Beauveria bassiana ZJB24327 and application thereof

Abstract

The invention discloses beauveria bassiana ZJB24327 and an application of the beauveria bassiana ZJB24327. The beauveria bassiana ZJB24327 is high in sporulation quantity and good in ultraviolet tolerance, and has a very strong infection insecticidal effect on plutella xylostella, the sporulation quantity can reach 2.508 * 10 < 8 > / cm < 2 > in 10 days under an optimal condition, and the germination rate still reaches 8.14 + / -1.80% after 25 minutes of ultraviolet treatment. The method is suitable for being applied to high-altitude areas, and lays a foundation for large-scale production of beauveria bassiana.

Description

(I) Technical field

[0001] The invention belongs to the technical field of biological control and relates to a strain of Beauveria bassiana ZJB24327 pathogenic to the larvae of the diamondback moth and an application thereof. (II) Background technology

[0002] Pests refer to the damage caused by harmful insects to plant growth. For example, the diamondback moth (Plutellaxylostella L.) is a Lepidoptera pest belonging to the family Plutella xylostella. The larvae of the diamondback moth damage the leaves of cruciferous vegetables throughout the entire growth period. The adults lay eggs on the back of the leaves. The newly hatched larvae only eat the mesophyll, leaving the epidermis, forming translucent spots on the leaves. The third-instar larvae can eat holes and notches in the leaves. In severe cases, the whole leaf is eaten into a net shape, affecting the normal growth of vegetables, reducing the yield and quality of vegetables. In severe cases, the yield can be reduced by more than 90%, or even a total crop failure. It is reported that the food intake of the first-instar diamondback moth larvae accounts for 3% of the entire larval period, the 2-3-instar larvae account for 19% of the entire larval period, and the food intake of the fourth-instar larvae increases greatly, accounting for 78% and has strong drug resistance, so the diamondback moth larvae should be eliminated in time before the third-instar larvae.

[0003] Beauveria bassiana is the most widely used entomogenous fungus. Its spores are highly infectious and can be spread through air, water, insect body surface, etc. Beauveria bassiana has many advantages, such as wide host range, environmental safety, harmlessness to humans and animals, no killing of natural enemies, no resistance to insects, significant insecticidal effect, simple cultivation, and easy large-scale production. Therefore, it is of great significance to study the high-spore-producing strains of Beauveria bassiana. (III) Summary of the invention

[0004] The invention provides a strain of Beauveria bassiana ZJB24327 for preventing and controlling diamondback moth and application thereof. Combined with the experience of actual biological control, the virulence of different Beauveria bassiana strains varies greatly, and the pests have a long survival time from contact with the fungus to death, and can still cause serious damage to crops. Therefore, it is particularly important to select a strain with high virulence and short death time; secondly, the spore production of the strain, a high-virulence strain must have a higher spore production, so as to reduce the production cost, and finally realize large-scale industrial production and commercial application; and thirdly, the effect of Beauveria bassiana as a biological pesticide will be affected by the environment, and a high-virulence strain must also have good stress resistance to have better application prospects.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The first object of the present invention is to provide a Beauveria bassiana ZJB24327 for controlling Plutella xylostella, which is deposited in China Center for Type Culture Collection, with a deposit number of CCTCC NO: M 20242328, a deposit date of October 24, 2024, and an address of Wuhan University, Wuhan, China, 430072.

[0007] Another object of the present invention is to provide a biocontrol preparation prepared by the Beauveria bassiana ZJB24327 strain.

[0008] Furthermore, the active ingredient of the biocontrol agent is the conidia suspension of the Beauveria bassiana ZJB24327 strain.

[0009] Furthermore, the preparation steps of the biocontrol agent include: inoculating Beauveria bassiana ZJB24327 on a solid plate, maintaining the temperature at 27-29° C., culturing for 6-12 days, collecting conidia of ZJB24327 and suspending them in sterile water containing 0.05-0.1% Triton X-100.

[0010] Furthermore, the solid plate is: SDAY solid culture medium, PDA solid culture medium or CDA solid culture medium.

