Prokaryotic expression plasmid of recombinant cat macrophage colony stimulating factor as well as construction method and application of prokaryotic expression plasmid

Abstract

The invention discloses a prokaryotic expression plasmid of a recombinant cat macrophage colony stimulating factor as well as a construction method and application of the prokaryotic expression plasmid, and the construction method of the prokaryotic expression plasmid comprises the following steps: cloning a synthesized cat macrophage colony stimulating factor gene into a PUC57 plasmid to obtain a PUC57-FM-CSF plasmid; and then taking the synthesized PUC57-FM-CSF plasmid as a template, carrying out PCR (Polymerase Chain Reaction) amplification by adopting a homologous recombinant primer designed at the position of a signal peptide sequence removed, purifying a target gene obtained by amplification, subcloning the purified target gene into a corresponding site of a prokaryotic expression vector, and transforming DH5alpha competent cells to obtain the gene. According to the invention, the plasmid containing the cat M-CSF gene is successfully constructed for the first time and is efficiently expressed in a prokaryotic expression system, and the expressed recombinant protein shows higher biological activity after being purified, so that a stable in-vitro research platform is provided for further researching the structure, biological function and the like of the cat M-CSF; the important research significance and clinical application value are realized.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, in particular to a prokaryotic expression plasmid of a recombinant cat macrophage colony stimulating factor and a construction method and application thereof. Background Art

[0002] Macrophage colony-stimulating factor (M-CSF), also known as CSF-1, is a four-α-helical bundle cytokine and a major regulator of macrophage survival, proliferation, and differentiation. M-CSF receptor (M-CSFR / CSF1R / cfms) is a transmembrane protein encoded by the proto-oncogene c-fms, which transduces its pleiotropic effects and mediates its endocytosis. After M-CSF binds to CSF1R, CSF1R dimerizes, and the kinase domain in the intracellular region is activated, which in turn triggers a series of signal transduction effects, thereby exerting its biological effects.

[0003] At present, the research on M-CSF shows that M-CSF has rich application value. M-CSF can induce rat bone marrow mesenchymal stem cells to differentiate into hepatocytes by activating the PI3K / AKT pathway; M-CSF can also induce human bone marrow mesenchymal stem cells to differentiate into hepatocytes, and can be used as a cell source for liver disease treatment. The expression level of M-CSF in patients with chronic hepatitis B virus (HBV) infection gradually increases with the progression of liver fibrosis, and has good clinical value in the non-invasive diagnosis of the degree of liver fibrosis in patients with chronic HBV infection. M-CSF high expression plasmid introduces exogenous genes into BMSCs, which is a powerful gene therapy tool for bone regeneration.

[0004] However, there are no reports on the recombinant expression of feline macrophage colony-stimulating factor in vitro. Summary of the invention

[0005] In view of the deficiencies of the prior art, the present invention provides a prokaryotic expression system of a recombinant cat macrophage colony stimulating factor, a construction method thereof, and an application thereof. The present invention aims to express cat macrophage colony stimulating factor, determine its biological activity, and provide a homologous stimulator for the polarization of cat bone marrow-derived macrophages. Subsequently, the differential markers of cat macrophages M0, M1, and M2 can be further explored, providing an in vitro system platform for in-depth research on cat macrophages; providing a platform for further exploring the pathogenic mechanism of viruses that commonly infect cat macrophages; providing a possible targeted therapy marker for our clinical treatment of diseases that directly infect macrophages, and becoming a powerful tool for our exploration and research of the cat immune system.

[0006] The objective of the present invention is achieved through the following technical solutions:

[0007] In a first aspect, the present invention provides a method for constructing a prokaryotic expression plasmid of a recombinant feline macrophage colony stimulating factor, characterized in that the method comprises the following steps:

[0008] A. Synthesizing PUC57-FM-CSF plasmid: synthesizing the feline macrophage colony stimulating factor gene according to the published feline macrophage colony stimulating factor gene sequence, and then cloning the synthesized feline macrophage colony stimulating factor gene into the PUC57 plasmid to obtain the PUC57-FM-CSF plasmid;

[0009] B. Construction of FM-CSF prokaryotic expression plasmid: The signal peptide of feline macrophage colony stimulating factor was detected, and primers for homologous recombination were designed at the position where the signal peptide sequence was removed; then, the synthesized PUC57-FM-CSF plasmid was used as a template and the designed primers were used for PCR amplification. The amplified target gene was purified and subcloned into the corresponding site of the prokaryotic expression vector. The obtained ligation product was transformed into Escherichia coli DH5α competent cells to obtain the correctly identified FM-CSF prokaryotic expression plasmid.

[0010] As a preferred embodiment, in step B, the sequences of the primer pair are shown as SEQ ID NO.1 and SEQ ID NO.2.

[0011] As a preferred embodiment, in step B, the nucleotide sequence of the target gene is shown as SEQ ID NO.3.

[0012] As a preferred embodiment, in step B, the prokaryotic expression vector is pET-32a(+).

[0013] As a preferred embodiment, in step B, the reaction system for PCR amplification is: 2 μL of PUC57-FM-CSF plasmid DNA, 1 μL each of 25 pmol / μL FM-CSF F1 and FM-CSF R1 primers, 25 μL of Premix Taq (LA Taq Version 2.0 plus dye), and H2O is added to make up the total volume to 50 μL.

[0014] As a preferred embodiment, in step B, the reaction conditions for PCR amplification are: pre-denaturation at 98°C for 4 min; denaturation at 98°C for 10 s, annealing at 55°C for 30 s, extension at 72°C for 90 s, for a total of 30 cycles; extension at 72°C for 10 min.

[0015] In a second aspect, the present invention provides a prokaryotic expression plasmid of recombinant feline macrophage colony stimulating factor constructed according to the aforementioned method.

