Application of ppt1 gene in high yield of gibberellins ga4 and ga7
By overexpressing the ppt1 gene in filamentous fungi and optimizing the Fujikura Gibberella strain to produce GA4 and GA7, the problem of low gibberellin GA4+7 production was solved, and efficient GA4 and GA7 production was achieved to meet market demand.
Patent Information
- Application Number
- CN202311333530.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-10-16
- Publication Date
- 2025-10-24
- Estimated Expiration
- 2043-10-16
AI Technical Summary
In the existing technology, the production capacity of gibberellin GA4+7 is low, which is difficult to meet market demand and limits its large-scale application in industrial production.
By overexpressing the ppt1 gene in the lysine biosynthesis pathway in filamentous fungi, the strain was optimized to produce intermediate metabolites GA4 and GA7 instead of the final metabolic product GA3. The ppt1 expression frame was transformed into Gibberella fujikura using the PEG-mediated method, and an engineered strain with high GA4 and GA7 production was constructed using the hygromycin resistance selection marker.
The production of GA4 and GA7 is significantly increased, making the production of GA4+7 mixture reach 36 times, meeting market demand, simple operation and significant effect.
Smart Images

Figure CN119842774B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the field of biotechnology, and particularly relates to application of a ppt1 gene in high-yield gibberellins GA4 and GA7. BACKGROUND
[0002] Gibberellins are endogenous growth regulators widely existing in plants, participate in multiple biological processes of plant growth and development, and have important regulatory effects on plant growth and development. So far, 136 gibberellins have been found from various organisms, and only a few gibberellins such as GA1, GA3, GA4 and GA7 belonging to the free type have strong physiological activities. Among them, GA3 has the highest activity and is the most widely used, and is the only gibberellin product that is currently commercially mass-produced. However, GA3 has excessively high activity, and excessive use can cause plants to grow wildly. In recent years, GA 4+7 applications in breaking dormancy and the like have attracted attention. In promoting stem and leaf growth of dwarf crops, GA4 shows better activity than GA3; in adjusting fruit type, GA 4+7 Due to its higher activity and more direct effect, GA4 is increasingly used as a plant growth regulator in agricultural and forestry production processes.
[0003] Gibberellin products on the market mainly include GA3 and mixed formulations GA 4+7 However, the production capacity of GA 4+7 is currently low, but its application range is continuously expanding, and the market demand is gradually increasing, so that the market price of GA 4+7 is about 3 times that of GA3, and the market sales price of the formulation rich in GA7 in the mixed formulation is more than 20% higher than that of the formulation containing the same content of GA4.
[0004] In the prior art, methods such as reasoning breeding and metabolic engineering directed modification are usually used to improve the yield of gibberellin GA 4+7 . For example, related enzymes or genes in the metabolic pathway can be knocked out by gene knockout method, and a mixed formulation GA 4+7 containing no gibberellin GA3 can also be obtained. Although the CRISPR / Cas9 system has been introduced and successfully used for gene modification of filamentous fungi, the structure of filamentous fungi is complex and multiple nuclei phenomenon often exists, so the knocking-out efficiency of the CRISPR / Cas9 system in filamentous fungi is very low. Due to the difficulty in industrial production and low yield of GA 4+7 , it cannot meet the market demand, which limits its large-scale application. SUMMARY
[0005] In order to solve the problem of low yield of GA 4+7The application provides an application of a ppt1 gene in high-yield gibberellin GA4 and GA7, and solves the problems of great difficulty and low yield in industrial production. 4+7 The mixture yield can reach 934.5 mg / L. The application method is simple in operation and remarkable in effect, and provides a feasible route for construction of the high-yield GA4 and GA7 engineering strain.
[0006] The technical scheme of the application is as follows: the application of a ppt1 gene in high-yield gibberellin GA4 and / or GA7 in filamentous fungi. The ppt1 gene, i.e., a phosphopantetheinyl transferase encoding gene, encodes Sfp type phosphopantetheinyl transferase (PPTase) protein which participates in lysine biosynthesis, regulates the activities of polyketide synthase and non-ribosomal polypeptide synthetase, and modifies enzymes related to a plurality of secondary metabolite synthesis pathways. The PPTase can perform 4'-phosphopantetheinylation post-translational modification on the ACP domain, i.e., phosphopantetheinyl group transfer. The ppt1 gene encoding the enzyme widely exists in some filamentous fungi, such as Gibberella fujikuroi and Beauveria bassiana, and plays a relatively important regulating role in a plurality of primary metabolism and secondary metabolism synthesis, such as protein modification of amino acid synthetase, polyketide synthase and non-ribosomal polypeptide synthase, and the phosphopantetheinyl group on coenzyme A is transferred to the conserved serine residue of the above-mentioned protein, thereby synthesizing fatty acid, polyketide and non-ribosomal peptide.