[0011] Specifically, the final concentration of the SDAY solid medium is composed of: 40g / L glucose, 10g / L yeast extract, 10g / L peptone, 20g / L agar, and the solvent is water. The PDA solid medium is composed of: 200g peeled potatoes, 20g glucose, 20g agar, and 1000ml distilled water. The final concentration of the CDA solid medium is composed of: 3g / L potassium nitrate, 1g / L dipotassium hydrogen phosphate, 0.5g / L magnesium sulfate (MgSO4·7H2O), 0.5g / L potassium chloride, 0.01g / L ferrous sulfate, 30g / L sucrose, 20g / L agar, and the solvent is water.

[0012] Preferably, the solid plate is recommended to be SDAY solid culture medium, and the preparation method of the biocontrol agent of Beauveria bassiana ZJB24327 is as follows:

[0013] (1) Slant culture: Beauveria bassiana ZJB24327 was inoculated onto SDAY solid medium for activation and kept at 28°C for 24-36 hours to obtain slant cells; the final concentration of the SDAY solid medium was as follows: 40 g / L glucose, 10 g / L yeast extract, 10 g / L peptone, 20 g / L agar, and the solvent was water;

[0014] (2) Liquid culture: a single colony was picked from the slant and inoculated into SDAY liquid medium, and cultured at 28°C with shaking at 200-250 rpm for 20-30 h to obtain seed solution; the final concentration of the SDAY liquid medium was composed of 40 g / L glucose, 10 g / L yeast extract, and 10 g / L peptone, and the solvent was water;

[0015] (3) Solid plate culture: Spread the seed solution on a SDAY solid culture medium plate, invert it in a constant temperature incubator at 28° C., culture for 9-12 days to obtain conidia, and wash and collect the conidia with sterile water containing 0.05-0.1% Triton X-100 to obtain a bacterial suspension. The composition of the SDAY solid culture medium is the same as that in step (1);

[0016] (4) Prepare conidia at a concentration of 10 6 pcs / ml~10 9 It is usually recommended to prepare a conidia concentration of 10 in sterile water containing 0.1% Triton X-100. 6 pcs / ml~10 8 Bacterial suspension of cells / ml.

[0017] The third object of the present invention is to provide an application of the Beauveria bassiana ZJB24327 in the preparation of biological control drugs for Plutella xylostella.

[0018] Furthermore, the medicine includes the biocontrol preparation of Beauveria bassiana ZJB24327.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] (1) The present invention provides a new strain for controlling Plutella xylostella - Beauveria bassiana ZJB24327.

[0021] (2) The lethality rate of strain ZJB24327 to Plutella xylostella was high, and the spore concentration of the strain was 1×10 8 The cabbage leaves treated with 100 conidia / mL bacterial suspension were fed to Plutella xylostella. On the 3rd, 5th and 7th days after feeding, the corrected mortality rates of ZJB24327 strain against the 3rd instar larvae of Plutella xylostella were 47.78±0.98%, 83.33±3.85% and 90±3.88%, respectively; the corrected mortality rates of ZJB24327 strain against the 2nd instar larvae of Plutella xylostella were 44.07±1.11%, 68.52±1.34% and 75.93±2.89%, respectively; the median lethal time (LT50) of ZJB24327 strain against the 3rd instar larvae of Plutella xylostella and the 2nd instar larvae of Plutella xylostella were 3.091d and 3.838d, respectively; the median lethal concentration (LC50) of ZJB24327 strain against the 3rd instar larvae of Plutella xylostella was 1.38×10 5 and 2.18×10 6Conidia / mL. Compared with the Beauveria bassiana HS-01 disclosed in the patent application number CN202111337604.1, the insecticidal effect on Plutella xylostella has been greatly improved.

[0022] (3) The spore production of strain ZJB24327 was high, and under optimal conditions, the spore production in 10 days could reach 2.508×10 8 Pieces / cm 2 Compared with the spore production of Beauveria bassiana IPPHBB2009B7 on solid plates disclosed in patent application number CN202311539869.9, which is 1.88×10 8 Pieces / cm 2 There has been a great improvement;

[0023] (4) Strain ZJB24327 has good tolerance to ultraviolet radiation, and the germination rate is still 8.14±1.80% after 25 minutes of ultraviolet treatment, which is suitable for application in high-altitude areas, laying a foundation for the large-scale production of Beauveria bassiana. (IV) Description of the drawings

[0024] Figure 1 : Morphological characteristics of a single colony of strain ZJB24327 cultured on SDAY solid medium for 7 days; a is the front view of a single colony, b is the back view of a single colony. c: Sporulation structure and conidia under an optical microscope magnified 400 times.