[0016] In a third aspect, the present invention provides a recombinant protein, which is obtained by the following steps: transfecting the prokaryotic expression plasmid of the recombinant feline macrophage colony stimulating factor according to claim 7 into the competent Escherichia coli Rosetta gamiB (DE3), picking up the transformed single colony and inoculating it into LB medium containing Amp for shaking culture, adding 0.1-0.5mM IPTG when the OD600 of the bacterial solution is 0.6-0.8, continuing the induction culture for 5-7h, collecting the bacteria by centrifugation, resuspending and ice bathing for 25-35min, ultrasonically disrupting the bacteria and then centrifuging, collecting the precipitate, denaturing and purifying to obtain the recombinant protein.

[0017] As a preferred embodiment, the specific steps of the purification after denaturation are: the precipitate is first washed with an inclusion body washing solution, then treated with an inclusion body denaturing solution and centrifuged to obtain a supernatant, which is chelated with an affinity chromatography column, and then eluted with an elution buffer containing 20 to 500 mmol / L imidazole, and the elution peak is collected to obtain the purified recombinant protein.

[0018] In a fourth aspect, the present invention provides a method for using the aforementioned recombinant protein as a stimulator in promoting the differentiation of feline bone marrow-derived macrophages.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] The present invention successfully constructed a plasmid containing the feline M-CSF gene for the first time and achieved efficient expression in a prokaryotic expression system. The expressed recombinant protein showed high biological activity after purification, which provided a stable in vitro research platform for further studying the structure and biological function of feline M-CSF, and for our subsequent exploration of the pathogenic mechanism of feline infectious peritonitis virus, the body's immune response and the variation characteristics of FIPV. It is a reliable way for us to study the polarization and function of cat bone marrow-derived macrophages. It can become an in vitro platform for us to explore the microenvironment of some neoplastic diseases in cats, and has great research significance and clinical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Other features, objects and advantages of the present invention will become more apparent from the detailed description of non-limiting embodiments made with reference to the following drawings:

[0022] Figure 1 The results of predicting the signal peptide of FM-CSF gene using SignalP-5.0 online software;

[0023] Figure 2 The PCR amplification results of prokaryotic expression of FM-CSF gene; where M: protein relative molecular weight standard; 1: PCR amplification product;

[0024] Figure 3The results of enzyme digestion identification of the recombinant plasmid pET-32a-FM-CSF; where M: protein relative molecular weight standard; 1: pET-32a(+) vector; 2: pET-32a-FM-CSF enzyme digestion product;

[0025] Figure 4 The expression results of the recombinant plasmid pET-32a-FM-CSF in Escherichia coli BL21 (DE3); wherein, M: protein relative molecular weight standard; 1: protein of pET-32a(+) without induction; 2: protein of pET-32a(+) after induction; 3: protein of pET-32a-FM-CSF without induction; 4: protein of pET-32a-FM-CSF strain 1 after induction; 5: protein of pET-32a-FM-CSF strain 2 after induction;

[0026] Figure 5 The expression results of the recombinant plasmid pET-32a-FM-CSF in Escherichia coli Rosetta gamiB (DE3); where M is the protein relative molecular weight standard; 1 is the protein of uninduced pET-32a (+); 2 is the protein of OD 600 1: pET-32a(+) protein after induction at 0.1 mmol / L IPTG concentration; 2: pET-32a-FM-CSF protein without induction; 3: pET-32a-FM-CSF protein at OD 600 The protein of pET-32a-FM-CSF after induction at an IPTG concentration of 0.1 mmol / L at 0.8;

[0027] Figure 6 The expression results of the recombinant plasmid pET-32a-FM-CSF in Escherichia coli Rosetta gamiB (DE3) under different induction conditions; M: protein relative molecular weight standard; 1: protein of uninduced pET-32a (+); 2: protein of uninduced pET-32a-FM-CSF; 3: protein of uninduced pET-32a-FM-CSF; 4: protein of uninduced pET-32a-FM-CSF; 5: protein of uninduced pET-32a-FM-CSF; 6: protein of uninduced pET-32a-FM-CSF; 7: protein of uninduced pET-32a-FM-CSF; 8: protein of uninduced pET-32a-FM-CSF; 9: protein of uninduced pET-32a-FM-CSF; 10: protein of uninduced pET-32a-FM-CSF; 11: protein of uninduced pET-32a-FM-CSF; 12: protein of uninduced pET-32a-FM-CSF; 13: protein of uninduced pET-32a-FM-CSF; 14: protein of uninduced pET-32a-FM-CSF; 15: protein of uninduced pET-32a-FM-CSF; 16: protein of uninduced pET-32a-FM-CSF; 17: protein of uninduced pET-32a-FM-CSF; 18: protein of uninduced pET-32a-FM-CSF; 19: protein of uninduced pET-32a-FM-CSF; 20: protein of uninduced pET-32a-FM-CSF; 21: protein of uninduced pET-32a-FM-CSF; 22: protein of uninduced pET-32a-FM-CSF; 23: protein of uninduced pET-32a-FM-CSF; 24: protein of uninduced pET 600 The protein of pET-32a-FM-CSF after induction at 0.1mmol / L IPTG concentration at OD 0.6; 4: 600 The protein of pET-32a-FM-CSF after induction at an IPTG concentration of 0.5 mmol / L when it was 0.8;

[0028] Figure 7The Western blot analysis results of the expression products induced by the recombinant pET-32a-FM-CSF bacteria; M: protein relative molecular weight standard; 1: protein of uninduced pET-32a(+); 2: protein of induced pET-32a(+); 3: protein of uninduced pET-32a-FM-CSF; 4: protein of induced pET-32a-FM-CSF;

[0029] Figure 8 This is the SDS-PAGE analysis of the recombinant protein purification; where M is the protein relative molecular weight standard; 1 is obtained by collecting and concentrating the relatively single protein in the purification step;

