An alfalfa gene MtZW1 and its application in plant salt tolerance

By discovering and inhibiting the negative regulatory gene MtZW1, the adaptability problem of alfalfa in saline-alkali land was solved, and the salt tolerance of alfalfa was significantly improved, providing a new method for gene editing technology to improve the salt tolerance of crops.

CN119842738BActive Publication Date: 2025-08-12SHANDONG UNIV +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510133379.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-02-06
Publication Date
2025-08-12
Estimated Expiration
2045-02-06

AI Technical Summary

Technical Problem

The adaptability of alfalfa in saline-alkali land has not been effectively solved, and traditional breeding methods are difficult to significantly improve their salt tolerance, and existing gene research mainly focuses on positive regulatory genes and is not suitable for molecular breeding of gene editing technology.

Method used

The negative regulation of MtZW1 of the Tnt1 retrotransposon insertion mutation method was discovered and verified. The expression of MtZW1 was inhibited and the salt tolerance of plants was improved through gene editing techniques such as Tnt1 retrotransposon insertion mutation.

Benefits of technology

The loss of function of gene MtZW1 significantly improved the salt tolerance of terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terrestrial terre

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119842738B_ABST
    Figure CN119842738B_ABST
Patent Text Reader

Abstract

The present invention belongs to the technical fields of genetic engineering and salt-tolerant plant breeding, and specifically relates to an alfalfa gene MtZW1 and its application in plant salt tolerance. Specifically, the present invention discovered for the first time a gene MtZW1 that negatively regulates the salt tolerance of Medicago truncatula. Studies have shown that the loss of function of the gene MtZW1 can significantly affect the salt tolerance phenotype of Medicago truncatula. Compared with wild-type plants, the survival rate of the gene mutant plants after treatment with 100mM NaCl was significantly improved. The present invention not only clarifies the mechanism of action of the gene MtZW1 in plant salt tolerance, but also provides new tools and methods for improving crop salt tolerance using genetic engineering methods, which has important scientific significance and practical application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering and salt-tolerant plant breeding, and particularly relates to an alfalfa gene MtZW1 and application thereof in plant salt tolerance. Background Art

[0002] The information disclosed in the background of the invention is only intended to enhance understanding of the overall background of the invention and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] In the livestock industry, alfalfa, known as the "King of Forages," is highly regarded worldwide for its exceptional yield, nutritional value, and palatability. Not only is it the fourth-largest cash crop in the United States, it also plays an indispensable role in China's livestock industry, providing a crucial source of high-quality feed. However, alfalfa's yield and quality are constrained by various environmental factors, particularly the presence of saline-alkali soils, which not only limits its cultivation range but also directly impacts its yield and quality.

[0004] Alfalfa has significant economic and ecological value, but its adaptability to saline-alkali soils has remained a challenge. While traditional breeding methods have improved salt tolerance to some extent, significant genetic improvement has been difficult due to the narrow genetic background. Furthermore, as a cross-pollinated, heterozygous tetraploid plant, the complexity of its genetic background complicates direct genetic improvement.

[0005] With the development of molecular genetics, improving alfalfa's salt tolerance through genetic modification has become an effective approach. Therefore, using Medicago truncatula, a model organism for legume research, with its characteristics such as self-pollination, small chromosome set, small genome, and high genetic transformation efficiency, basic research is being conducted to discover genes with salt tolerance. The research results of these genes can then be transferred to alfalfa to improve its salt tolerance, thereby expanding its planting range and increasing yield and quality. However, most of the genes discovered so far are genes that positively regulate salt stress, and most studies have focused on heterologous expression to enhance salt tolerance in Arabidopsis, which is not suitable for molecular breeding using gene editing technology. Summary of the Invention

[0006] In response to the above-mentioned prior art, the present invention aims to provide an alfalfa gene, MtZW1, and its application in plant salt tolerance. Specifically, the present invention discovered for the first time a gene, MtZW1, that negatively regulates salt tolerance in Medicago truncatula. Studies have shown that loss of function in MtZW1 significantly affects the salt tolerance phenotype of Medicago truncatula. Compared to wild-type plants, mutant plants of this gene exhibit significantly improved survival rates after treatment with 100 mM NaCl. Based on these research findings, the present invention was completed.

