1 Hz, 2H), 7.58 – 7.50 (m, 2H), 7.45 (t, J = 7.5 Hz, 2H), 7.34 (q, J = 7.3 Hz, 4H), 7.27 (d, J = 7.3 Hz, 2H), 6.63 (d, J = 8.1 Hz, 2H), 1.30 (s, 12H). 13 13C NMR (101 MHz, Chloroform-d) δ 152.82, 144.10, 135.80, 135.21, 130.32, 128.53, 126.44, 126.17, 126.09, 125.36, 124.42, 118.54, 83.44, 24.89).

[0088] (3) Dissolve compound 2 (1 g, 2.12 mmol) and 4,9-dibromonaphthothiadiazole (243.11 mg, 0.71 mmol) in toluene (20 mL). Subsequently, add potassium carbonate (314 mg, 2.27 mmol) dissolved in 908 μL of water. Then, add tetrakis(triphenylphosphine)palladium(0) (27.08 mg, 0.023 mmol), heat to 110 °C under an argon atmosphere, and carry out the reaction overnight. After the reaction is completed, cool to room temperature and add ultrapure water (30 mL) to terminate the reaction. The resulting mixture is extracted three times with dichloromethane (CH2Cl2). The combined organic phases are dried over MgSO4 and concentrated. The crude product is purified by silica gel column chromatography using dichloromethane / n-hexane (volume ratio 2:1) as the elution solvent to obtain compound 3 (yield: 23%). The chemical structural formula of compound 3 is shown in Figure 12 .

[0089] The 1 1H NMR spectrum of compound 3 [N,N′-(naphtho[2,3-c][1,2,5]thiadiazole-4,9-diylbis(4,1-phenylene))bis(N-(naphthalen-1-yl)naphthalen-1-amine)] in CDCl3 is shown in Figure 13 . 1 1H NMR (400 MHz, Chloroform-d) δ 8.35 (d, J = 9.1 Hz, 2H), 8.15 (d, J = 8.4 Hz, 4H), 8.02 (d, J = 9.0 Hz, 2H), 7.85 (d, J = 8.2 Hz, 4H), 7.68 (d, J = 7.2 Hz, 4H), 7.44 – 7.31 (m, 20H), 6.81 (d, J = 8.2 Hz, 4H).

[0090] The 13 13C NMR spectrum of [N,N′-(naphtho[2,3-c][1,2,5]thiadiazole-4,9-diylbis(4,1-phenylene))bis(N-(naphthalen-1-yl)naphthalen-1-amine)] in CDCl3 at 298 K is shown in Figure 14 . 13 13C NMR (101 MHz, Chloroform-d) δ 151.07, 150.40, 144.08, 135.27, 133.11, 132.39, 132.10, 131.14, 130.42, 128.63, 128.23, 127.85, 127.40, 126.52, 126.45, 126.28, 126.23, 126.18, 125.50, 124.41, 118.99).

[0091] 1 mg of the photosensitizer drug molecule (NTPN) with photodynamic properties and 4 mg of DSPE-PEG2000 were completely dissolved in 600 μL of tetrahydrofuran (THF). Subsequently, under the condition of rapid stirring, the drug solution was injected into 6 mL of deionized water through a syringe. Stirring was carried out overnight at room temperature in a fume hood to remove THF from the solution. The obtained photosensitizer nanoparticles (NT) were collected by centrifugation using a centrifugal filter with a molecular weight cut-off of 100 kDa. The prepared nanoparticles (1 mL, with a concentration of 1 mg / mL in terms of NTPN) were mixed with 2 mg of the ANX5-P cell membrane carrier under ultrasonic conditions (100 W, 50 Hz, 10 minutes). Then, extrusion through a polycarbonate membrane was carried out to generate NT@ANX5-P nanoparticles, which is the tumor immunotherapy nano-vaccine NT@ANX5-P encapsulated by engineered cell-derived vesicles. The prepared NT@ANX5-P nano-vaccine was stored at 4 °C.

[0092] Meanwhile, in the same way, the photosensitizer nanoparticles were mixed with 4T1 cell membrane and 4T-ANX5 cell membrane under ultrasonic conditions respectively to prepare NT@M nano-vaccine and NT@ANX5 nano-vaccine.