[0007] Specifically, the method of the application is as follows: the ppt1 expression frame is transformed into filamentous fungi for expression. The important gene ppt1 in the lysine synthesis pathway of filamentous fungi is overexpressed, and the optimized strain only produces intermediate metabolites GA4 and GA7, but does not produce the final metabolite GA3.
[0008] Further, the ppt1 expression cassette comprises a promoter, a ppt1 gene, and a terminator. The ppt1 expression cassette generally comprises important regulatory sequences and functional regions serving the target ppt1 gene, and helps to maintain the structural and functional integrity of the target gene. For example, the ppt1 expression cassette of the present application comprises a promoter with a length of 1000-1200 bp, which can promote the transcription and translation of the target ppt1 gene in the host cell, so as to achieve higher expression efficiency and ultimately achieve overexpression. It is worth noting that, due to the particularity of the nucleotide sequence, the ppt1 expression cassette referred to in the present application can have a polynucleotide variant, including a polynucleotide variant of the promoter and a polynucleotide variant of the ppt1 gene. Any polynucleotide variant shown in the present application falls within the scope of protection of the present application as long as it has more than 90% homology with the aforementioned polynucleotide. The polynucleotide variant refers to a polynucleotide sequence with one or more nucleotide changes. This polynucleotide variant can be a natural variant or a non-natural variant, including a substitution variant, a deletion variant, and an insertion variant. As known in the art, an allelic variant is an alternative form of a polynucleotide, which can be a substitution, deletion, or insertion of a polynucleotide, but does not substantially change the function of the encoded peptide protein. For different filamentous fungi with gibberellin synthesis capacity, the application method should be selected according to the ppt1 expression cassette suitable for the filamentous fungus.
[0009] Preferably, the filamentous fungus comprises Fusarium fujikuroi. The ppt1 gene is widely present in Fusarium graminearum, Fusarium moniliforme, Beauveria bassiana, Fusarium fujikuroi and other fungi, and is mainly involved in the biosynthesis of lysine. The above-mentioned fungi are known to cause plant gibberella diseases. At present, the industrial production of gibberellins mainly depends on the liquid fermentation of Fusarium fujikuroi. In addition, some species belonging to the genus Fusarium, such as Fusarium moniliforme, and some species belonging to the genus Aspergillus, such as Aspergillus niger, have also been confirmed to have the potential for industrial synthesis of gibberellins. Stable and high-yield strains are crucial for industrial production. The present application specifically provides the application of the ppt1 gene in Fusarium fujikuroi for high-yield gibberellins GA4 and / or GA7. The application method provided by the present application can also be implemented in the above-mentioned filamentous fungi or strains with gibberellin synthesis capacity. Overexpression of the ppt1 gene can improve the yield of metabolic products GA4 and GA7 in the metabolic pathway.
[0010] The nucleotide sequence of the ppt1 expression frame includes the nucleotide sequence of the ppt1 gene. For different filamentous fungi with gibberellin synthesis ability, the application method can specifically use the ppt1 expression frame for the filamentous fungi. The filamentous fungi specifically involved in the application are Gibberella fujikuroi. The nucleotide sequence of the ppt1 gene of Sfp type Gibberella fujikuroi is shown in SEQ ID NO. 1, and the nucleotide sequence of the ppt1 expression frame for the Gibberella fujikuroi is shown in SEQ ID NO. 2.
[0011] The application also provides a Gibberella fujikuroi genetically engineered bacterium with high yield of gibberellins GA4 and GA7, which is obtained by the following method: constructing the ppt1 expression frame into an expression vector and then transforming the expression vector into the Gibberella fujikuroi.
[0012] Specifically, the expression plasmid further includes a resistance screening gene. The resistance screening gene generally includes a hygromycin resistance gene Hygr, a geneticin resistance gene G418, a bleomycin resistance gene bleoR and the like. By introducing the resistance screening gene into the plasmid, only the transformants that are successfully transformed can grow in the medium containing the corresponding resistance substance, so that the positive transformants can be effectively screened and separated.