[0007] In order to achieve the above technical objectives, the technical solutions provided by the present invention are as follows:

[0008] In a first aspect of the present invention, a alfalfa gene MtZW1 is provided, wherein the alfalfa gene MtZW1 has:

[0009] (a1) the nucleotide sequence shown in SEQ ID NO. 1;

[0010] (a2) a nucleotide sequence that encodes a protein having the same amino acid sequence as the nucleotide sequence shown in (a1), but differs in sequence due to the degeneracy of the genetic code;

[0011] (a3) a nucleotide sequence that has ≥90% identity with the nucleotide sequence shown in (a1) or (a2) and encodes the same functional protein;

[0012] (a4) A nucleotide sequence complementary to any one of (a1) to (a3).

[0013] Furthermore, the alfalfa gene MtZW1 has the nucleotide sequences shown in SEQ ID NO.2 and SEQ ID NO.3.

[0014] The second aspect of the present invention provides a recombinant expression vector comprising the alfalfa gene MtZW1.

[0015] The recombinant expression vector is obtained by effectively connecting the alfalfa gene MtZW1 to an expression vector. The expression vector can be any one or more of a viral vector, a plasmid, a phagemid, a cosmid, or an artificial chromosome.

[0016] The third aspect of the present invention provides a transgenic cell line, a host bacteria or a genetically engineered plant containing the alfalfa gene MtZW1 or the recombinant expression vector.

[0017] The transgenic cell line may be isolated, in vitro, in culture, or preferably, part of a plant.

[0018] The host bacteria may be eukaryotic fungi (such as fungi, specifically yeast, etc.) or prokaryotic fungi (such as bacteria, specifically Escherichia coli, Bacillus, Agrobacterium, etc.).

[0019] In the present invention, the genetically engineered plant can be a crop, further a leguminous crop, such as alfalfa (Medicago sativa).

[0020] A fourth aspect of the present invention provides the use of the alfalfa gene MtZW1, recombinant expression vector, transgenic cell line, host bacteria or genetically engineered plant in any one or more of the following:

[0021] (b1) regulating plant salt tolerance;

[0022] (b2) Screening and / or breeding of salt-tolerant plants.

[0023] A fifth aspect of the present invention provides a method for improving salt tolerance of plants, the method comprising: inhibiting the expression of the alfalfa gene MtZW1 in the plant.

[0024] The expression of the gene MtZW1 is inhibited in such a way that the expression level of the gene MtZW1 is reduced compared with the wild type, and the lowest expression level can be 0, that is, the gene is knocked out.

[0025] This can be accomplished using known methods, such as T-DNA insertion mutagenesis, transposon insertion mutagenesis, retrotransposon insertion mutagenesis, CRISPR / Cas9 gene editing, or virus-mediated VIGS. In one embodiment of the present invention, Tnt1 retrotransposon insertion mutagenesis is used to inhibit the expression of the gene MtZW1. The nucleotide sequences of the mutated gene MtZW1 are shown in SEQ ID NOs. 2 and 3.

[0026] The plant may be a crop, and may further be a leguminous crop, such as alfalfa, etc., which is not specifically limited here.

[0027] Beneficial technical effects of one or more of the above technical solutions:

[0028] The above technical solution revealed the function of the Medicago truncatula gene MtZW1, confirming it as a key gene for responding to salt stress. A mutant of the MtZW1 gene, inserted by the Tnt1 retrotransposon, was obtained from a mutant library. The mutation was found to improve the plant's salt tolerance, providing a new strategy for breeding new legume varieties with enhanced stress tolerance.

[0029] This technical solution utilized molecular biology and genetic methods to conduct an in-depth analysis of the expression pattern and function of the MtZW1 gene in Medicago truncatula. We observed that loss of MtZW1 function significantly affected the salt tolerance phenotype of Medicago truncatula. The experimental results showed that, compared with wild-type plants, the survival rate of plants expressing this gene mutant after treatment with 100 mM NaCl was significantly improved.

[0030] Through repeated biological experiments and statistical analysis, the above technical solution confirmed that the mtzw1-1 and mtzw1-2 Medicago truncatula mutants had higher survival rates under salt treatment conditions compared to the wild-type Medicago truncatula R108 plants. This result suggests that the MtZW1 gene has significant application potential in enhancing plant salt tolerance. It can be applied not only to improve salt tolerance in alfalfa but also to other legume crops, providing a theoretical and practical basis for stress management in agricultural production.