[0030] Fig. 9 The results of SDS-PAGE analysis of recombinant protein purification: where M: protein relative molecular weight standard; 1: protein of pET-32a-FM-CSF after induction; 2: supernatant after ultrasonic centrifugation; 3: precipitate after ultrasonic centrifugation; 4: protein of pET-32a(+) after induction; 5: flow-through; 6: 25ml 20mM imidazole elution of the first drop; 7: 25ml 20mM imidazole elution of the last drop; 8: 25ml 50mM imidazole elution of the first drop; 9: 25ml 50mM imidazole elution of the last drop; 10: 10ml 100mM imidazole elution; 11: 5ml 200mM imidazole elution; 12: 2ml 500mM imidazole elution;

[0031] Fig.10 The results are for testing the biological activity of the recombinant protein using the cell line M-NFS-60;

[0032] Fig.11 The biological activity results of different concentrations of recombinant protein (100ng / mL, 200ng / mL, 300ng / mL) on mouse bone marrow-derived macrophages;

[0033] Fig.12 The biological activity results of 200 ng / mL recombinant protein on cat bone marrow-derived macrophages;

[0034] Fig.13 This is the validation result of the phagocytic ability of cat-derived M0 macrophages;

[0035] Fig.14 The results of the effects of M-CSF from different species on reactive oxygen species in mouse macrophages;

[0036] Fig.15 The effects of M-CSF from different species on the mRNA of mouse macrophage subtypes (iNOS, Arg-1). DETAILED DESCRIPTION

[0037] The present invention is described in detail below in conjunction with specific embodiments. The following embodiments will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. It should be noted that, for those of ordinary skill in the art, several variations and improvements may be made without departing from the concept of the present invention. These all belong to the protection scope of the present invention.

[0038] Feline Infectious Peritonitis is a chronic, progressive, and fatal infectious disease caused by the feline infectious peritonitis virus, characterized by peritonitis, large amounts of ascites accumulation, and a high mortality rate. FIPV infection has the phenomenon of antibody-dependent enhancement (ADE). After the virus binds to antibodies and complement, it is easier to invade macrophages; FIPV spreads to organs and tissues through macrophage-related viremia, and then spreads in the endothelial venules of the serosa, omentum, pleura, meninges, and uveal bundles, causing abnormal immune responses, and then gradually causing systemic inflammatory responses. Therefore, studying the immune pathogenic mechanism in the pathogenesis of FIP is of great significance to the scientific research and clinical diagnosis and treatment of FIP.

[0039] Bone marrow-derived macrophages (BMDM) are primary macrophages obtained by in vitro differentiation of bone marrow cells in the presence of macrophage colony-stimulating factor (M-CSF or CSF-1). However, since there is currently no commercialized cat M-CSF protein, the experimenters in previous related studies have used human M-CSF with higher homology instead. However, through previous related studies in this laboratory, it was found that heterologous M-CSF showed higher levels of inflammation than macrophages stimulated by native M-CSF (see the detection results of reactive oxygen species of mouse bone marrow-derived macrophage subtypes stimulated by human M-CSF and mouse M-CSF and the identification results of transcriptional levels of differential phenotypic genes in Examples 7 and 8 below), which had a great impact on the accuracy of the experimental results. Based on this, in order to reduce the inflammatory level of macrophages stimulated by heterologous M-CSF and to more accurately study cat bone marrow-derived macrophages, this laboratory constructed a prokaryotic expression system of recombinant cat macrophage colony-stimulating factor for the first time.

[0040] The prokaryotic expression vector pET-32a (+) used in the present invention is preserved in this laboratory; Escherichia coli DH5α was purchased from Sangon Biotech (Shanghai) Co., Ltd.; Rosetta gamiB (DE3) was purchased from Beijing Solebow Technology Co., Ltd.; Escherichia coli BL21 (DE3) was purchased from Beijing Solebow Technology Co., Ltd.; M-NFS-60 cells were purchased from Beijing Science and Technology (Beijing) Pharmaceutical Research Institute Co., Ltd.

[0041] The experimental animals used in the present invention are: C57BL / 6 female mice, SPF grade, 6-8 weeks old, purchased from Shanghai Jiesijie Experimental Animal Co., Ltd.; cats, 2-3 months old, purchased from Qingdao Animal Health Products Engineering Technology Research Center.

[0042] The restriction endonucleases and Taq DNA polymerase used in the present invention were purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd.; protein markers were purchased from Beijing Quanshijin Biotechnology Co., Ltd., and DNA gel recovery kits were purchased from Omega; MTT was purchased from Acmec Biotechnology Co., Ltd., and urea and imidazole were purchased from Sangon Biotechnology (Shanghai) Co., Ltd.; oxidized / reduced glutathione was purchased from Beijing Solebow Technology Co., Ltd.; and DCFH-DA was purchased from Sigma.

[0043] Other reagents used in the embodiments of the present invention are also conventional reagents and can be obtained by purchase or preparation using known methods.

[0044] Example 1. Construction of FM-CSF prokaryotic expression plasmid

[0045] 1. Feline macrophage colony-stimulating factor (FM-CSF) gene synthesis

[0046] According to the gene sequence of feline macrophage colony stimulating factor (XM_045033266.1) published in the UniProt protein database, Nanjing Qingke Biotechnology Co., Ltd. was commissioned to synthesize FM-CSF, and the FM-CSF gene was connected to the PUC57 vector. After enzyme digestion and sequencing identification, the pUC57-FM-CSF plasmid was obtained.

[0047] 2. Primer Design

[0048] Signal peptides are short (5-30 amino acids in length) peptide chains that guide newly synthesized proteins to the secretory pathway. Usually, signal peptides are located at the N-terminus of the protein (sometimes not necessarily at the N-terminus). Signal peptides are usually hydrophobic and their main function is to promote protein secretion outside the cell. Before expressing recombinant proteins, it is necessary to predict the signal peptide of the sequence, and then delete, replace or add the signal peptide based on the signal peptide prediction results. Signal peptides are a common feature of secretory proteins. The full-length protein is called the precursor protein, and the remaining amino acid portion after removing the signal peptide is called the mature form.

