A sucrose isomerase mutant and its application in the preparation of isomaltulose
By mutating specific amino acid sites in sucrose isomerase, its catalytic efficiency and selectivity are improved, solving the problem of low catalytic efficiency in the existing technology and achieving the effect of efficient preparation of isomaltulose.
Patent Information
- Application Number
- CN202510109037.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-23
- Publication Date
- 2025-10-03
- Estimated Expiration
- 2045-01-23
AI Technical Summary
Existing sucrose isomerase has low catalytic efficiency and poor stability, resulting in low selectivity of isomaltulose product and a large number of by-products, which limits its application efficiency in the preparation of isomaltulose.
By performing single-point or multi-point combination mutations at positions 149, 222, and 297 of the amino acid sequence of sucrose isomerase, a highly efficient sucrose isomerase mutant is prepared, thereby improving its catalytic efficiency and selectivity.
The selectivity and enzyme activity of isomaltulose are improved, the reaction time is shortened, the production cost is reduced, and the efficiency of preparing isomaltulose is improved.
Smart Images

Figure CN119842680B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, in particular to a sucrose isomerase mutant and application thereof in the preparation of isomaltulose. Background Art
[0002] Isomaltulose, also known as palatinose, is a natural functional sugar. It is formed by an α-1,6 glycosidic bond connecting one glucose molecule to one fructose molecule. It is an isomer of sucrose. Its appearance and taste are similar to sucrose, but its sweetness is slightly lower, at approximately 42% of sucrose. Isomaltulose's sweet properties and unique health benefits have broad applications in the food and health sectors.
[0003] The method of extracting isomaltulose from plants is difficult to meet the current market demand. The methods currently developed for preparing isomaltulose include chemical synthesis and biotransformation. The chemical synthesis method is difficult to synthesize, expensive, and has serious environmental pollution. The microbial transformation method also has many problems, such as a long production cycle and difficult separation and extraction. In contrast, the enzyme-catalyzed synthesis method has obvious advantages. It can directly use sucrose isomerase to react, can be applied to higher concentrations of substrates, and conforms to the concept of green production. Therefore, the enzyme-catalyzed synthesis method is considered to be the most effective method for preparing isomaltulose.
[0004] Sucrose isomerase (SIase, EC 5.4.99.11) can isomerize sucrose to isomaltulose and has potential value in carbohydrate conversion and the development of new sugar sources. Sucrose isomerase is primarily found in bacteria, such as Klebsiella sp., Serratia plymuthica sp., Protaminobacter rubrum sp., Erwinia sp., and Pantoea adiposa. However, currently available sucrose isomerases generally suffer from poor stability, low catalytic efficiency and isomaltulose product selectivity, and a large number of byproducts. These issues limit the efficiency and effectiveness of sucrose isomerase in practical applications, making it difficult for it to realize its potential. Summary of the Invention
[0005] In order to solve the technical problem of low catalytic efficiency of sucrose isomerase, the present invention provides a sucrose isomerase mutant and its application in the preparation of isomaltulose.
[0006] The specific technical solutions of the present invention are:
[0007] In a first aspect, the present invention provides a sucrose isomerase mutant, which is obtained by subjecting the amino acid sequence shown in SEQ ID NO.1 to single-point mutation or multi-point combined mutation at the following positions:
[0008] The amino acid at position 149 was mutated from arginine (R) to glutamine (Q);
[0009] The amino acid at position 222 was mutated from aspartic acid (D) to glutamic acid (E);
[0010] The amino acid at position 297 was mutated from phenylalanine (F) to tyrosine (Y).
[0011] The present invention improves the catalytic efficiency of a sucrose isomerase mutant for catalyzing the production of isomaltulose from sucrose by performing single-point mutations at positions 149, 222, and 297, or by combining any of the aforementioned multiple mutations, in the amino acid sequence shown in SEQ ID NO. 1. This is specifically reflected in increased isomaltulose selectivity and enzyme activity. When isomerizing sucrose to produce isomaltulose, the mutant exhibits significantly improved selectivity for the product, isomaltulose. Simultaneously, the catalytic activity of the sucrose isomerase mutant is also enhanced. Consequently, the sucrose isomerase mutant catalyzes the production of isomaltulose with high efficiency and a short reaction time.
[0012] In a second aspect, the present invention provides a gene encoding the above-mentioned sucrose isomerase mutant.
[0013] In a third aspect, the present invention provides an expression vector or a cloning vector of the above-mentioned encoding gene.