[0093] Transmission electron microscope (TEM) images revealed the typical core-shell structure of these nano-vaccines, with an obvious membrane layer around the nano-vaccine core ( Figure 15 ). Dynamic light scattering (DLS) measurements ( Figure 16 ) showed that the average diameter of all nano-vaccines was about 150 nm, and among them, due to the addition of the PEG layer, the NT@ANX5-P nano-vaccine was slightly larger than other nano-vaccines. In addition, after cell membrane camouflage, the ζ potential of the NT@M nano-vaccine decreased from -22.37 mV to -30.67 mV due to the addition of the negatively charged cell membrane, while the surface charge of the NT@ANX5-P nano-vaccine further decreased after weak charge PEG modification ( Figure 17 ).

[0094] Example 2 Performance determination of ANX5 nano-vaccine

[0095] 1. Evaluate the stability of ANX5 nano-vaccine

[0096] In this example, the stability of different nano-vaccines over a period of time was evaluated. When incubated in PBS, the hydrodynamic sizes of the NT nano-vaccine, NT@M nano-vaccine, and NT@ANX5-P nano-vaccine hardly changed within 7 days ( Figure 18 ), indicating that they have high stability under physiological conditions.

[0097] 2. In vitro verification of ROS-responsive cleavage of TK bonds on the surface of the nano-vaccine and exposure of ANX5

[0098] By treating with the chemotherapeutic drug doxorubicin (Dox), phosphatidylserine (PS) was induced to be exposed on the surface of 4T1 tumor cells. The competitive binding between fluorescently labeled Annexin V-APC700 and ANX5 exposed on the surface of the nanovesicles was used to analyze the cleavage of TK bonds and the exposure of ANX5 caused by ROS generated by H2O2 treatment.

[0099] After treatment of NT@ANX5-P nano-vaccine with H2O2, the binding of NT@ANX5-P nano-vaccine to PS was restored. In addition, by treating with the chemotherapeutic drug doxorubicin (Dox), PS was induced to be exposed on the surface of 4T1 tumor cells. Through flow cytometry imaging ( Figure 19 ), it was observed that the NT@ANX5 nano-vaccine could effectively bind to PS exposed on the surface of tumor cells, while the NT@ANX5-P nano-vaccine showed weaker binding ability due to the protective PEG layer. Notably, H2O2 treatment significantly restored this binding ability. These results indicate that ROS-triggered PEG layer cleavage can regulate the exposure of ANX5, thus promoting the binding of PS.

[0100] 3. Detection of the in vitro tumor targeting ability of the nano-vaccine

[0101] The uptake of various nano-formulations by 4T1 cells was evaluated by confocal laser scanning microscopy (CLSM), with the red fluorescence of NTPN as an indicator. After co-incubation with nanoparticles (10 μM) (NT+L group, NT@M group, NT@ANX5-P group) at 37 °C for 6 hours, the cells treated with NT@M or NT@ANX5-P nanoparticles showed significantly stronger red fluorescence than the group treated with uncoated NT nanoparticles ( Figure 20 and Figure 21 ). Flow cytometry analysis further confirmed that the ability of nanoparticles camouflaged with homologous tumor cell membranes to be phagocytosed by tumor cells (79.5%) was significantly increased compared with the group of uncoated NT nanoparticles (51.3%), while the addition of the PEG protective layer did not significantly affect the ability of nanoparticles to be taken up by tumor cells ( Figure 22 ). There was no significant difference between the NT@M group and the NT@ANX5-P group, indicating that ANX5 modification did not affect the endocytosis of nanoparticles by target cells.

[0102] 4. Analysis of the in vitro tumor proliferation inhibitory ability of the nano-vaccine

[0103] CCK-8 analysis of the viability of 4T1 cells after treatment with different nanoparticles and light therapy (+L); C: PBS, C2: PBS + L, C3: NT + L, C4: NT@M + L, C5: NT@ANX5-P + L.

[0104] CCK-8 cell viability assays showed that all the nano-vaccines exhibited dose-dependent cytotoxicity against 4T1 cells under light irradiation (0.3 W / cm², 2 min) Figure 23 ). Notably, NT@M and NT@ANX5-P nanoparticles showed significantly higher photo-induced toxicity compared to the bare nanoparticle group. Cell viability was further evaluated by live-dead cell co-staining experiments. As Figure 24 shown, under light irradiation conditions, the proportion of green live cells stained with Calcein-AM was significantly reduced in cells treated with NT@M or NT@ANX5-P, indicating a higher level of cell death.