[0031] In summary, the above technical solution not only clarifies the mechanism of action of the gene MtZW1 in plant salt tolerance, but also provides new tools and methods for improving crop salt tolerance using genetic engineering means, which has important scientific significance and application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] The accompanying drawings, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0033] Figure 1 : qRT-PCR analysis of the relative expression of the gene MtZW1 at different salt treatment times. Three biological replicates were performed; each batch contained 25 seedlings.

[0034] Figure 2 : RT-PCR was used to detect the expression level of the gene MtZW1 in the roots of mutant plants. The results showed that both mtzw1-1 and mtzw1-2 mutants were gene knockout mutants.

[0035] Figure 3 One month of 100 mM NaCl treatment revealed improved salt tolerance in mtzw1-1 and mtzw1-2 Medicago truncatula mutants compared to wild-type Medicago truncatula R108 plants. A shows the growth of wild-type Medicago truncatula R108 plants and mtzw1-1 and mtzw1-2 Medicago truncatula mutants at 0, 1, 2, 3, and 4 weeks after 100 mM NaCl treatment. B shows the results of t-test statistical analysis. DETAILED DESCRIPTION

[0036] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present invention belongs.

[0037] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is intended to include the plural form. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, they indicate the presence of features, steps, operations, devices, components and / or combinations thereof.

[0038] The present invention will now be further described with reference to specific examples. The following examples are intended only to illustrate the present invention and are not intended to limit its contents. Experimental conditions not specified in the examples are generally based on conventional conditions or those recommended by the reagent company. Reagents and consumables used in the following examples are commercially available unless otherwise specified.

[0039] As mentioned above, most of the genes discovered so far are genes that positively regulate salt stress, and most of the studies are about heterologous expression to enhance the salt tolerance of Arabidopsis, which are not suitable for molecular breeding using gene editing technology.

[0040] In the early stage of the present invention, wild-type R108 plants of Medicago truncatula were divided into a control group and an experimental group. The experimental group was treated with 100mM NaCl, and its transcriptome data was analyzed. A gene whose relative expression was downregulated after treatment with 100mM NaCl was screened. After analysis, it was found that it had a salt-tolerant phenotype and that the WRKYs transcription factor involved in salt stress was downregulated in the MtZW1 mutant. Therefore, this gene was named MtZW1 (its nucleotide sequence is shown in SEQ ID NO.1). Two Tnt1 retrotransposon mutants of this gene, mtzw1-1 and mtzw1-2, were screened and subjected to salt tolerance experiments. It was found that the gene mutation could improve the survival rate of the plant after treatment with 100mM NaCl. That is, the MtZW1 found by the present invention is a gene that negatively regulates salt tolerance in Medicago truncatula. Therefore, the alfalfa homologous gene MsZW1 was knocked out by gene editing to obtain high-quality salt-tolerant alfalfa.

[0041] The present invention is further explained by the following examples, but is not intended to limit the present invention. It should be understood that these examples are only intended to illustrate the present invention and are not intended to limit the scope of the present invention. The test methods in the following examples are generally carried out under conventional conditions.

[0042] Example 1: Expression analysis of MtZW1

[0043] The material was cultured hydroponically: the hard outer skin of wild-type Medicago truncatula R108 seeds was moderately polished with sandpaper to break the dormancy of the seeds. The seeds were cultured on moist filter paper at 4°C for about a week. The germinated seeds were then transferred to 1 / 2 Hoagland nutrient solution and placed in an incubator for growth. The incubator environmental conditions were: long day (16h / 8h), temperature 23°C, 65% humidity, and light intensity 150mmol m -2 s -1 At one month old, the seedlings were treated with 100 mM NaCl. RNA was extracted from the seedling leaves using the Trizol method after different treatment times.

[0044] The primer sequences are as follows:

[0045] MtZW1-qF:GGTGGCCACATGAGAAAGCA;

[0046] MtZW1-qR:ACGGCGTCAAGTTCAAGTCC;

[0047] MtUBQ-qF:CTGACAGCCCACTGAATTGTGA;

[0048] MtUBQ-qR:TTTTGGCATTGCTGCAAGC.