[0025] Figure 2 : Morphology of Plutella xylostella larvae infected with strain ZJB24327.

[0026] Figure 3 : Phylogenetic tree of strain ZJB24327.

[0027] Figure 4 : The cumulative corrected mortality of the bacterial suspension of strain ZJB24327 against the third instar larvae of Plutella xylostella.

[0028] Figure 5 : The cumulative corrected mortality of the bacterial suspension of strain ZJB24327 against the second-instar larvae of Plutella xylostella.

[0029] Figure 6 : Germination rate of strain ZJB24327 under ultraviolet (18W, 254nm) 60cm at different times. (V) Specific implementation methods

[0030] In order to better illustrate the purpose, technical scheme and advantages of the present invention, the present invention will be further described below in conjunction with specific drawings and embodiments. In the embodiments, the experimental methods used are conventional methods unless otherwise specified, and the materials, reagents, etc. used are all commercially available unless otherwise specified.

[0031] In order to explain the technical solution of the present invention more clearly and in detail, some embodiments are provided below for further explanation.

[0032] Example 1 Screening, identification and preservation of Beauveria bassiana ZJB24327

[0033] 1. Source of Materials

[0034] The original strain is Beauveria bassiana ZJB16001, which is deposited in the China Center for Type Culture Collection, with a deposit number of CCTCC NO: M 2023583, a deposit date of April 21, 2023, and an address of laboratory preservation at Wuhan University, 430072, Wuhan, China, which has been disclosed in patent application CN202310558818.4.

[0035] 2. The culture medium used is as follows:

[0036] (1) The final concentration of SDAY solid medium is as follows: glucose 40 g / L, yeast extract 10 g / L, peptone 10 g / L, agar 20 g / L, and the solvent is water.

[0037] (2) Final concentration composition of SDAY liquid culture medium: glucose 40 g / L, yeast extract 10 g / L, peptone 10 g / L, and the solvent is water.

[0038] 3. Screening of strain ZJB24327

[0039] (1) Initial screening

[0040] The original strain ZJB16001 was inoculated into SDAY solid slant medium and activated at 28°C for 3 days. A single colony was picked and placed in fresh SDAY liquid medium. The culture temperature was controlled at 28°C, the liquid volume was 20%, the rotation speed was 200-250rpm, and the culture was carried out for 36 hours to obtain a conidia solution. The conidia solution was then diluted with sterile water to a concentration of 1×10 7 The spore suspension was prepared by mixing 1-methyl-3-nitro-1-nitrosoguanidine (MNNG) aqueous solution with the spore suspension to a MNNG mass concentration of 2 g / L, and incubated at 28°C for 40 min. The cells were collected by centrifugation at 1200 rpm for 3 min, and washed twice with sterile water to prepare a conidia concentration of 1×10 7 Bacterial suspension of cells / ml.

[0041] The bacterial suspension was spread on SDAY solid culture medium plates respectively. After culturing at 28°C for 3 days, single colonies with high spore production were selected and placed on new SDAY solid culture medium plates. The colonies were inoculated on SDAY solid culture medium plates repeatedly to screen out strains with higher spore production as shown in Table 1.

[0042] (2) Rescreening

[0043] The original strain ZJB16001 and the strains numbered in Table 1 were inoculated onto plates of SDAY solid culture medium, respectively. After culturing at 28° C. for 7 days, the spore production, colony growth rate and UV tolerance (18 W, 254 nm, distance 60 cm) were measured using the methods of Examples 4 and 5. The results are shown in Table 1.

[0044] Table 1 Indicators for screening strains

[0045]

[0046] Entomogenous fungi are diverse in genetics, ecology and biology. The screening and acquisition of high-yield and high-quality strains is the primary prerequisite for achieving better control effects. The three main indicators considered in strain screening are spore production, colony growth rate and ultraviolet tolerance (pathogenicity is also an important indicator, and pathogenicity is generally positively correlated with spore production, so it is not screened separately). The present invention uses these indicators as the basis to screen excellent strains, and finally obtains an isolated strain ZJB16001-7014 with excellent performance, which is named strain ZJB24327.

