MiRNA simulant for targeted inhibition of large yellow croaker SOCS3 gene expression and application of miRNA simulant

Abstract

The invention discloses a miRNA simulant for inhibiting expression of a large yellow croaker SOCS3 gene and application of the miRNA simulant, and belongs to the field of biotechnology and genetic engineering. The miRNA is miR-181b, and the nucleotide sequence of the miRNA is as shown in SEQ ID NO. 2. The invention discloses a miR-181b simulant which is synthesized by a positive-sense strand and an antisense strand, and the nucleotide sequence of the miR-181b simulant is shown as SEQ ID NO.3-SEQ ID NO.4. The miR-181b simulant is transfected in primary lymphocytes of large yellow croakers, so that the mRNA level of SOCS3 genes of the large yellow croakers can be remarkably reduced, T and B lymphocyte proliferation is promoted, and the adaptive immune response is enhanced. Therefore, the miR-181b simulant has a potential application value in development of the pseudosciaena crocea immunomodulator.

Description

Technical Field

[0001] The invention belongs to the field of molecular biotechnology and genetic engineering, and specifically relates to a miRNA mimic for targeted inhibition of SOCS3 gene expression in large yellow croaker and an application thereof. Background Art

[0002] Cytokines are a broad class of small molecule proteins (5-20 kDa) that regulate the balance between humoral and cellular immune responses through specific receptors, and also regulate the maturation, growth and immune response of specific cell populations. Interleukins are cytokines produced by lymphocytes, monocytes or other non-mononuclear cells, and play an important regulatory role in cell-cell interactions, immune regulation, hematopoiesis and inflammation. Interleukin 4 (IL-4) and IL-13 are regulatory cytokines with similar structures and functions. They are mainly produced by Th2 cells (T-helper cell type 2) and mediate humoral immune responses by promoting Th cell differentiation, inducing major histocompatibility complex (MHC) II protein expression, antibody production, and antibody class switching (J. Zhu. 2015. T helper 2 (Th2) cell differentiation,type 2 innate lymphoid cell (ILC2) development and regulation of interleukin-4 (IL-4)and IL-13 production. Cytokine, 75(1), 14-24.). IL-4 and IL-13 mainly transmit signals through the JAK-STAT pathway, which is also strictly regulated. Suppressor of cytokine signaling 3 (SOCS3) is a key factor in negatively regulating the IL-4 and IL-13 signaling pathways (Pastuszak-Lewandoska D, et al. 2018. The Expression Levels of IL-4 / IL-13 / STAT6 Signaling Pathway Genes and SOCS3 Could Help to Differentiate the Histopathological Subtypes of Non-Small Cell Lung Carcinoma. Mol Diagn Ther. 22(5): 621-629.). Therefore, screening molecules that inhibit SOCS3 function is expected to be developed into immunomodulatory drugs.

[0003] MicroRNA (miRNA) is a non-coding RNA of about 22 nt in length that is widely present in eukaryotes. It targets the 3'UTR of mRNA by binding to the RNA silencing complex, degrading mRNA or inhibiting mRNA translation, and is widely involved in biological processes such as development and immunity. miRNA mimics can precisely regulate the expression of target genes with high specificity. At the same time, miRNA mimics are easy to synthesize and are widely used in disease treatment, drug screening and other fields (BR Cullen. 2013. MicroRNAs as mediators of viral evasion of the immune system. Nat Immunol, 14(3), 205-10.).

[0004] So far, no miRNA mimics have been used to regulate the expression of SOCS3 gene and its adaptive immune response in large yellow croaker. Summary of the invention

[0005] The object of the present invention is to provide a miRNA mimic (miR-181b) for targeted inhibition of SOCS3 gene expression in large yellow croaker and its use in a reagent for controlling SOCS3 gene expression in large yellow croaker and / or in the preparation of an immunomodulatory drug for large yellow croaker.

[0006] In order to achieve the above object, the present invention adopts the following technical scheme: The present invention provides a miRNA mimic, wherein the miRNA is miR-181b, and its nucleotide sequence is shown in SEQ ID NO.2; the miR-181b mimic is synthesized by a sense chain and an antisense chain, the nucleotide sequence of the sense chain is shown in SEQ ID NO.3, and the nucleotide sequence of the antisense chain is shown in SEQ ID NO.4.

[0007] The present invention also provides the use of the miRNA mimics in preparing a reagent for regulating the expression of the large yellow croaker SOCS3 gene.

[0008] Furthermore, in the above application, the miRNA mimics inhibit the expression of SOCS3 gene.

[0009] The present invention also provides the use of the miRNA mimics in the preparation of immunomodulatory drugs for large yellow croaker.