[0014] Preferably, the expression vector is a plasmid, phage or viral vector.
[0015] In a fourth aspect, the present invention provides a host cell carrying the above-mentioned encoding gene or the above-mentioned expression vector, for example, a genetically engineered bacterium for expressing the above-mentioned sucrose isomerase mutant.
[0016] In a fifth aspect, the present invention provides use of the aforementioned sucrose isomerase mutant in the preparation of isomaltulose.
[0017] The application method comprises the following steps: using sucrose as substrate and the sucrose isomerase mutant as catalyst.
[0018] Compared with the prior art, the present invention has the following technical effects:
[0019] 1. The present invention improves the catalytic efficiency of a sucrose isomerase mutant for catalyzing the production of isomaltulose from sucrose by performing single-point mutations or any combination of mutations at positions 149, 222, and 297 of the amino acid sequence set forth in SEQ ID NO. 1. Specifically, this is reflected in increased isomaltulose selectivity and enzyme activity. When isomerizing sucrose to produce isomaltulose, the mutant exhibits significantly improved selectivity for the product isomaltulose. Simultaneously, the catalytic activity of the sucrose isomerase mutant is also enhanced. Consequently, the sucrose isomerase mutant catalyzes the production of isomaltulose with high efficiency and a short reaction time.
[0020] 2. The present invention uses the wet cells of the above-mentioned sucrose isomerase mutant to directly apply to the enzymatic catalytic preparation of isomaltulose, which has the outstanding advantages of low production cost and high efficiency. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Figure 1 It is the sucrose conversion rate of sucrose isomerase SI5, SI5-R149Q, SI5-D222E, SI5-F297Y, and Sl5-R149Q / D222E / F297Y at a sucrose concentration of 600 g / L. DETAILED DESCRIPTION
[0022] The present invention will be further described below with reference to the following embodiments. Those skilled in the art will be able to implement the present invention based on these descriptions. Furthermore, the embodiments of the present invention described below are generally only a portion of the embodiments of the present invention, rather than all of the embodiments. Therefore, all other embodiments derived by those skilled in the art based on the embodiments of the present invention without inventive effort should fall within the scope of protection of the present invention.
[0023] In the following examples, the culture medium involved is composed as follows:
[0024] LB liquid medium: yeast extract 5 g / L, sodium chloride 10 g / L, peptone 10 g / L.
[0025] In the following examples, the detection methods involved are as follows:
[0026] (1) Method for determining the activity of sucrose isomerase:
[0027] To 1 mL of 50 mM pH 6.0 citric acid-disodium hydrogen phosphate buffer containing 200 g / L sucrose, wet cells containing recombinant sucrose isomerase were added at a final concentration of 2 g / L. The reaction was carried out at 40°C for 4 min, and then the enzymatic reaction was terminated by boiling in 100°C water bath for 10 min. The supernatant was collected by centrifugation, and the isomaltulose content in the reaction solution was determined by HPLC.
[0028] (2) Definition of sucrose isomerase activity unit (U):
[0029] At pH 6.0 and 40°C, the micromolar amount of sucrose converted by each gram of wet bacteria in 4 minutes is defined as one unit of enzyme activity.
[0030] The specific enzyme activity was defined as the enzyme activity per unit wet cell U / g.
[0031] (3) Detection of the content of isomaltulose:
[0032] The isomaltulose content was determined using an Agilent liquid chromatograph (Agilent 1260 InfinityⅡLC) and an Elite amino column (SupersilNH2 plus 5um4.6mm*250mm). The mobile phase was acetonitrile:water (75:25), the injection volume was 10μL, the flow rate was 1mL / min, the column temperature was 30℃, the detector was a differential refractive index detector (RID), and the detector temperature was 31.5℃.
[0033] (4) Method for determining the selectivity of isomaltulose product of sucrose isomerase:
[0034] In 10 mL of pH 6.0, 50 mM citric acid-disodium hydrogen phosphate buffer, add 0.05 g of wet cells of the recombinant strain containing sucrose isomerase (5 g / L) and 1 g of sucrose (100 g / L). The reaction was carried out at 700 rpm and 40°C for 0.5 h. The reaction was terminated by boiling for 10 min. Centrifugation was performed at 12,000 rpm for 10 min, and the supernatant was collected. The centrifuged supernatant was diluted 100 times with ultrapure water and filtered through an aqueous filter membrane (0.22 μm). After high-performance liquid chromatography analysis, the content of sucrose, isomaltulose, trehalulose, glucose, and fructose in the reaction system was determined. Three parallel experiments were performed, and the final results were expressed as mean ± standard deviation.