[0105] 5. Analysis of the function of activating immune cells by nano-vaccines in vitro

[0106] To evaluate the phagocytic clearance of tumor cell death under different conditions, bone marrow-derived macrophages (BMDMs) were collected and co-cultured with tumor cells treated with different regimens. The results showed that tumor cells treated with "NT + L" or "NT@M + L" exhibited significant macrophage phagocytosis, with approximately 70% to 80% of BMDMs actively participating in the clearance of dead tumor cells ( Figure 25 ). However, in the "NT@ANX5-P + L" group, phagocytosis was significantly reduced (approximately 50%), indicating that PS blockade inhibited the phagocytic activity of BMDMs.

[0107] Subsequently, the present invention evaluated the effects of PS blockade on macrophage phenotype polarization and cytokine secretion. Flow cytometry analysis showed that phagocytosis of dead cancer cells induced by PDT polarized BMDMs into an immunosuppressive M2 (CD206 + ) phenotype ( Figure 26 ). However, for BMDMs co-cultured with dead tumor cells treated with "NT@ANX5-P + L", the proportion of the immunosuppressive M2 phenotype was significantly reduced. Subsequently, the supernatants of these BMDMs were collected and analyzed for cytokine secretion using an ELISA kit. As Figure 27As shown, BMDMs co-cultured with dead 4T1 cells treated with "NT NPs + L" or "NT@M NPs + L" secreted a large amount of immunosuppressive cytokines, including TGF-β. In contrast, when co-cultured with cells treated with "NT@ANX5-P + L", the levels of immunosuppressive cytokines secreted by BMDMs were significantly reduced. At the same time, blocking phagocytosis through PS blockade led to more secretion of pro-inflammatory mediators by BMDMs, including IL-1β ( Figure 28 ).

[0108] 6. Analysis of tumor cell immunogenicity after nanoparticle treatment

[0109] Immunofluorescence staining showed that compared with other treatment groups, the expression of the cell surface immunogenic marker ecto-CRT was significantly increased after tumor cells treated with NT@ANX5-P and light were co-cultured with BMDMs ( Figure 29 ), indicating that inhibiting the phagocytic clearance of dead tumor cells through PS blockade promoted the expression of ecto-CRT. Further, the release of HMGB1 in the cell supernatant was analyzed by Western blot, and the results showed that after treatment with "NT@ANX5-P + light", the release of HMGB1 in 4T1 cells was significantly increased ( Figure 30 ). The concentration of HSP70 in the supernatant of 4T1 cells treated with "NT@ANX5-P + light" was also the highest compared with other treatment groups ( Figure 30 ).

[0110] 7. Analysis of the antitumor ability of the nano-vaccine in vivo

[0111] The present invention further evaluated its antitumor effect in vivo. 4T1 cells were subcutaneously injected into the right abdomen of mice. Seven days later, when the tumor volume reached 100 mm³, the mice were then randomly divided into five groups (n = 5 per group) and treated with the following formulations: PBS, L, NT + L, NT@M + L, and NT@ANX5-P + L. In the "L" group, the tumor site was treated with light (0.5 W / cm²) for 10 minutes 12 hours after injection of their respective formulations. This injection and irradiation procedure was repeated on days 1, 4, and 7. During the entire treatment period, the tumor volumes of mice in different treatment groups were monitored, and tumor samples were taken for analysis on day 14. The tumors of mice in the PBS group and the L group grew rapidly throughout the treatment process, indicating that the antitumor effect of simple laser treatment was limited ( Figure 31 and Figure 32). After treatment in the NT + L or NT@M + L group, compared with the PBS control group, tumor growth was significantly inhibited, but there was still moderate tumor growth. These results indicate that although photodynamic therapy (PDT) has a certain anti-tumor effect when used alone, the effect is not satisfactory. NT@ANX5-P combined with light irradiation significantly delayed tumor growth, and complete regression was observed in one of the five mice, which was not seen in any other group ( Figure 32 ). On day 14, the average tumor volume (146.82 mm³) in the "NT@ANX5-P + L" group was approximately 7.57-fold, 6.87-fold, 5.07-fold, and 3.21-fold smaller than those in the PBS (1111.33 mm³), L (1008.99 mm³), NT + L (743.99 mm³), and NT@M + L (471.27 mm³) groups ( Figure 31 ). These results indicate that the combination of potent PDT and PS blockade achieved the most effective tumor growth inhibition.