[0049] For prokaryotic cells, simple organelles make it difficult to complete the complex process of signal peptide recognition and removal, guiding the endoplasmic reticulum, Golgi apparatus repackaging and secretion like eukaryotic cells. Some proteins cross the membrane multiple times, which is almost impossible for prokaryotic cells to complete. Therefore, when we use the prokaryotic expression system, we need to remove the signal peptide sequence on the target gene from eukaryotic cells. When Escherichia coli expresses the target gene, it cannot recognize the signal peptide sequence, which will affect the expression of the recombinant protein. Usually, the positioning function of the signal peptide is not required for intracellular expression. The excess signal peptide cannot be recognized and removed by the cell, which may affect the correct folding of the protein, thus causing a series of problems.

[0050] Based on this, this example uses the gene sequence of feline macrophage colony stimulating factor published in the UniProt protein database and uses the Newpro Bio protein signal peptide prediction tool (SignalP-5.0 online software) to detect the signal peptide of feline macrophage colony stimulating factor. The results are as follows: Figure 1 As shown, the probability of having a signal peptide is 95.438%, and the signal peptide type is SP (Sec / SPI); the cleavage site is: 32-33, with a probability of 55.790%. Primers for homologous recombination were designed at the position where the signal peptide sequence was removed. The designed primers are FM-CSF F and FM-CSF R, and BamHI and EcoR I restriction sites are introduced at the 5' end and 3' end of the removed signal peptide sequence, respectively. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the sequences are as follows:

[0051] FM-CSF F1(SEQ ID NO.1):5'--GCCATGGCTGATATC GGATCC GAGGAGGTGTCAGAGCGC-3′;

[0052] FM-CSF R1 (SEQ ID NO.2):

[0053] 5'-TTGTCGACGGAGCTC GAATTC CTATACTGGAAGCTCCACCTGTCTG-3'.

[0054] 3. Construction of FM-CSF prokaryotic expression plasmid

[0055] 3.1 PCR amplification was performed using the PUC57-FM-CSF plasmid synthesized in step 1 as a template. The PCR amplification system was as follows: 2 μL of PUC57-FM-CSF plasmid DNA, 1 μL of each of FM-CSF F and FM-CSF R primers (25 pmol / μL), 25 μL of Premix Taq (LA Taq Version 2.0 plus dye), and H2O was added to make up the total volume to 50 μL. PCR amplification conditions: 98°C pre-denaturation for 4 min; 98°C denaturation for 10 s, 55°C annealing for 30 s, 72°C extension for 90 s, for a total of 30 cycles; 72°C extension for 10 min.

[0056] 3.2 The amplified PCR product was recovered and purified, and the electrophoresis results were as follows Figure 2 As shown, a fragment of about 1400 bp in size was obtained, which is consistent with the expected gene fragment size. The gene sequence of the target gene fragment is shown in SEQ ID NO.3.

[0057] SEQ ID NO.3:

[0058] GAGGAGGTGTCAGAGCGCTGTAGCCACATGATTGGGAACGGACACCTGCAGTTC

[0059] CTGCAGCAGCTGATTGACAGTCAGATGGAGACTTCGTGCCAAATTGCCTTTGAGT

[0060] TTGTAGACCAGGAGCAGTTGAAAGATCCCGTGTGCTACCTTAAGAAGGCCTTTCT

[0061] CCTAGTGCAAGACATAATGGAGGACACCATGCGCTTCAAAGACAATACTCCCAAT

[0062] GCCAATGTCATCGGTGACGCTCCAGGAACTCTCTCTGAGGCTAAGCAGCTGCTTCA

[0063] CCAGGGACTATGAAGAGCAGGACAAGGCCTGTGTACGAACTTTCCATGAGACAC

[0064] CCCTCCAGTTGCTGGAAAAGATCAAGAATGTCTTTAATGAAACAAAGAATCTCCT

[0065] TAAAAAGGACTGGAACGTTTTCAGCAAGAACTGCAACAAGAGCTTTGAGAAATG

[0066] CTCCAGCCAAGATGTGGTGACCAAGCCTGATTGCAACTGCCTGTACCCCAAAGCC

[0067] ACCCCTACCAGTGACCTGGCCTCTGTCTCCCCTCAGCAGCCCCTTGCCCCCTCCAC

[0068] GGCCCCCATGGCTGGCTTGACCCGGGCTGACTCTGAGGGGACAGAGGGCGGCTC

[0069] CCTCTTGCCCAGTGAGCTGCCCCTCCGCACAGTGGACCTGGACCCGGGCACTGCC

[0070] AAGCAGCGACCACCCAGGAGCACCTGCCAGAGCTTTGACTCTCCAGAGCCCCCG

[0071] GGTGTAGAGGCCAGTCCTATCGGAGACTCATCTCAGCCCCAGTCCTCTGCCGGGG

[0072] CCCCCACCCCTGGGATGGAGCACATTCTTGACTCTGTGTTAGGCACTAACTGGAC

[0073] CCTAGAAGAGGCCTCCGGAGAGGCTAGTGAGGGTCCCGTACCCCAAGGGGCAGA

[0074] GCTTTCCTCCTCCAGGCCGGGAGGAGGCAGCATCCAGGCCAAGATGACCGCCAG

[0075] GCCCAGTGACCTCTTGTCAGCATCTTTTCCATTGTCCTACTCAGCCAGGAGCCAGC

[0076] AGCCAGAGGACATGACTAGCATACCCCTGCCCACGGTGGGCCCTGCGAGACCCA

[0077] CTGGCCAGGCCCAGAGTCATACACCTGAGAAGACAGACCGTCCATCTGCCAAGC

[0078] CCAGAGACCACCAGGAGCCAGGCTCTGCCAGGACCCCGTCGCGGCCCCCACGAA

[0079] GCCTCAGCAGTCTCAGGACCCCGTCACGGCCTCCACGAAGCCCCGGCAGTCCCTC

[0080] GGCCCTCTCTGCACAGCCAGGCCATGACAGGCAGCAGGAGGGACCCTCAGACCC

[0081] TCAGCTCCCCGGGTTTGTCTTCCGCCTGCTGGTGCCCAGCATCATCCTGGTCCTGC

[0082] TGGCCGTCGGCGGCCTCCTGTTCTACAGGCAGAGACGGCGGAGCCATCGAGAGC

[0083] CTCAGACAGTGGATTCTCCCATGGAGCGACCAGAGGGCAGCCCCCTGACCCAGG

[0084] ATGAGGACAGACAGGTGGAGCTTCAGTATAG

[0085] 3.3 The target gene fragment was subcloned into the corresponding site of the pET-32a(+) prokaryotic expression vector, and the resulting ligation product was transformed into DH5α competent cells. White colonies were picked for culture, and a small amount of plasmid was extracted for PCR and restriction enzyme digestion identification. Figure 3 As shown, the results showed that the recombinant plasmid was constructed correctly, and the obtained recombinant plasmid was named pET-32a-FM-CSF.