[0035] (5) Isomaltulose selectivity (the calculation method for trehalulose, glucose and fructose is the same as that for isomaltulose) is calculated using the following formula:
[0036]
[0037] Example 1 Construction of recombinant E. coli BL21(DE3) / pET-28a(+)-SI5
[0038] (1) In this example, sucrose isomerase SI5 from Serratia symbiotica was used as the wild-type enzyme. The amino acid sequence of wild-type SI5 is shown in SEQ ID NO. 1. The codons encoding the wild-type enzyme SI5 were optimized to obtain the optimized nucleotide sequence shown in SEQ ID NO. 2. A 6×His tag was inserted at the C-terminus of the nucleotide sequence shown in SEQ ID NO. 2, and the gene was synthesized and cloned into the vector pET-28a(+) with the cloning sites Nco I and Xho I to obtain the recombinant plasmid pET-28a(+)-SI5, which was stored at -20°C.
[0039] (2) Add 10 μL of recombinant plasmid pET-28a(+)-SI5 to 100 μL of E. coli BL21(DE3) competent cells and mix gently. After ice bathing for 30 minutes, heat shock in a 42°C water bath for 90 seconds. After heat shock, quickly place on ice for 2 minutes, add 800 μL of LB culture medium, place at 37°C, shake on a shaker at 200 rpm for 1.5 hours, collect the bacteria after centrifugation at 5000 rpm for 2 minutes, take 80 μL of supernatant to resuspend the bacteria, and spread on LB solid culture medium plates containing 100 μg / mL kanamycin. Invert and culture in a 37°C constant temperature incubator overnight to prepare recombinant E. coli BL21(DE3) / pET-28a(+)-SI5.
[0040] Example 2 Mutation Design and Construction of Sucrose Isomerase
[0041] Site-directed mutagenesis was performed based on the amino acid sequence of wild-type SI5 (as shown in SEQ ID NO. 1). Primers were designed, and whole-plasmid PCR was performed using the E. coli BL21(DE3) / pET-28a(+)-SI5 expression vector prepared in Example 1 as a template. Site-directed mutagenesis was performed to obtain the sucrose isomerase mutant plasmids pET-28a(+)-SI5-R149Q, pET-28a(+)-SI5-D222E, pET-28a(+)-SI5-F297Y, and pET-28a(+)-SI5-R149Q / D222E / F297Y.
[0042] The primers used for the design of site-directed mutagenesis of sucrose isomerase are as follows:
[0043] (1) Single point mutation: The 149th amino acid of wild-type SI5 was mutated from arginine (R) to glutamine (Q). Primers for the sucrose isomerase mutant plasmid pET-28a(+)-SI5-R149Q obtained by site-directed mutagenesis:
[0044] The upstream primer was: ACACCAGCGACCAGCATGCGTGGTTCGTGAAGAGC;
[0045] The downstream primer is: ATGCTGGTCGCTGGTGTGATTGATGACGATGT.
[0046] (2) Single point mutation: The amino acid 222 of wild-type SI5 was mutated from aspartic acid (D) to glutamic acid (E). The primers for the sucrose isomerase mutant plasmid pET-28a(+)-SI5-D222E obtained by site-directed mutagenesis are:
[0047] The upstream primer was: GTTCGTCAGGAACTGTATAAGATGTTACGTTTCTGGCTG;
[0048] The downstream primer is: TACAGTTCCTGACGAACATTGCTGTTGTCCCA.
[0049] (3) Single point mutation: The amino acid 297 of wild-type SI5 was mutated from phenylalanine (F) to tyrosine (Y). The primers for the sucrose isomerase mutant plasmid pET-28a(+)-SI5-F297Y obtained by site-directed mutagenesis are:
[0050] The upstream primer was: ATTGTATGGTATCCCGCTGGACCAATCTATCA;
[0051] The downstream primer is: GCGGGATACCATACAATTCGCCAGCCGTCGCA.
[0052] (4) The wild-type SI5 was simultaneously mutated by site-directed mutation: the 149th amino acid was mutated from arginine (R) to glutamine (Q), the 222th amino acid was mutated from aspartic acid (D) to glutamic acid (E), and the 297th amino acid was mutated from phenylalanine (F) to tyrosine (Y). The sucrose isomerase mutant plasmid pET-28a(+)-SI5-R149Q / D222E / F297Y obtained by site-directed mutation was simultaneously mutated using the primers contained in the above single-point mutations.