[0013] Preferably, the resistance screening gene includes the hygromycin resistance gene Hygr.
[0014] Further, the Gibberella fujikuroi genetically engineered bacterium is preferably obtained by the following method: constructing the ppt1 expression frame into an expression plasmid, and using a polyethylene glycol (PEG) mediation method to transfer the expression plasmid with the ppt1 expression frame into wild Gibberella fujikuroi protoplasts, and then transforming the expression plasmid into the Gibberella fujikuroi. The PEG mediation method is a simple method and is commonly used for transformation of the Gibberella fujikuroi. The method increases the permeability of the cell membrane by treating with a CaCl2-PEG mixed solution, so that the cell is in an active state of easily accepting nucleic acid fragments or plasmids from the outside world.
[0015] The application also provides a method for overexpressing the ppt1 gene and producing gibberellins GA4 and GA7 in high yield, which includes the following steps: constructing the ppt1 expression frame into an expression vector and then transforming the expression vector into Gibberella fujikuroi protoplasts to obtain transformants, using hygromycin resistance as a screening marker, and fermenting and culturing the obtained positive transformants to prepare GA4 and GA7.
[0016] Preferably, the resistance screening gene is the hygromycin resistance gene Hygr.
[0017] Further, the method is preferably performed according to the following steps:
[0018] The ppt1 expression cassette was constructed into an expression plasmid, and the expression plasmid was transformed into the protoplasts of Gibberella fujikura by the PEG-mediated method. Hygromycin resistance was used as a screening marker, and the positive transformants obtained by screening were verified by PCR and re-screened by sequencing. The verified positive transformants were fermented and cultured to prepare GA4 and GA7.
[0019] Beneficial effects of the present invention: The present invention provides an application of the ppt1 gene in high-yield gibberellins GA4 and GA7. By overexpressing the key gene ppt1 in the lysine synthesis pathway in filamentous fungi, the production of gibberellins intermediate metabolites GA4 and GA7 in filamentous fungi is increased, and the production of gibberellins final product GA3 is reduced to 0. The method is simple to operate and has significant effects, providing a new approach for the construction of high-yield GA4 and GA7 engineered strains. Compared with wild-type Fujikura Gibberella, the Fujikura Gibberella genetically engineered strain provided by the present invention can more efficiently carry out the fermentation production of GA4 and GA7, making GA 4+7 The yield of the mixture increased by 36 times. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] Figure 1 Schematic diagram of the construction of the pOEorippt1 vector in Example 1.
[0021] Figure 2 This is a microscope image of the protoplasts of Gibberella fujikura in Example 1.
[0022] Figure 3 This is a comparison chart of the sequencing results of the positive transformants in Example 1.
[0023] Figure 4 The growth conditions of the genetically engineered Gibberella fujikura strains OE:ppt1-1, 3, 4, and 5 with high gibberellin GA4 and GA7 production in Example 1 on PDA agar plates are shown. DETAILED DESCRIPTION
[0024] The following describes the embodiments of the present invention by specific embodiments. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments. The various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, in the case of no conflict, the features in the following examples and embodiments can be combined with each other. In the embodiments of the present invention, unless otherwise specified, the methods used are all conventional methods, and the reagents used can be obtained from commercial sources.
[0025] Example 1:
[0026] The embodiment provides application of the ppt1 gene in high-yield gibberellins GA4 and / or GA7 of filamentous fungi.
[0027] The embodiment further provides a Gibberella fujikuroi genetically engineered bacterium for high-yield gibberellins GA4 and GA7.
[0028] The embodiment further provides a method for high-yield gibberellins GA4 and GA7 by overexpression of the ppt1 gene.
[0029] The specific experimental process is as follows.