[0086] 3.4 The positive clones were further sent to Shanghai Biotech Co., Ltd. for sequencing verification to confirm that the sequence had no mutations and the reading frame was correct. The sequencing results showed that the amplified FM-CSF gene was 1452 bp in length, encoding 483 amino acid residues, and had a 100% homology with the FM-CSF gene reference sequence XM_045033266.1 published in GenBank. DNAstar11.0 software was used to further compare the obtained sequence with the M-CSF gene sequences of other animals known in GenBank for nucleotide and amino acid homology analysis. The results showed that the amplified FM-CSF ORF had 84.2%, 79.1% and 74.0% homology with the nucleotide sequence of M-CSF of human, pig and mouse, respectively; the deduced amino acid sequence had 76.0%, 87.2% and 79.5% homology, respectively.

[0087] Example 2 Expression of recombinant protein in Escherichia coli

[0088] 1) The FM-CSF prokaryotic expression plasmid pET-32a-FM-CSF and the pET-32a empty vector plasmid obtained in Example 1 were transformed into competent Escherichia coli BL21 (DE3), respectively. The specific transformation steps were: pET-32a-PM-CSF and pET-32a empty vector plasmids were added to the competent cells BL21 (DE3) at a ratio of 1:10, respectively, after ice bathing for 30 minutes, heat shock in a 42°C water bath for 45 seconds, ice bathing for 2 minutes, coating LB solid culture medium containing Amp, and culturing in an oven at 37°C overnight. Then pick a single colony after transformation, inoculate 5mL of LB culture medium containing Amp, and culture at 37°C with shaking. When the OD600 of the bacterial solution is 0.8, add IPTG to a final concentration of 0.1mmol / L, continue culturing for 6 hours, take 1mL of the bacterial solution, centrifuge to collect the bacteria, and detect the expression of the recombinant protein by SDS-PAGE electrophoresis. The results are as follows Figure 4 As shown, the results showed that the induced pET-32-FM-CSF recombinant bacteria did not show a specific protein band at a molecular weight of approximately 70.4 kD (lanes 4 and 5), indicating that the recombinant protein was not significantly expressed in BL21 (DE3).

[0089] 2) The FM-CSF prokaryotic expression plasmid pET-32a-FM-CSF and the pET-32a empty vector plasmid obtained in Example 1 were transformed into competent Escherichia coli Rosetta gamiB (DE3), respectively. The specific transformation steps are: add pET-32a-PM-CSF and pET-32a empty vector plasmids to the competent cells BL21 (DE3) at a ratio of 1:10, respectively, after ice bathing for 30 minutes, heat shock in a 42°C water bath for 45 seconds, ice bath for 2 minutes, apply LB solid culture medium containing Amp, and culture in an oven at 37°C overnight. Then pick a single colony after transformation, inoculate 5mL of LB culture medium containing Amp, and culture at 37°C with shaking. When the OD600 of the bacterial solution is 0.6-0.8, add IPTG to a final concentration of 0.1-0.5mmol / L for induction, continue to culture for 6 hours, take 1mL of the bacterial solution, centrifuge to collect the bacteria, and detect the expression of the recombinant protein by SDS-PAGE electrophoresis. The results are as follows Figure 5 and Figure 6 As shown, the results showed that the pET-32-FM-CSF recombinant bacteria expressed by induction had a specific protein band at a molecular weight of about 70.4 kD ( Figure 5 Lane 4 in Figure 6 The size of the recombinant protein is basically consistent with the deduced size. In contrast, the uninduced pET-32-FM-CSF recombinant bacteria did not show this band ( Figure 5 Lane 3 in Figure 6 Lane 2 in the figure), and the induced pET-32a(+) empty vector bacteria also did not show a protein band around 70.4kD ( Figure 5 Lane 2 in Figure 1) indicates that the recombinant protein was expressed in Rosetta gamiB (DE3).

[0090] The pET-32a-FM-CSF recombinant bacteria and pET-32a(+) empty vector bacteria induced by expression in step 2) were transferred to nitrocellulose membranes after SDS-PAEG and analyzed by Western blot. The membranes were blocked with 5% BSA for 2 h, and anti-6×His monoclonal antibody was diluted 1:1000 as primary antibody, and HRP-labeled goat anti-mouse IgG was diluted 1:2000 as secondary antibody. The membranes were reacted at 37°C for 1 h, and then washed and developed with ECL. The results are shown in Figure 2. Figure 7 Western blot results showed that the pET-32a-FM-CSF recombinant bacteria after induced expression (IPTG final concentration 0.1mmol / L, bacterial solution OD600 of 0.8) showed a specific band at about 70.4kD (lane 4), while the induced pET-32a (+) empty vector bacteria did not show any band at the same position (lane 2), confirming that the recombinant protein was correctly expressed.