[0053] The reaction system for PCR amplification of site-directed mutagenesis was 0.5 μL of dNTP Mix, 0.5 μL of DNA Polymerase, 10 μL of 2× Phanta Max Buffer, 1 μL of E. coli BL21 (DE3) / pET-28a (+) -SI5 plasmid, 6 μL of ddH2O, and 1 μL of each primer.
[0054] PCR program: 98°C pre-denaturation for 5 min, 98°C denaturation for 30 s, 60°C annealing for 30 s, and 72°C extension for 4 min, for 33 cycles.
[0055] After the completion of PCR, the amplified fragments were subjected to nucleic acid gel electrophoresis. The amplified fragments containing the target bands were purified using a kit, and 10 μL of the purified product was added to 100 μL of E. coli BL21 (DE3) competent cells and gently mixed. After ice bathing for 30 minutes, heat shock was performed in a 42°C water bath for 90 seconds. After heat shock, it was quickly placed on ice for 2 minutes, and then 800 μL of LB culture medium was added. The culture was placed at 37°C and shaken at 200 rpm for 1.5 hours. The bacteria were collected by centrifugation at 5000 rpm for 2 minutes, and 80 μL of the supernatant was used to resuspend the bacteria and spread on an LB solid culture medium plate containing 100 μg / mL kanamycin. The plate was inverted and cultured in a 37°C constant temperature incubator overnight.
[0056] A single colony was picked and placed in a 10 mL LB liquid culture medium tube containing 100 μg / mL kanamycin, and cultured at 37°C, 200 rpm, and shaking for about 12 h. The plasmids were extracted and sent to Beijing Qingke Biotechnology Co., Ltd. (Hangzhou) for sequencing verification. The plasmids pET-28a(+)-SI5-R149Q, pET-28a(+)-SI5-D222E, pET-28a(+)-SI5-F297Y, and pET-28a(+)-SI5-R149Q / D222E / F297Y were prepared, respectively.
[0057] Example 3 Expression of recombinant sucrose isomerase and its mutants and preparation of wet cells
[0058] (1) Take 10 μL of the plasmid pET-28a(+)-SI5 prepared in Example 1, and the plasmids pET-28a(+)-SI5-R149Q, pET-28a(+)-SI5-D222E, pET-28a(+)-SI5-F297Y, and pET-28a(+)-SI5-R149Q / D222E / F297Y prepared in Example 2, respectively, and add them to 100 μL of E. coli After gently mixing the BL21(DE3) competent cells, incubate on ice for 30 minutes, then heat shock in a 42°C water bath for 90 seconds. Immediately after the heat shock, place the cells on ice for 2 minutes. Add 800 μL of LB culture medium and incubate the cells on a shaker at 37°C at 200 rpm for 1.5 hours. Collect the cells by centrifugation at 5000 rpm for 2 minutes, resuspend the cells in 80 μL of the supernatant, spread the plates on LB solid medium containing 100 μg / mL kanamycin, and incubate them inverted in a 37°C incubator overnight. This step prepares recombinant E. coli expressing wild-type sucrose isomerase SI5 and its various mutants.
[0059] (2) Pick a single colony from step (1) and place it in a 10 mL LB liquid culture medium test tube containing 100 μg / mL kanamycin, and shake culture it at 37°C and 200 rpm for about 8 hours. Inoculate the seed solution grown in the test tube into a shake flask containing 100 μg / mL kanamycin in LB liquid culture medium according to a 2% inoculum volume ratio, and culture the bacteria at 37°C and 180 rpm until the OD value is 600 When the pH reaches 0.7, IPTG is added to a final concentration of 0.4 mM. After induction culture at 25°C for 12 hours, the culture is centrifuged at 8000 rpm at 4°C for 10 minutes, the supernatant is discarded, and the precipitate is collected. This step yields wet cells of recombinant E. coli containing wild-type sucrose isomerase SI5 and recombinant sucrose isomerases SI5-R149Q, SI5-D222E, SI5-F297Y, and SI5-R149Q / D222E / F297Y, respectively. These wet cells can be used directly as biocatalysts.