[0047] 4. Identification of strain ZJB24327

[0048] (1) Morphological identification

[0049] Use an inoculation needle to pick up a small amount of spores of strain ZJB24327 and plant them on a SDAY solid plate. When the spores are mature, make a slide. Select a fine-textured transparent tape, use tweezers to hold a small piece of tape that has been cut to an appropriate size, and gently and slowly stick it from the edge of the colony to the center. Fix it with 95% alcohol, and place the transparent tape with the spore-producing structure facing up. After 2 minutes, gently put down the cover glass, and be careful to avoid bubbles. Observe under a low-power microscope to find the field of view, then add cedar oil or paraffin oil, and observe the structural characteristics of conidiophores, spore-producing cells and spores under an oil microscope. The results are shown in the figure. Figure 1 .

[0050] (2) Molecular Biological Identification

[0051] The strain ZJB24327 was inoculated into SDAY liquid medium, cultured at 200-250 rpm and 28°C for 3 days, and centrifuged at 12000 rpm for 10 min to collect the bacterial precipitate; the genome of the strain was extracted according to the instructions of the Spin Kit for Soil;

[0052] Using this genome as a template, the upstream primer: GTAGTCATATGCTTGTCTC, the downstream primer: ATTCCCCGTTACCCGTTG, sequence amplification was performed, and the amplification program was 95℃, 3min, 95℃, 30S, 52℃, 30S, 72℃, 1min, 16℃, insulation. The number of cycles was 30; the amplified sequence of rDNA-ITS of strain ZJB24327 was obtained and sent to Hangzhou Qingke Technology Co., Ltd. for sequencing. The nucleotides are shown in SEQ ID No.1. A homology comparison was performed on NCBI; the results showed that it belongs to the genus Beauveria, and has the highest homology with Beauveria bassianaARSEF 1564, reaching 98.18%. Ten representative strains of Beauveria were selected from them, and a phylogenetic tree was constructed using Maga11.0.6 software based on the homology of the 18S rRNA gene sequence, as shown in the following figure: Figure 3 .

[0053] The nucleotide sequence shown in SEQ ID No.1 is as follows:

[0054] AAGGTCTCGTTGGTGAACCAGCGGAGGGATCATTACCGAG

[0055] TTTTCAACTCCCTAACCCTTCTGTGAACCTACCTATCGTTGCTTCG

[0056] GCGGACTCGCCCCAGCCCGGACGCGGACTGGACCAGCGGCCCGC

[0057] CGGGGACCTCAAACTCTTGTATTCCAGCATCTTCTGAATACGCCG

[0058] CAAGGCAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTT

[0059] GGCTCTGGCATCGATGAAGAACGCAGCGAAACGCGATAAGTAAT

[0060] GTGAATTGCAGAATCCAGTGAATCATCGAATCTTTGAACGCACAT

[0061] TGCGCCCGCCAGCATTCTGGCGAGCATGCCTGTTCGAGCGTCATT

[0062] TCAACCTCGACCTCCCCTTGGGGAGGTCGGCGTTGGGGACCGG

[0063] CAGCACACCGCCGGCCCTGAAATGGAGTGGCGGCCCGTCCGCGG

[0064] CGACCTCTGCGCAGTAATACAGCTCGCACCGGGACCCCGACGCG

[0065] GCCACGCCGTAAAACACCCAACTTCTGAACGTTGACCTCGAATC

[0066] AGGTAGGACTACCCGCT.

[0067] (3) Identification results

[0068] Morphological characteristics: The colony texture of strain ZJB24327 on SDAY solid medium plate is fluffy, milky white on the front and light yellow on the back, with wrinkles in the center at the late stage of colony growth. Observation under an optical microscope revealed that the spore-forming cells of strain ZJB24327 are clustered on conidiophores, which are spike-shaped and extend to the top to form a curved conidial axis. Conidia are transparent, round or oval, with thin walls and smooth surfaces. It was initially identified as Beauveria ( Figure 1 ).