[0091] Example 3 Purification of recombinant protein

[0092] The induction step 2) in Example 2 was performed, and the bacterial solution after continued cultivation for 6 hours was centrifuged, 400 mL of bacterial cells were collected, resuspended in PBS (containing 1 mg / mL lysozyme) and ice-bathed for 30 minutes, ultrasonically disrupted the bacterial cells, and centrifuged at 12,000 r / min for 10 minutes to collect the precipitate 1 and supernatant 1 (the precipitate 1 and supernatant 1 were subjected to SDS-PAGE analysis, Fig. 9 Lane 2 and Lane 3 in the figure). The precipitate 1 (inclusion body) was homogenized and washed three times with inclusion body washing solution (50mmol / L Tris-HCl (pH 8.0), 1mmol / LEDTA, 0.2% TritonX-100, 2mol / L urea), and the precipitate 2 was collected by centrifugation at 12,000r / min for 10min. The precipitate 2 was dissolved with 5mL inclusion body denaturation solution (50mmol / L Tris-HCl (pH 8.0), 2mmol / L 2-ME, 8mol / L urea), and the supernatant 2 was collected by centrifugation at 12,000r / min for 10min. The supernatant 2 collected by centrifugation was chelated by Ni2+-NTA affinity chromatography column and stored at 4°C overnight. The flow-through was collected after overnight column storage and before elution ( Fig. 9 Lane 5 in the figure) was subjected to SDS-PAGE analysis. The next day, different concentrations and amounts of elution buffer (2-25 ml of elution buffer containing 20-500 mmol / L imidazole, other components of the eluent also include: 1.64 g Na3PO4, 14.61 g NaCl; specifically, 25 ml of elution buffer containing 20 mmol / L imidazole, 25 ml of elution buffer containing 50 mmol / L imidazole, 10 ml of elution buffer containing 100 mmol / L imidazole, 5 ml of elution buffer containing 200 mmol / L imidazole, 2 ml of elution buffer containing 500 mmol / L imidazole) were used for elution in sequence, and the elution peaks were collected step by step, and the protein purification process was analyzed by SDS-PAGE. The results are shown in Figure 8 and Fig. 9 As shown in the results, most of the impurities can be removed after the inclusion bodies are eluted, and the purity of the recombinant protein can reach 89.73% ( Figure 8 ); When the imidazole concentration is 100-500mmol / L, a relatively ideal purified protein band can be obtained ( Fig. 9Lanes 10, 11, and 12 in the figure). The recombinant protein collected in the purification step was transferred to the refolding buffer (50mmol / L Tris-HCl (pH8.0), 0.1mmol / L oxidized glutathione, 1mmol / L reduced glutathione, and 0.5mol / L urea) and renatured at 4°C for 24h. The renatured protein was dialyzed against PBS at 4°C overnight, concentrated, and the protein concentration was determined to be 963μg / mL using the Biotech Protein BCA Kit. After filtration and sterilization, it was frozen at -20°C for later use.

[0093] Example 4 Activity determination of recombinant protein 1

[0094] M-NFS-60 cells were cultured in a special medium for M-NFS-60 cells (containing 90% RPMI-1640, 10% FBS, 62ng / mL M-CSF (provided by the product), and 0.05mM β-mercaptoethanol). The cells were collected by centrifugation and washed three times with RPMI1640. Then, RPMI-1640 (containing 10% FBS and 1% double antibody) was added to resuspend the cells and adjust the density to 2×10 5 / mL, and obtain a cell suspension. Add 50μL RPMI1640 medium to each well of the 96-well plate, dilute the recombinant protein purified in Example 3 with RPMI1640 appropriately, take 50μL and add it to the first well of each row, and dilute it in multiples (repeat 3 wells for each concentration); at the same time, use a row of cell wells without adding samples as a blank control. Add 50μL of cell suspension to each well of the above cell wells, culture at 37℃ for 48h, add 20μL MTT (5mg / mL) to each well, continue to culture for 5h, add 100μL acidic SDS (10% SDS, 0.012mol / L HCl) to each well, and place at 37℃ overnight. Zero the blank control well, and use an ELISA reader to measure the OD570 and OD630 of each well at wavelengths of 570nm and 630nm. The OD values ​​obtained by the MTT method for the standard and the test samples with different concentrations were plotted as the difference between OD570 and OD630. Fig.10 The results showed that the recombinant protein concentration of 10ug / mL in the culture medium could significantly maintain the growth of M-NFS-60 cells, and the control cells without recombinant protein died after 2 to 3 days.

[0095] Example 5 Activity determination of recombinant protein 2

[0096] 1. Isolation and culture of mouse bone marrow-derived macrophages: C57BL / 6 female mice were killed by cervical dislocation, and the hind limbs of the mice were separated and soaked in 75% alcohol for 15 minutes, and then transferred to the clean bench. Cut off both ends of the bone, and insert a 1ml syringe into both ends of the bone for flushing. Use a 5mL syringe to draw 1640 culture medium containing 10% serum and 1% antibiotics to flush the bone marrow. Rinse both ends of the bone once into a 15mL centrifuge tube, centrifuge at 4℃550×g for 5 minutes in a low-temperature horizontal centrifuge, and discard the supernatant. The precipitated cells were suspended and mixed by blowing in 1640 medium, washed twice, centrifuged at 4°C 550×g for 5 min, and the supernatant was discarded. The cells were resuspended in 2 mL of red blood cell lysis buffer and lysed for 5 min. During the period, the mixture was mixed several times by inversion every two minutes, centrifuged at 4°C and 550×g for 5 min, and washed twice with PBS. The centrifuged cells were resuspended into a single cell suspension in 1640 medium containing 1% antibiotics + 10% FBS + 100-300 ng / mL FM-CSF (the purified recombinant protein obtained in Example 3), and the cell density was adjusted to 1×10 6 Each well was plated in a six-well plate, and the culture medium was replaced after 3 days. The cell morphology was observed under an inverted microscope every day. The biological activity results of different concentrations of recombinant protein (100ng / mL, 200ng / mL, 300ng / mL) on mouse bone marrow-derived macrophages are shown in Figure 2. Fig.11 The results showed that the recombinant protein concentration of 200 ng / mL in the culture medium of mouse bone marrow-derived macrophages could significantly stimulate mouse BMHC (bone marrow-derived stem cells) to differentiate into macrophages.