[0049] Figure 1 Shown: qRT-PCR analysis of the response of MtZW1 to salt stress in roots of wild-type Medicago truncatula R108 plants. The abscissas (0 h, 1 h, 3 h, 6 h, 9 h, 12 h, and 24 h) represent the different times of 100 mM NaCl treatment, while the ordinates represent the relative expression of the MtZW1 gene. MtZW1 expression remained low from 0 to 24 h after 100 mM NaCl treatment. Three biological replicates were used; * indicates P < 0.05. Each batch consisted of 25 seedlings.

[0050] Example 2: Identification of mtzw1-1 and mtzw1-2 Medicago truncatula mutant plants and RT-PCR identification of the gene MtZW1 in the mutants

[0051] Genomic DNA was extracted from mtzw1-1 and mtzw1-2 Medicago truncatula mutants and amplified using the Tnt1 forward insertion F primer (tccttgttggattggtagccaactttgttg) and the gene reverse primer (CATAACTGCAACCGCGACTACC). RNA-reversed cDNA was extracted from these mutants and wild-type plants and analyzed by RT-PCR using the gene forward primer (CCTAGACATGAAGAGAGGTAGAG) and the gene reverse primer (CATAACTGCAACCGCGACTACC). MtActin11-F (ACGAGCGTTTCAGATG) and MtActin11-R (ACCTCCGATCCAGACA) were used as internal controls.

[0052] See the results Figure 2 .

[0053] Figure 2 Shown: RT-PCR analysis of MtZW1 expression in the roots of two Medicago truncatula mutant lines, designated mtzw1-1 and mtzw1-2, based on the location of the Tnt1 insertion site. The upper panel shows MtZW1 expression in the roots of wild-type Medicago truncatula R108 plants and the mtzw1-1 and mtzw1-2 mutants. The lower panel shows the expression of the housekeeping gene MtActin11 in the roots of wild-type Medicago truncatula R108 plants and the mtzw1-1 and mtzw1-2 mutants. This indicates that both mtzw1-1 and mtzw1-2 are knockout mutants.

[0054] Example 3: Analysis of salt tolerance of mtzw1-1 and mtzw1-2 Medicago truncatula mutant plants

[0055] Wild-type R108 seeds of Medicago truncatula and mutants mtzw1-1 and mtzw1-2 were sandpapered to break seed dormancy and placed in a Petri dish filled with moist filter paper for germination for one week. They were then planted in seedling holes and grown in an incubator. The incubator was maintained under the following environmental conditions: long daylight (16 h / 8 h), temperature (23°C), 65% humidity, and a light intensity of 150 mmol m -2 s -1 After two weeks of growth, the plants were moved into 10 cm × 10 cm square pots and placed in a greenhouse for growth. The normal growth conditions in the greenhouse were: long daylight (16 h / 8 h), temperature 22°C to 25°C, 60% to 70% humidity, and light intensity 150 mmol m -2 s -1After two weeks of seedling acclimatization, 25 wild-type R108 plants of Medicago truncatula and 25 plants of the mtzw1-1 and mtzw1-2 mutants of Medicago truncatula with consistent growth status were selected and treated with 100 mM NaCl for 4 weeks. The growth status of the plants was photographed and recorded every week. The biological replicates were performed three times, and the survival rate was calculated.

[0056] See the results Figure 3 .

[0057] Figure 3 Figure 1: One-month salt treatment reveals improved salt tolerance in mtzw1-1 and mtzw1-2 Medicago truncatula mutant plants compared to wild-type Medicago truncatula R108 control plants. Figure (A) shows the growth of wild-type Medicago truncatula R108 plants and mtzw1-1 and mtzw1-2 Medicago truncatula mutant plants at 0, 1, 2, 3, and 4 weeks after treatment with 100 mM NaCl. After 4 weeks of 100 mM NaCl, wild-type plants exhibited yellowing leaves, wilting stems, and even plant death compared to mutant plants. Figure (B) shows t-test statistical analysis showing significantly increased survival of mtzw1-1 and mtzw1-2 Medicago truncatula mutant plants compared to wild-type Medicago truncatula R108 control plants after 100 mM NaCl treatment. Three biological replicates; * indicates P < 0.05. Each batch consisted of 25 seedlings.