[0069] Molecular characteristics: The sequenced base sequence was compared with the gene sequence in the NCBI database by Blast, and it was found that it belongs to the genus Beauveria. Combined with the morphological identification of the strain, it can be determined that strain ZJB24327 is Beauveria bassiana. The inventor named the strain Beauveria bassiana ZJB24327, which is deposited in the China Center for Type Culture Collection, with the deposit number: CCTCC NO: M 20242328, the deposit date: October 24, 2024, the address: Wuhan University, Wuhan, China, 430072.

[0070] Entomogenous fungi are diverse in genetics, ecology and biology. The selection and acquisition of high-yield and high-quality strains is the primary prerequisite for achieving better control effects. The four main indicators considered in strain screening are spore production, colony growth rate, pathogenicity and ultraviolet tolerance. In the following Examples 2-5, the present invention uses these indicators as the basis to illustrate the performance of strain ZJB24327.

[0071] 5. Preservation of strains

[0072] Strain preservation: Beauveria bassiana ZJB24327 was inoculated into SDAY liquid culture medium, cultured at 28°C and 200-250 rpm for 12 h, the bacterial suspension was mixed with an equal volume of a 50% glycerol aqueous solution, and stored at -80°C.

[0073] Example 2: Determination of the Optimal Solid Plate and Culture Temperature for Beauveria bassiana Strain ZJB24327

[0074] (1) Screening of solid plates

[0075] The ZJB24327 strain was prepared into 1×10 7 The bacterial suspension with a concentration of conidia / mL was inoculated with the spore suspension at the center of SDAY solid medium, PDA solid medium, and Cha-type solid medium plates, respectively, and cultured at 28°C for 10 days. After the hyphae grew, fresh colonies were taken with a 13 mm diameter puncher. Five replicates were made, and the colony diameter was measured once a day. Conidia were collected on the 3rd, 6th, 9th, and 12th days, and the conidia production and colony diameter were determined using a hemacytometer.

[0076] The formula of each culture medium is:

[0077] SDAY solid culture medium plate: glucose 40g / L, yeast extract 10g / L, peptone 10g / L, agar 20g / L, solvent is water;

[0078] PDA solid culture medium plate: 200 g peeled potato, 20 g glucose, 20 g agar and 1000 ml distilled water;

[0079] CDA medium: 3 g / L potassium nitrate, 1 g / L potassium dihydrogen phosphate, 0.5 g / L magnesium sulfate (MgSO4·7H2O), 0.5 g / L potassium chloride, 0.01 g / L ferrous sulfate, 30 g / L sucrose, 20 g / L agar, the solvent is water;

[0080] The growth rate of ZJB24327 is shown in Table 2. Its growth rate on SDAY was the fastest and the conidia production was the highest, which was 2.487×10 8 Pieces / cm 2 The conidia production in PDA and Cha's medium were 1.737×10 8 Pieces / cm 2 and 1.969×10 8 Pieces / cm 2 .

[0081] Table 2 Colony diameter of strain ZJB24327 on solid plate

[0082]

[0083] (2) Determination of culture temperature

[0084] The ZJB24327 strain was prepared to a conidia concentration of 1×10 7 The center of the SDAY solid culture medium plate was inoculated with a suspension of spores / mL, and the plate was cultured in an incubator at 25, 26, 27, 28, and 29°C, with 5 replicates, and the colony diameter was measured once a day.

[0085] The colony diameters at various temperatures are shown in Table 3. The strain ZJB24327 grew fastest at 28°C, with the colony diameter reaching 73.68±0.94 mm on the 12th day. Therefore, the optimal culture temperature for the strain ZJB24327 was 28°C.

[0086] Table 3 Colony diameter of strain ZJB24327 at different temperatures

[0087]

[0088] Example 3: Preparation of Beauveria bassiana ZJB24327 bacterial suspension

[0089] (1) Slant culture: Beauveria bassiana ZJB24327 was inoculated onto SDAY solid medium and kept at 28°C for 24 h to obtain slant cells; the final concentration of SDAY solid medium was as follows: 40 g / L glucose, 10 g / L yeast extract, 10 g / L peptone, 20 g / L agar, and the solvent was water;

[0090] (2) Seed culture: A single colony was picked from the slant and inoculated into SDAY liquid medium. The culture was maintained at 28°C and shaken at 200-250 rpm for 24 h to obtain seed solution. The final concentration of SDAY liquid medium was as follows: 40 g / L glucose, 10 g / L yeast extract, and 10 g / L peptone. The solvent was water.