[0010] Furthermore, the large yellow croaker immunomodulatory drug promotes the proliferation of large yellow croaker T cells and B cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1The graph shows the result of miR-181b mimics inhibiting the luciferase activity of cells transfected with pmiRGLO-SOCS3-3'UTR; Figure A is a schematic diagram of the miR-181b mimic sequence and its bound large yellow croaker SOCS3 3'UTR sequence and mutant sequence; Figure B shows the effect of NC mimics and miR-181b mimics on the luciferase activity of cells transfected with pmiRGLO-SOCS3-3'UTR or its mutant plasmid.

[0012] Figure 2 The results of SOCS3 mRNA level in primary head kidney lymphocytes of large yellow croaker after transfection with miR-181b mimics; Figure A shows the effect of NC mimics and miR-181b mimics on endogenous miR-181b levels; Figure B shows the effect of NC mimics and miR-181b mimics on endogenous SOCS3 transcription levels.

[0013] Figure 3 The results of the proliferation ratio of T cells and B cells in primary lymphocytes of large yellow croaker after transfection with miR-181b mimics are shown in Figure A. + Flow cytometry of T cell ratio; Figure B shows the proliferation of Zap70 + T cell statistics; Figure C shows the proliferation of IgM + B cell ratio flow cytometry; Figure D is the proliferation of IgM + B cell statistics results. DETAILED DESCRIPTION

[0014] In order to make the technical solutions and advantages of the present invention more clear, the content of the present invention is described in detail through the following examples, but they should not be regarded as limiting the scope of the present invention.

[0015] The methods used in the implementation of the following cases are conventional methods unless otherwise specified, and the materials used are commercially available unless otherwise specified.

[0016] Example 1 Prediction and verification of miR-181b targeting SOCS3 of large yellow croaker The target mRNA of the miRNA mimic of the present invention is shown in SEQ ID NO. 1 in the sequence table. The target sequence of the miRNA mimic is located at 791-815 bases after the termination codon (TAG) of the mRNA sequence (TCACCATTGCTTCCAAATGAATGTA).

[0017] The nucleotide sequence of miR-181b described in the present invention is shown as 5'-AACAUUCAUUGCUGUCGCUGGGUU-3' (SEQ ID NO. 2).

[0018] The miR-181b mimics of the present invention have a sense strand sequence of 5'-GACUUGGUCAAAGCUCCUCAGC-3' (SEQ ID NO. 3) and an antisense strand sequence of 5'-GCUGAGGAGCUUUGACCAAGUC-3' (SEQ ID NO. 4).

[0019] The software miRanda and PITA were used to predict the binding site of miR-181b in the 3'UTR region of the mRNA sequence of the SOCS3 gene of large yellow croaker (GenBank accession number: XM_010738599.3). The sequence of the binding site was: 5'-UCACCAUUGCUUCCAAAUGAAUGUA-3'. The large yellow croaker SOCS3 3'UTR sequence and the corresponding mutant sequence (5'-UCACCAUUGCUUCCAAACUGGCACA-3') were inserted into the SacI restriction site and Xbal restriction site of the pmiRGLO vector (Promega) by homologous recombination, and were named pmiRGLO-SOCS3-WT and pmiRGLO-SOCS3-MUT. HEK-293T cells were cultured at 2×10 5 / well was inoculated into a 24-well plate, and 0.5 mL of prepared DMEM complete medium (containing 10% fetal bovine serum from Gibco, USA and 1% penicillin / streptomycin from Nearshore Protein) was added, and cultured in an incubator at 37°C and 5% carbon dioxide. When the cells grew to 80%, the synthetic miRNA mimics and vectors pmiRGLO-SOCS3-WT or pmiRGLO-SOCS3-MUT were transfected into HEK-293T cells using the transfection reagent Lipofectamine 2000 (Invitrogen), and the final concentration of miRNA mimics was 100 nM / well. After 36 hours, the luciferase activity of the cell samples was detected using the dual luciferase reporter system detection kit (E1910; Promega), and the Renilla luciferase activity was used as an internal reference. The results are shown in Figure 1 As shown, transfection of miR-181b mimics inhibited the luciferase activity of pmiRGLO-SOCS3-WT cells, but had no effect on the luciferase activity of pmiRGLO-SOCS3-MUT cells, indicating that miR-181b mimics may inhibit the expression of upstream genes by binding to the 3'UTR of SOCS3 in large yellow croaker.