[0097] 2. Isolation and culture of cat bone marrow macrophages: Cats were isolated and cultured using the same method as step 1. Cell morphology was observed under an inverted microscope every day. The biological activity results of 200 ng / mL recombinant protein on cat bone marrow macrophages are shown in Figure 2. Fig.12 The results showed that adding 200 ng / mL of recombinant protein to the culture medium of cat bone marrow-derived macrophages could significantly stimulate cat BMHC (bone marrow-derived stem cells) to differentiate into M0 macrophages, and the stimulation results were consistent with the stimulation effect of adding recombinant protein to mouse bone marrow-derived macrophages.

[0098] Example 6 Phagocytosis Experiment

[0099] To test the differentiation of macrophages, a phagocytosis experiment was performed. The pET-28a-EGFP was streaked, and a single colony was selected and inoculated into a liquid culture medium containing 50 μg / ml KanrLB. When the colony was cultured at 37°C until OD600 = 0.6-0.8, a final concentration of 0.3 mM IPTG was added, and the cells were induced at 37°C for 3 hours. The bacterial concentration was diluted to a multiplicity of infection of 20:1, and then inoculated into the feline M0 macrophages (FM0) differentiated in step 2 of Example 5. After incubation at 37°C for 0.5 h, the phagocytosis ability of the M0 macrophages was verified. The results are as follows: Fig.13 The results showed that green fluorescence (blue excitation) was visible under a fluorescence microscope, proving that the polarized macrophages induced by the stimulus (recombinant protein) had phagocytic ability.

[0100] Example 7 Detection of reactive oxygen species in macrophage subtypes stimulated by M-CSF in different species

[0101] Reactive oxygen species are important immune mediators released by macrophages in response to pathogens such as bacteria, viruses, and parasites. By producing reactive oxygen species, macrophages can kill or at least inhibit the growth of pathogens and protect the body from infection. By interacting DCFH-DA (2,7-dichlorofluorescein diacetate) with differentiated macrophage subtypes, the changes in reactive oxygen species of activated bone marrow-derived macrophages were detected, and the green fluorescence intensity was detected by flow cytometry to show the level of ROS. Related studies have shown that cytokines of different species may have different effects on the differentiation and function of macrophages due to their different amino acid sequences and post-translational modifications. For example, although human and mouse cytokines are similar in structure, they may have different efficiencies or effects on the macrophage activation pathway due to subtle differences. Based on this, we stimulated differentiated mouse bone marrow-derived macrophages with human M-CSF (HM), cat M-CSF (FM), and mouse M-CSF (MM), and detected the levels of reactive oxygen species in each differentiated mouse bone marrow-derived macrophage.

[0102] The specific steps are as follows:

[0103] 1. C57BL / 6 female mice were killed by dislocating the neck, and the hind limbs of the mice were separated. After soaking in 75% alcohol for 15 minutes, they were transferred to the clean bench. The two ends of the bone were cut off, and a 1ml syringe was inserted into the two ends of the bone for flushing. A 5mL syringe was used to draw 1640 culture medium containing 10% serum and 1% antibiotics to flush the bone marrow. Both ends of the bone were flushed once into a 15mL centrifuge tube, and centrifuged at 4℃550×g for 5 minutes in a low-temperature horizontal centrifuge, and the supernatant was discarded. The precipitated cells were suspended and mixed by blowing in 1640 medium, washed twice, centrifuged at 4°C 550×g for 5 min, and the supernatant was discarded. The cells were resuspended in 2mL of red blood cell lysis buffer and lysed for 5 min. During the period, the cells were mixed several times by inversion every two minutes, centrifuged at 4°C and 550×g for 5 min, and washed twice with PBS. The centrifuged cells were resuspended into a single cell suspension in 1640 medium containing 1% antibiotics + 10% FBS + 20ng / mL human M-CSF (purchased from PEPROTECH), feline M-CSF (the purified recombinant protein obtained in Example 3) or mouse M-CSF (purchased from PEPROTECH) to adjust the cell density to 1×10 6 Each well was plated in a six-well plate, and the culture medium was replaced after 3 days. After 7 days of culture, differentiated human M0 macrophages (HM0), cat M0 macrophages (FM0), and mouse M0 macrophages (MM0) were obtained.

[0104] 2. Macrophages (HM0, FM0, MM0) were cultured at 1×10 per well. 6 The cells were plated in six-well plates, washed twice with PBS after overnight culture, added with DCFH-DA (20 μmol / L; Sigma D6883), incubated at 5% CO2 and 37°C for 30 min, then washed three times with PBS, digested and resuspended, and the mean fluorescence intensity was analyzed by flow cytometry. Fig.14 As shown, the mouse bone marrow macrophages differentiated by cat M-CSF and human M-CSF showed high levels of reactive oxygen species, while the levels of reactive oxygen species in the mouse bone marrow macrophages differentiated by mouse M-CSF were very low. The results prove that allogeneic M-CSF stimulated differentiated bone marrow macrophages to induce high levels of reactive oxygen species.

[0105] Example 8 Identification of transcriptional levels of differentially phenotypic genes of macrophage subtypes stimulated by M-CSF in different species

[0106] In order to explore the degree of stimulation of mouse bone marrow-derived macrophages by stimulatory factors (M-CSF) of different species, M0, M1, and M2 macrophages were collected after being stimulated by stimulators (20 ng / mL of HM, MM, or 200 ng / mL of FM), and then nucleic acids were extracted to detect changes in the mRNA levels of their phenotypic genes. The specific experimental steps are as follows:

[0107] 1. Obtaining M0 macrophages: Obtain mouse bone marrow-derived M0 macrophages stimulated with human, cat, and mouse M-CSF, respectively, using the same method as step 1 in Example 7;

[0108] 2. Obtaining M1 macrophages: Add 100ng / ml LPS or 100ng / ml IFN-γ to M0 macrophages for polarization for 24 hours to obtain mouse bone marrow-derived M1 macrophages stimulated with human, cat, and mouse M-CSF, respectively;