[0058] The nucleotide sequence involved in the present invention is:

[0059] ZW1

[0060] >ATGAAGAGAGGTAGAGAAGATAAGAGTGAGTTAAATTGTTTGATGCT ACTATCCAAAGTTGGTGAAACAAAAGAGCCTAATACATTGAAAGAATGTGGTTTTAAGTGCAAAACATGCAACAAAGAATTCTCTTCTTTTCAAGCTTTAGGTGGCCATAGAGCAAGTCACAAGAGACCAAAACTCATGTACAAGTTACCAAACATGAAACCAAAGATGCATCCATGCC CTATTTGTGGACTTGAGTTTTCCATTGGACAAGCTCTTGGTGGCCACATGAGAAAGCATAATAGTAGTTTTTCCATCTTCAAAAAATCAAAAAAAGACCATTGTGAAAGGTTGAATTTTTGCTTGGACTTGAACTTGACGCCGTTAGAGAATGGTCTTGTTTGGACTTGTACTTGA(SEQ ID NO.1)

[0061] mtzw1-1

[0062] >ATGAAGAGAGGTAGAGAAGATAAGAGTGAGTTAAATTGTTTGATGCT ACTATCCAAAGTTGGTGAAACAAAAGAGCCTAATACATTGAAAGAATGTGGTTTTAAGTGCAAAACATGCAACAAAGAATTCTCTTCTTTTCAAGCTTTAGGTGGCCATAGAGCAAGTCACAAGAGACCAAAACTCATGTACAAGTTACCAAACATGAAACCAAAGATGCATCCATGCCCTATTTGTGGACTTGAGTTTTCCATTGGACAAGCTCTTGGTGGCCACATGAGAAAGCATAATAGTAGTTTTTCCATCTTCAAAAAATCAAAAAAAGACCATTGTGAAAGGTTGAATTTTTGCTTGGACTTGAACTT(SEQ IDNO.2)

[0063] mtzw1-2

[0064] >ATGAAGAGAGGTAGAGAAGATAAGAGTGAGTTAAATTGTTTGATGCT ACTATCCAAAGTTGGTGAAACAAAAGAGCCTAATACATTGAAAGAATGTGGTTTTAAGTGCAAAACATGCAACAAAGAATTCTCTTCTTTTCAAGCTTTAGGTGGCCATAGAGCAAGTCACAAGAGACCAAAACTCATGTACAAGTTACCAAACATGAAACCAAAGATGCATCCATGCCCTATTTGTGGACTTGAGTTTTCCATTGGACAAGCTCTTGGTGGCCACATGAGAAAGCATAATAGTAGTTTTTCCATCTTCAAAAAATCAAAAAAAGACCATTGTGAAAGGTTGAATTTTTGCTTGGACTTGAACTTGACGCCGTTAGAGAATGGTCTTGTTTGGACT(SEQ ID NO.3)

[0065] Matters not covered by this invention are well-known techniques.

[0066] The above embodiments are intended only to illustrate the technical concepts and features of the present invention. Their purpose is to enable those skilled in the art to understand the contents of the present invention and implement them accordingly. They are not intended to limit the scope of protection of the present invention. Any equivalent changes or modifications made in accordance with the spirit of the present invention are intended to be covered by the scope of protection of the present invention.

Claims

1. A method for improving plant salt tolerance, characterized in that: The method comprises: inhibiting the alfalfa gene in the plant MtZW1 The expression of the alfalfa gene MtZW1 The nucleotide sequence is shown in SEQ ID NO.1; the plant is Medicago truncatula.

2. The method according to claim 1, wherein Suppressing alfalfa genes MtZW1 Methods for expression include T-DNA insertion mutagenesis, transposon insertion mutagenesis, retrotransposon insertion mutagenesis, CRISPR / Cas9 gene editing, or virus-mediated VIGS.

3. The method according to claim 2, wherein The Tnt1 retrotransposon was used to insert a mutagenesis strategy to suppress the alfalfa gene. MtZW1 expression.

4. Suppressing alfalfa genes MtZW1 Application of expression of alfalfa gene in promoting salt tolerance in plants MtZW1 The nucleotide sequence is shown in SEQ ID NO.1; the plant is Medicago truncatula.

5. The use according to claim 4, characterized in that Suppressing alfalfa genes MtZW1 By knocking out the alfalfa gene MtZW1 accomplish.

Citation Information

Patent Citations

  • Application of medicago truncatula gene STMP in improving salt tolerance of medicago truncatula

    CN118834905A

  • Transgenic plants

    WO2015035532A1