[0060] Example 4 Determination of Isomaltulose Product Selectivity of Recombinant Sucrose Isomerase
[0061] The wet cells prepared in Example 3, i.e., sucrose isomerase SI5 and its mutants SI5-R149Q, SI5-D222E, SI5-F297Y, and SI5-R149Q / D222E / F297Y, were used to catalyze the reaction with sucrose to determine the isomaltulose product selectivity of the sucrose isomerase. The following steps were followed:
[0062] In 10mL of pH 6.0, 50mM citric acid-disodium hydrogen phosphate buffer, add 0.05g of wet bacteria (5g / L) of the recombinant strain containing sucrose isomerase and 1g of sucrose (100g / L), and react at 700rpm and 40℃ for 0.5h. Boil for 10min to terminate the reaction. Centrifuge at 12000rpm for 10min, collect the supernatant, dilute the centrifuged supernatant 100 times with ultrapure water, and filter with an aqueous filter membrane (0.22μm) for high performance liquid chromatography analysis to determine the content of sucrose, isomaltulose, trehalulose, glucose and fructose in the reaction system. Set up three sets of parallel experiments, and the final results are expressed as mean ± standard deviation. The measurement results are shown in Table 1 below.
[0063] Table 1 Results of isomaltulose selectivity determination of SI5 and its mutants
[0064]
[0065] The results showed that the original isomaltulose product selectivity of sucrose isomerase SI5 was 72.4%, and the isomaltulose product selectivity of the mutants was significantly improved. Among them, the isomaltulose product selectivity of the mutant SI5-R149Q / D222E / F297Y was increased by 18.85% compared with the wild type. This shows that the sucrose isomerase mutant prepared by the present invention is conducive to improving the isomaltulose product selectivity of sucrose isomerase.
[0066] Example 5 Determination of enzyme activity of recombinant sucrose isomerase
[0067] The wet cells prepared in Example 3, i.e., sucrose isomerase SI5 and its mutants SI5-R149Q, SI5-D222E, SI5-F297Y, and SI5-R149Q / D222E / F297Y, were used to catalyze the substrate sucrose to determine the enzymatic activity of each enzyme. The following steps were followed:
[0068] Wet cells were added to 1 mL of 50 mM, pH 6.0 citric acid-disodium hydrogen phosphate buffer containing 100 g / L sucrose at a final concentration of 2 g / L. The reaction was carried out at 40°C for 4 min, and then the enzymatic reaction was terminated by boiling in 100°C water bath for 10 min. The supernatant was collected by centrifugation, and the content of isomaltulose in the reaction solution was detected by HPLC differential detection.
[0069] Definition of sucrose isomerase activity unit (U): Under the conditions of pH 6.0 and 40°C, the micromolar amount of sucrose converted by one gram of wet bacteria in 4 minutes is defined as one enzyme activity unit.
[0070] Enzyme activity comparison: The activity of sucrose isomerase SI5, reacted under the same conditions, was defined as 100%. The relative activity of the mutants was calculated based on the activity of sucrose isomerase. Specifically, the activity of the mutants was divided by the activity of sucrose isomerase SI5 to obtain the specific activity. The results are shown in Table 2.
[0071] Table 2 Results of enzyme activity determination of SI5 and mutants
[0072]
[0073]
[0074] The results showed that the original enzyme activity of sucrose isomerase SI5 was 24.37 U / g, and the enzyme activities of the mutants R149Q, D222E, and R149Q / D222E / F297Y were increased by 1.29 times, 1.08 times, and 1.34 times, respectively, compared with the original enzyme activity. This shows that the sucrose isomerase mutants prepared by the present invention are also beneficial for improving the enzyme activity of sucrose isomerase.
[0075] Example 6 Application of wild-type sucrose isomerase SI5 in the preparation of isomaltulose The recombinant Escherichia coli BL21 (DE3) / pET-28a (+) -SI5 wet bacteria (whole cells) containing the expression recombinant plasmid obtained in Example 3 was used as a biocatalyst, and sucrose was used as a substrate to carry out a bioconversion reaction to prepare isomaltulose. The composition and catalytic conditions of the catalytic system are as follows: a 10 mL reaction system containing 50 mM, pH 6.0 citric acid-disodium hydrogen phosphate buffer, 5 g / L recombinant sucrose isomerase SI5, an initial substrate final concentration of 600 g / L, a 40°C water bath, a magnetic stirring of 700 rpm, and regular sampling of the reaction with a sample volume of 100 μL. The sample was diluted 600 times with 75% acetonitrile, and the conversion rate at different times was determined by HPLC analysis. The results are as follows. Figure 1 shown.
[0076] The results showed that the sucrose conversion rate was 84% after 7 h of catalysis.