[0109] 3. Obtaining M2 macrophages: Add 100ng / ml IL-4 or 100ng / ml IL-10 to M0 macrophages for polarization for 24 hours to obtain mouse bone marrow-derived M2 macrophages stimulated with human, cat, and mouse M-CSF, respectively;

[0110] 4. Use the Novezan Nucleic Acid Extraction Kit to extract nucleic acids from M0 macrophages, M1 macrophages, and M2 macrophages (this step is machine-operated, and nucleic acid products can be obtained by simply adding cells to the kit and loading it on the machine);

[0111] 5. The extracted nucleic acid product was reverse transcribed using the reverse transcription system: 4xHifair AdvanceFast One-StepRT SuperMix 5μL, gDNA Remover Mix 1μL, and the volume was adjusted to 20uL with the extracted nucleic acid. The reaction procedure was 37℃ for 5min and then 86℃ for 30s;

[0112] 6. Use the nucleic acid reverse transcription product obtained in step 5 as a template to prepare the RT-qPCR system, which includes: 10 μL of 2xUniversal Blue SYBR Green gPCR Master Mix, 0.4 μL of upstream and downstream primers, and Nuclease-Free Water to make up to 20 uL after adding different templates.

[0113] 7. Perform fluorescence quantitative PCR detection on the machine to obtain the relative expression levels of iNOS and Arg-1 mRNA.

[0114] The relative expression levels of iNOS and Arg-1 mRNA in M0 macrophages were used as internal references in the calculation of each group to obtain the relative expression level of specific mRNA (iNOS) in M1 macrophages and the relative expression level of specific mRNA (Arg-1) in M2 macrophages. The results are shown in Figure 2. Fig.15 As shown, both cat-derived M-CSF and human-derived M-CSF have stronger adverse effects on mouse bone marrow-derived macrophages than mouse-derived M-CSF.

[0115] Based on the results of Examples 7 and 8, the following conclusion can be drawn: When the cat-derived M-CSF obtained in the embodiments of the present invention is used to stimulate the differentiation of cat bone marrow-derived macrophages, the level of reactive oxygen species and adverse effects will be significantly reduced compared to the use of heterologous M-CSF (such as human M-CSF).

[0116] The above describes the specific embodiments of the present invention. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art may make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A method for constructing a prokaryotic expression plasmid of a recombinant feline macrophage colony stimulating factor, characterized in that: The following steps are involved: A. Synthesizing PUC57-FM-CSF plasmid: synthesizing the feline macrophage colony stimulating factor gene according to the published feline macrophage colony stimulating factor gene sequence, and then cloning the synthesized feline macrophage colony stimulating factor gene into the PUC57 plasmid to obtain the PUC57-FM-CSF plasmid; B. Construction of FM-CSF prokaryotic expression plasmid: The signal peptide of feline macrophage colony stimulating factor was detected, and primers for homologous recombination were designed at the position where the signal peptide sequence was removed; then, the synthesized PUC57-FM-CSF plasmid was used as a template and the designed primers were used for PCR amplification. The amplified target gene was purified and subcloned into the corresponding site of the prokaryotic expression vector. The obtained ligation product was transformed into Escherichia coli DH5α competent cells to obtain the correctly identified FM-CSF prokaryotic expression plasmid.

2. The method for constructing the prokaryotic expression plasmid of recombinant feline macrophage colony stimulating factor according to claim 1, characterized in that: In step B, the sequences of the primer pair are shown as SEQ ID NO.1 and SEQ ID NO.

2.

3. The method for constructing the prokaryotic expression plasmid of recombinant feline macrophage colony stimulating factor according to claim 1, characterized in that, In step B, the nucleotide sequence of the target gene is shown as SEQ ID NO.

3.

4. The method for constructing the prokaryotic expression plasmid of recombinant feline macrophage colony stimulating factor according to claim 1, characterized in that, In step B, the prokaryotic expression vector is pET-32a(+).

5. The method for constructing the prokaryotic expression plasmid of recombinant feline macrophage colony stimulating factor according to claim 1, characterized in that, In step B, the PCR amplification reaction system is: 2 μL of PUC57-FM-CSF plasmid DNA, 1 μL of 25 pmol / μL FM-CSF F1 and FM-CSF R1 primers, 25 μL of Premix Taq, and H2O is added to make up the total volume to 50 μL.

6. The method for constructing the prokaryotic expression plasmid of recombinant feline macrophage colony stimulating factor according to claim 1, characterized in that: In step B, the reaction conditions of the PCR amplification are: pre-denaturation at 98°C for 4 min; denaturation at 98°C for 10 s, annealing at 55°C for 30 s, extension at 72°C for 90 s, for a total of 30 cycles; extension at 72°C for 10 min.

7. A prokaryotic expression plasmid of recombinant feline macrophage colony stimulating factor constructed according to the method according to any one of claims 1 to 6.

8. A recombinant protein, characterized in that The recombinant protein is obtained by the following steps: transfecting the prokaryotic expression plasmid of the recombinant feline macrophage colony stimulating factor according to claim 7 into competent Escherichia coli Rosetta gamiB (DE3), picking a single colony after transformation and inoculating it into LB medium containing Amp for shaking culture, adding 0.1-0.5mM IPTG when the OD600 of the bacterial solution is 0.6-0.8, inducing culture for 5-7h, collecting the bacteria by centrifugation, resuspending and ice bathing for 25-35min, ultrasonically disrupting the bacteria and then centrifuging, collecting the precipitate, denaturing and purifying, and obtaining the recombinant protein.

9. The recombinant protein according to claim 8, characterized in that The specific steps of the post-denaturation purification are: washing the precipitate with an inclusion body washing solution, treating it with an inclusion body denaturation solution, centrifuging the resulting supernatant, chelating it with an affinity chromatography column, and then eluting it with an elution buffer containing 20 to 500 mmol / L imidazole, collecting the elution peak, and obtaining the purified recombinant protein.

10. Use of the recombinant protein according to claim 8 as a stimulator in promoting differentiation of cat bone marrow-derived macrophages.

Images