[0091] (3) Solid plate culture: Take 100 μL of the seed solution and spread it on a SDAY solid medium plate, invert it in a constant temperature incubator at 28°C, and culture it for 10 days. Wash the conidia with sterile water containing 0.1% Triton X-100 and place it in a container equipped with a magnetic stirrer. Then place it in a shaker at 180 rpm and 25°C for 30 minutes, filter it with double-layer lens paper, count the filtrate with a hemocytometer, and adjust the concentration of conidia to the required concentration with sterile water containing 0.1% Triton X-100 to prepare a bacterial suspension of Beauveria bassiana ZJB24327.

[0092] Example 4: Pathogenicity of the bacterial suspension of Beauveria bassiana ZJB24327 to the 2nd and 3rd instar larvae of Plutella xylostella

[0093] 1. Test strains:

[0094] The test strain was Beauveria bassiana ZJB24327;

[0095] The control strain 1 is Beauveria bassiana ZJB16001 (deposited in China Center for Type Culture Collection, deposit number: CCTCC NO: M 2023583, deposit date: April 21, 2023, address: Wuhan University, Wuhan, China, 430072), laboratory preserved, and disclosed in patent application CN 202310558818.4.

[0096] Control strain 2 is Beauveria bassiana ZJB23323, deposited in China Center for Type Culture Collection, deposit number: CCTCC NO: M 2023584, deposit date: April 21, 2023, address: China, Wuhan, Wuhan University, 430072, laboratory collection, disclosed in patent application CN 202310558818.4.

[0097] The blank control was sterile water containing 0.1% Triton X-100.

[0098] 2. Test insects:

[0099] Test insect source: Plutella xylostella L., Lepidoptera, Plutella xylostella, purchased from Taobao and artificially subcultured in the laboratory by the inventor.

[0100] 3. Experimental methods

[0101] (1) Preparation of bacterial suspension

[0102] The bacterial suspensions of the test strain, control strain 1 and control strain 2 were prepared using the method of Example 3 with a concentration of 1×10 4 , 1×10 5 , 1×10 6 , 1×10 7 , 1×10 8 and 1×10 9 Conidia / mL, and use it after determining the conidia activity.

[0103] (2) Determination of the toxicity of fungi to Plutella xylostella

[0104] The cabbage was processed into leaves of the same size, and then each cabbage leaf was evenly soaked in the bacterial suspension of the test strain, control strain 1 and control strain 2 and the blank control at room temperature for 30 seconds, and then spread out to dry and used to feed the diamondback moth. Three cabbage leaves treated with the same spore concentration of the test strain suspension were fed to 30 2nd-instar diamondback moth larvae and 30 3rd-instar diamondback moth larvae, and the cabbage leaves treated with the bacterial suspension of the control strain 1 and control strain 2 and the blank control were used as controls, and 5 parallel tests were performed for each group. Observation was performed regularly every day, and the larval mortality rate was recorded, and the observation was continued for 7 days.

[0105] (3) Data processing

[0106] All data are the mean values ​​of 3 independent measurements and are presented as values ​​± standard deviation (SD). Data were analyzed by one-way ANOVA followed by Dunnett's t test for intergroup comparison. P<0.05 was considered statistically significant compared with the control.

[0107] The experimental parameters were statistically calculated using Excel, the experimental data were analyzed using professional data statistical software IBM SPSSStatistics 27, and the graphs were drawn using Origin2021 software.