[0077] Example 7 Application of Sucrose Isomerase Mutant SI5-R149Q in the Preparation of Isomaltulose Using the recombinant E. coli BL21(DE3) / pET-28a(+)-SI5-R149Q wet bacteria (whole cells) containing the expression recombinant plasmid obtained in Example 3 as a biocatalyst, sucrose was used as a substrate to carry out a bioconversion reaction to produce isomaltulose. The catalytic system composition and catalytic conditions are the same as those in Example 6. The conversion rate at different times was determined by HPLC analysis. The results are shown in FIG. Figure 1 shown.
[0078] The results showed that after 7 h of catalysis, the sucrose conversion rate was 96%, and the sucrose isomerase mutant SI5-R149Q as a catalyst increased by 14.3% compared with the wild type.
[0079] Example 8 Application of Sucrose Isomerase Mutant SI5-D222E in the Preparation of Isomaltulose Using the recombinant Escherichia coli BL21 (DE3) / pET-28a (+) -SI5-D222E wet bacteria (whole cells) containing the expression recombinant plasmid obtained in Example 3 as a biocatalyst, sucrose was used as a substrate to carry out a bioconversion reaction to prepare isomaltulose. The catalytic system composition and catalytic conditions are the same as those in Example 6. The conversion rate at different times was determined by HPLC analysis. The results are as follows: Figure 1 shown.
[0080] The results showed that after 7 h of catalysis, the sucrose conversion rate was 93%, and the sucrose isomerase mutant SI5-D222E as a catalyst increased by 10.7% compared with the wild type.
[0081] Example 9 Application of Sucrose Isomerase Mutant SI5-F297Y in the Preparation of Isomaltulose Using the recombinant E. coli BL21(DE3) / pET-28a(+)-SI5-F297Y wet bacteria (whole cells) containing the expression recombinant plasmid obtained in Example 3 as a biocatalyst, sucrose was used as a substrate to carry out a bioconversion reaction to prepare isomaltulose. The catalytic system composition and catalytic conditions are the same as those in Example 6. The conversion rate at different times was determined by HPLC analysis. The results are as follows: Figure 1 shown.
[0082] The results showed that the sucrose conversion rate was 80% after 7 h of catalysis.
[0083] Example 10 Application of sucrose isomerase mutant SI5-R149Q / D222E / F297Y in the preparation of isomaltulose The recombinant Escherichia coli containing the expression recombinant plasmid obtained in Example 3 was used to generate the recombinant E. coli.
[0084] BL21(DE3) / pET-28a(+)-SI5-R149Q / D222E / F297Y wet bacteria (whole cells) were used as biocatalysts and sucrose was used as substrate to carry out bioconversion reactions to produce isomaltulose. The composition and catalytic conditions of the catalytic system were the same as those in Example 6. The conversion rates at different times were determined by HPLC analysis. The results are shown in FIG. Figure 1 shown.
[0085] The results showed that the sucrose conversion rate was 94% after 7 h of catalysis, and the sucrose isomerase mutant
[0086] The catalyst SI5-R149Q / D222E / F297Y increased by 11.9% compared with the wild type.
[0087] Unless otherwise specified, the raw materials and equipment used in the present invention are commonly used in the art; the methods used in the present invention are conventional methods in the art unless otherwise specified.
[0088] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent transformation made to the above embodiment based on the technical essence of the present invention still fall within the scope of protection of the technical solution of the present invention.
Claims
1. A sucrose isomerase mutant, characterized in that: The amino acid sequence shown in SEQ ID NO. 1 is obtained by single point mutation or triple point combination mutation at the following positions: Single point mutations are: The amino acid at position 222 was mutated from aspartic acid to glutamic acid; The three-point combination mutation is: The amino acid at position 149 mutated from arginine to glutamine, the amino acid at position 222 mutated from aspartic acid to glutamic acid, and the amino acid at position 297 mutated from phenylalanine to tyrosine.
2. A gene encoding the sucrose isomerase mutant according to claim 1.
3. An expression vector comprising the encoding gene according to claim 2.
4. The expression vector according to claim 3, wherein: The expression vector is a plasmid, phage or virus vector. A cloning vector comprising the encoding gene according to claim 2 . A host cell comprising the sucrose isomerase mutant according to claim 1 or the encoding gene according to claim 2.
7. Use of the sucrose isomerase mutant according to claim 1 in the preparation of isomaltulose.
8. The use according to claim 7, characterized in that: The preparation comprises the following steps: Sucrose is used as a substrate, and the sucrose isomerase mutant according to claim 1 is used as a catalyst.
Citation Information
Patent Citations
Sucrose isomerase mutant and application thereof in production of isomaltulose
CN119432953A