[0020] Example 2 miR-181b mimics inhibit SOCS3 mRNA levels in primary head kidney lymphocytes of large yellow croaker The primary head kidney lymphocytes of large yellow croaker were separated by Percoll separation method and 2×10 6 / well was inoculated into a 6-well plate, 2 mL of prepared DMEM complete medium (containing 10% fetal bovine serum and 1% penicillin / streptomycin) was added, and the plate was cultured in an incubator at 28°C and 5% carbon dioxide. After 4 h, the miRNA mimics were transfected into the primary head kidney lymphocytes of large yellow croaker using Lipofectamine 2000, and the final concentration of the miRNA mimics was 100 nM / well. After 24 h, the total RNA of the cells was extracted using an RNA extraction kit (Novozymes), and then the RNA was reverse transcribed into cDNA using an RNA reverse transcription kit (Promega). The cDNA was used as a template for fluorescence quantitative PCR reaction. The reaction system was as follows: 1 μL of cDNA template, 0.5 μL of 10 μM upstream and downstream primers, 10 μL of SYBR Green Mix (Novozymes), and 8 μL of sterile water in a 20 μL system; reaction procedure: 95°C pre-denaturation for 30 s; 95°C denaturation for 5 s, 60°C annealing and extension for 30 s, 40 cycles, and finally 60-95°C melting curve stage. The mRNA levels of endogenous miR-181b and SOCS3 were detected, U6 was used as the internal reference of miRNA, and β-actin was used as the internal reference of mRNA. The primer sequences used for the fluorescence quantitative PCR reaction are shown in Table 1. The downstream primers of miR-181b and U6 are both miRNA-R. The results are shown in Figure 2 As shown, after transfection of miR-181b mimics, the level of miR-181b in primary head kidney lymphocytes of large yellow croaker was significantly upregulated, while the level of SOCS3 mRNA in large yellow croaker was significantly downregulated, with a decrease of about 30%.

[0021] Table 1 Primers used in fluorescence quantitative PCR experiments

[0022] Example 3 Application of miR-181b mimics to promote proliferation of T cells and B cells in large yellow croaker The experiment was divided into TRX group, IL-4 / 13A group and IL-4 / 13B group. The primary head kidney lymphocytes of large yellow croaker were separated by percoll separation method, labeled with CFSE (Sigma), cultured at 28℃ for 4 h, and transfected with miRNA mimics into the primary head kidney lymphocytes of large yellow croaker using Lipofectamine 2000. The final concentration of miRNA mimics was 100 nM / well. After 6 h, the control protein thioredoxin (TRX) with a final concentration of 100 ng / mL, 100 ng / mL of large yellow croaker IL-4 / 13A recombinant protein and 100 ng / mL of large yellow croaker IL-4 / 13B recombinant protein were added for treatment. After 48 h, the primary head kidney lymphocytes of large yellow croaker were labeled with Zap70 monoclonal antibody and anti-large yellow croaker IgM monoclonal antibody for large yellow croaker T cells and B cells, respectively. Finally, the proportion of proliferating cells in T cells and B cells was analyzed by flow cytometry. The results are shown in Figure 3 As shown, whether it was the TRX recombinant protein treatment group or the large yellow croaker IL-4 / 13A treatment group or IL-4 / 13B treatment group, Zap70 was significantly upregulated after transfection with miR-181b mimics. + T cells and IgM + The proportion of proliferating cells in B cells was significantly higher than that in the random miRNA (NC mimics) transfection group, indicating that miR-181b mimics targets SOCS3 in large yellow croaker, downregulates the mRNA level of SOCS3, weakens the function of SOCS3 in large yellow croaker, thereby enhancing the promoting effect of IL-4 / 13A and IL-4 / 13B on the proliferation of T and B cells in large yellow croaker, and strengthens the adaptive immune response of large yellow croaker.

[0023] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention should fall within the scope of the present invention.

Claims

1. A miRNA mimic, characterized in that: The miRNA is miR-181b, and its nucleotide sequence is shown in SEQ ID NO.2; the mimic of miR-181b is synthesized by a sense chain and an antisense chain, the nucleotide sequence of the sense chain is shown in SEQ ID NO.3, and the nucleotide sequence of the antisense chain is shown in SEQ ID NO.

4.

2. Use of the miRNA mimics as claimed in claim 1 in preparing a reagent for regulating the expression of the SOCS3 gene of large yellow croaker.

3. The use according to claim 2, characterized in that: The miRNA mimics inhibit the expression of SOCS3 gene.

4. Use of the mimetic as claimed in claim 1 in the preparation of immunomodulatory drugs for large yellow croaker.

5. The use according to claim 4, characterized in that :The large yellow croaker immunomodulatory drug promotes the proliferation of large yellow croaker T cells and B cells.

Images