[0112] 8. Analysis of in vivo immune activation by nano-vaccine therapy

[0113] To confirm that PDT-induced tumor antigen generation and DAMP release can enhance the immunogenicity of tumor cells and promote dendritic cell (DC) maturation in a living model, the present invention collected the tumor-draining lymph nodes of mice for flow cytometry analysis. In the NT@ANX5-P plus light irradiation treatment group, the proportion of mature DCs (CD80 + CD86 + , gated by CD11c + ) was approximately 23.5%, which was significantly increased compared with the PBS group (3.29%), L group (4.54%), NT + L group (9.88%), and NT@M + L group (16.3%) ( Figure 33 ). The present invention then investigated whether the combination of downregulation of NT@ANX5-P-mediated immunosuppression and upregulation of immune activation could enhance the local anti-tumor immune response. Compared with the PBS control group or the simple light irradiation group, an increase in the proportion of cytotoxic CD8 + T cells (CD45 + CD3 + CD8 + ) was observed in the tumor tissues of mice treated with "NT + L" and "NT@M + L" ( Figure 34 ). This finding indicates that PDT may stimulate the immune response to some extent by enhancing tumor immunogenicity. It is worth noting that NT@ANX5-P + light irradiation treatment further enhanced the CD8 +The response of T cells was 7.32 times that of the PBS treatment group and 2.11 times that of the NT@M + light irradiation group ( Figure 34 ).

[0114] 9. In vivo safety evaluation of the nano-vaccine

[0115] Meanwhile, to verify the in vivo biosafety of the nano-vaccine, healthy mice were intravenously injected with the NT@ANX5-P nano-vaccine or PBS as a control through the tail vein. The hearts, livers, spleens, lungs, and kidneys of the mice in each group were subjected to HE staining to observe whether there was tissue damage. The results are as Figure 35 shown. There was no obvious histological damage, indicating the biosafety of the drug.

[0116] The embodiments described above are only descriptions of the preferred modes of the present invention and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. An engineered cell-derived vesicle-encapsulated tumor immunotherapy nano-vaccine, characterized in that, The nano-vaccine is obtained by PEG-modifying the tumor cell membrane with ANX5 protein anchored on the surface and then reacting with a photosensitizer; The accession number of the coding gene of the ANX5 protein on NCBI is NM_009673.2; and / or the PEG includes PEG5000; The tumor cell membrane includes breast cancer cell membrane; The nano-vaccine is prepared by the following method: Connect the coding gene of the ANX5 protein with a lentiviral expression vector to construct a recombinant lentiviral expression plasmid; then transfect the recombinant lentiviral expression plasmid into tumor cells and screen for a stable cell line with overexpression of ANX5; Introduce an N3 group onto the outer membrane of the stable cell line with overexpression of ANX5, then extract the cell membrane, and combine the cell membrane with PEG 5000-TK-DBCO to obtain ANX5-anchored PEG-camouflaged nanoparticles through click chemistry reaction; Ultrasonically react the ANX5-anchored PEG-camouflaged nanoparticles and photosensitizer nanoparticles, and extrude through a polycarbonate membrane to prepare a nano-vaccine for tumor immunotherapy encapsulated by engineered cell-derived vesicles.

2. The nano-vaccine according to claim 1, wherein The molar ratio of the N3 group in the cell membrane to the DBCO in the PEG 5000-TK-DBCO is 1:1; the time of the click chemistry reaction is 10-12 hours.

3. The nano-vaccine according to claim 1, characterized in that, The mass-volume ratio of the ANX5-anchored PEG-camouflaged nanoparticles to the photosensitizer nanoparticles is (1-5) mg:1 mL.

4. Use of the nano-vaccine according to any one of claims 1-3 in the preparation of a tumor immunotherapy product, characterized in that, The tumor is breast cancer.

5. A product, characterized in that, It includes the nano-vaccine described in claim 1 and pharmaceutically acceptable excipients and carriers.

Images