[0108] 4. The experimental results showed that the pathogenicity of each bacterial suspension to Plutella xylostella was significant, and the strain ZJB24327 was significantly higher than other strains. 9 Conidia / mL and 1×10 8 There was no significant difference in the treatment effects of conidia / mL, so no statistics were made. 8 After feeding the cabbage leaves soaked with the suspension of the test strains / mL to the diamondback moth for 3, 5, and 7 days, the corrected mortality rates of the third-instar larvae of the diamondback moth were 47.78±0.98%, 83.33±3.85%, and 90±3.88%, respectively. Figure 4 ), the corrected mortality rates of the second-instar larvae of Plutella xylostella were 44.07±1.11%, 68.52±1.34%, and 75.93±2.89% ( Figure 5 ); Use SPASS to calculate the lethal median time (LT) of the test strain suspension to the third-instar larvae and the second-instar larvae of the diamondback moth 50 ) were 3.096 and 3.838 respectively (Table 4 and Table 5); the median lethal concentration (LC) of the test strain suspension to the 3rd and 2nd instar larvae of Plutella xylostella 50 ) are 1.38×10 5 and 2.18×10 6 The experiment showed that the concentration and time required for ZJB24327 to kill 50% of Plutella xylostella were lower, so ZJB24327 had a stronger pathogenicity to Plutella xylostella.

[0109] Table 4 The median lethality of Beauveria bassiana ZJB24327, ZJB16001 and ZJB23323 suspensions to the third instar larvae of Plutella xylostella

[0110] strains ZJB24327 ZJB16001 ZJB23323 Regression equation 14.772X-0.9524 12.937X-4.7619 10.127X+0.794 <![CDATA[LT 50 (d)]]> 3.096 3.829 4.991 Correlation coefficient r 0.874 0.946 0.895

[0111] Table 5 The median lethality of Beauveria bassiana ZJB24327, ZJB16001 and ZJB23323 suspensions to the second instar larvae of Plutella xylostella

[0112] strains ZJB24327 ZJB16001 ZJB23323 Regression equation 11878X+1.746 10.295X+3.634 8.235X+5.873 <![CDATA[LT 50 (d)]]> 3.838 4.664 5.442 Correlation coefficient r 0.913 0.869 0.944

[0113] Example 5 Biological characteristics of Beauveria bassiana ZJB24327

[0114] 1. Test strains: Beauveria bassiana ZJB24327, ZJB16001, and ZJB2332.

[0115] 2. Experimental methods

[0116] (1) Preparation of bacterial suspension

[0117] The test strains were prepared using the method in Example 3 to 1×10 7 Conidia / mL of bacterial suspension.

[0118] (2) Determination of colony growth rate and spore production

[0119] The conidia concentration of strains ZJB24327, ZJB16001, and ZJB23323 was 1×10 7 The spore suspension was inoculated at the center of the SDAY solid medium plate with a concentration of 100 / mL. The plate was inoculated with spore suspension and cultured at 28°C for 5 replicates. The colony diameter was measured once a day, as shown in Table 6. On the 10th day, a 13 mm diameter puncher was used to collect fresh colonies and conidia, and the conidia production of a single colony was measured using a hemocytometer. The strain ZJB24327 had the fastest growth rate and the highest conidia production, which was 2.508×10 8 Pieces / cm 2 The conidia production of ZJB16001 and ZJB23323 was 1.649×10 8 Pieces / cm 2 and 1.785×10 8 Pieces / cm 2 .

[0120] Table 6 Colony diameter of strains

[0121]

[0122] (3) Determination of UV resistance:

[0123] 2mL (1×10 8 A bacterial suspension of Beauveria bassiana ZJB24327 with a concentration of 100 conidia / mL) was placed in a culture dish, placed in an ultraviolet mutagenesis chamber and the lid was opened. The bacterial suspension was exposed to ultraviolet rays (18W, 254nm) at 60cm for 0, 5, 10, 15, 20, 25, 30 and 35min respectively. The bacterial suspension without ultraviolet treatment was used as a control. 10μL of the bacterial suspension of each treatment was taken and evenly spread on a SDAY solid culture medium plate. The plate was placed in a 28°C incubator for culture, and each treatment was repeated 3 times. After 3 days of culture, the number of colonies in each treatment plate was counted, and the ratio of the number of colonies of the ultraviolet-treated strain to the number of colonies of the untreated strain was used to express the germination rate of conidia. Germination rate = number of colonies treated with ultraviolet light / number of colonies not treated with ultraviolet light. The strain ZJB24327 has outstanding ultraviolet tolerance, and still has a germination rate of 8.14±1.80% ( Figure 6 ).

[0124] The experimental results show that strain ZJB24327 has excellent properties, strong pathogenicity, high spore production, fast colony growth rate and high ultraviolet tolerance. 50 ) showed that it had high pathogenicity to the 2nd and 3rd instar larvae of Plutella xylostella. Under semi-field conditions, the spore suspension of the 3rd instar infection strain ZJB24327 of Plutella xylostella (1×10 8 The mortality rate of 1.34% conidia / mL after 7 days was as high as 90±3.88%, which was significantly higher than that of the control strains ZJB16001 and ZJB23323. Comprehensive comparison of various factors showed that strain ZJB24327 was a potential excellent biocontrol bacterium.

Claims

1. A Beauveria bassiana ZJB24327, characterized in that: The Beauveria bassiana ZJB24327 is deposited in the China Center for Type Culture Collection, with a deposit number of CCTCC NO: M 20242328, a deposit date of October 24, 2024, and an address of Wuhan University, 430072, Wuhan, China.

2. The biocontrol preparation prepared from Beauveria bassiana ZJB24327 as claimed in claim 1.

3. The biocontrol agent according to claim 2, characterized in that The active ingredient of the biocontrol agent is the conidia suspension of Beauveria bassiana ZJB24327 according to claim 1.

4. The biocontrol agent according to claim 3, characterized in that The preparation steps of the biocontrol agent include: inoculating Beauveria bassiana ZJB2432 on a solid plate, maintaining the temperature at 27-29° C., culturing for 6-12 days, collecting conidia and suspending them in sterile water containing 0.05-0.1% Triton X-100.

5. The biocontrol agent according to claim 4, characterized in that The solid plate is: SDAY solid culture medium, PDA solid culture medium or CDA solid culture medium.

6. The biocontrol agent according to claim 5, characterized in that The final concentration of the SDAY solid culture medium is composed of 40 g / L glucose, 10 g / L yeast extract, 10 g / L peptone, and 20 g / L agar, and the solvent is water; the PDA solid culture medium is composed of 200 g peeled potatoes, 20 g glucose, and 20 g agar, and 1000 ml of distilled water is added; the final concentration of the CDA solid culture medium is composed of 3 g / L potassium nitrate, 1 g / L dipotassium hydrogen phosphate, 0.5 g / L magnesium sulfate, 0.5 g / L potassium chloride, 0.01 g / L ferrous sulfate, 30 g / L sucrose, and 20 g / L agar, and the solvent is water.

7. The biocontrol agent according to claim 5, characterized in that The solid plate is SDAY solid culture medium, and the preparation method of the biocontrol agent is as follows: (1) Slant culture: Beauveria bassiana ZJB24327 was inoculated onto SDAY solid medium for activation and kept at 28°C for 24-36 hours to obtain slant cells; the final concentration of the SDAY solid medium was as follows: 40 g / L glucose, 10 g / L yeast extract, 10 g / L peptone, 20 g / L agar, and the solvent was water; (2) Liquid culture: a single colony was picked from the slant and inoculated into SDAY liquid medium, and cultured at 28°C with shaking at 200-250 rpm for 20-30 h to obtain seed solution; the final concentration of the SDAY liquid medium was composed of 40 g / L glucose, 10 g / L yeast extract, and 10 g / L peptone, and the solvent was water; (3) Solid plate culture: The seed solution was spread on a SDAY solid plate, which was inverted in a constant temperature incubator at 28°C, and cultured for 9-12 days to obtain conidia, and the conidia were washed and collected with sterile water containing 0.05-0.1% Triton X-100 to obtain a bacterial suspension. The final concentration of the SDAY solid plate was composed of 40 g / L glucose, 10 g / L yeast extract, 10 g / L peptone, and 20 g / L agar, and the solvent was water; (4) Prepare conidia at a concentration of 10 6 pcs / ml~10 9 Bacterial suspension of cells / ml.

8. The biocontrol agent according to claim 7, characterized in that In step (4), a conidia concentration of 10% is prepared by using sterile water containing 0.1% Triton X-100. 6 pcs / ml~10 8 Bacterial suspension of cells / ml.

9. Use of Beauveria bassiana ZJB24327 as claimed in claim 1 in the preparation of biological control drugs for Plutella xylostella.

10. The use according to claim 9, characterized in that The medicine comprises a biocontrol preparation of Beauveria bassiana ZJB24327.

Images