[0030] Construction of expression plasmid pOEorippt1: two pairs of upstream and downstream primers F1, R1, F2, R2 are used to amplify the ppt1 expression frame and the hygromycin resistance gene Hygr, respectively. The previously obtained ppt1 expression frame gene fragment and the hygromycin resistance gene are connected to the linearized vector pOEori by one-step cloning, so as to obtain the expression plasmid pOEorippt1. The expression plasmid pOEorippt1 comprises a ppt1 expression frame comprising the Gibberella fujikuroi ppt1 gene and a DNA element of the hygromycin resistance gene Hygr, as shown in the following formula (I). Figure 1 The expression plasmid pOEorippt1 is transformed into Escherichia coli DH5α for storage for subsequent use. The transformation method of the Escherichia coli DH5α is as follows: the Escherichia coli competent cells DH5α are thawed on ice; 10 μL of the recombinant Pcas-ppt1 vector plasmid is added into 100 μL of the competent cells, and the liquid is uniformly mixed by gently blowing and is placed on ice for 30 min; 42 ℃ water bath heat shock for 50 s, and then placed on ice for 5 min to promote cell membrane shrinkage; 600 uL of LB medium is added and mixed by blowing, and then cultured at 37 ℃ and 200 rpm for 1 h. 200 μL is aspirated and coated on an Amp-resistant plate; and then inverted and cultured in a 37 ℃ incubator for 12-16 h. Before use, the pOEorippt1 vector is used to pick a single colony of the Escherichia coli DH5α in a test tube containing 10 mL of LB medium, and then cultured at 30 ℃ in a constant-temperature shaker for 12-14 h, and then the pOEorippt1 vector plasmid is extracted by using a plasmid extraction kit.
[0031] Preparation of G. fujikuroi protoplasts: G. fujikuroi was picked with a sterile toothpick from PDA (PDA medium: potato 200 g / L, glucose 20 g / L, agar powder 15 g / L) medium to a thum size of fungal plaque in YEPD medium (YEPD medium: yeast extract powder 30 g / L, peptone 10 g / L, glucose 20 g / L) and cultured for 2 days. The cultured fungal liquid in YEPD medium was poured into a Buchner funnel with double-layer filter paper in a clean bench, and was filtered to dryness, then washed with 0.8 mol / L sodium chloride solution for 3 times, and was filtered to dryness. About 1 g of the fungal body was scraped with a sterile gun head into 10 mL of cell wall enzyme solution (1% Driselase, 2% Yatalase, 1% Snailase, 0.8 M NaCl solution), and was enzymolyzed at 30°C, 150 rpm for 2-3 h, and was gently inverted every half an hour to mix evenly. The completely enzymolyzed fungal liquid was filtered with double-layer Miracloth into a sterilized 50 mL centrifuge tube, and the remaining fungal body and insoluble substances were removed. 10 mL of 0.8 mol / L sodium chloride solution was added, and was mixed evenly with a blunt gun head to fully suspend the protoplasts, and was centrifuged at 600 x g, 4°C for 10 min, and the supernatant was discarded. This step was repeated twice. 10 mL of STC solution was added, and was mixed evenly with a blunt gun head to fully suspend the protoplasts, and was centrifuged at 900 x g, 4°C for 10 min, and the supernatant was discarded. This step was repeated twice. 2 mL of STC solution was added, and was mixed evenly with a blunt gun head to fully suspend the protoplasts and dilute to 10 7 Protoplasts prepared under a microscope were as shown in Figure 2 Under a microscope, the mycelial cell wall treated with the cell wall enzyme solution was completely enzymolyzed to generate round protoplasts.
[0032] The expression plasmid pOEoripptl is introduced into the protoplast of G. fimbriatum by PEG-mediated transformation method. The transformation method is as follows: 160 μL of protoplast suspension, 100 μL of expression plasmid pOEoripptl, and 60 μL of 60% PEG6000 solution are mixed in a 2 mL centrifuge tube, and the plasmid and donor fragment are 10 μg respectively; the positive control group: 160 μL of protoplast suspension, 100 μL of STC solution, and 60 μL of 60% PEG6000 solution are mixed in a 2 mL centrifuge tube; the negative control group: 160 μL of protoplast suspension, 100 μL of STC solution, and 60 μL of 60% PEG6000 solution are mixed in a 2 mL centrifuge tube; the above mixed 2 mL centrifuge tubes are placed on ice, and are inverted and mixed every 10 min for 3 times, 1.5 mL of 60% PEG6000 solution is added, and is mixed by blowing, and is placed at room temperature for 25 min. 6 mL of soft agar MYG liquid medium containing 100 ng / μL of hygromycin resistance (MYG: maltose 5 g / L, yeast extract 5 g / L, glucose 10 g / L, sucrose 171 g / L, agar 20 g / L, solvent is water) is added to a 50 mL centrifuge tube, 3 mL of preheated STC solution and the above transformation system are mixed, and are poured into the same hygromycin concentration MYG hard agar medium; the above plate is transferred to a 28°C incubator, and is cultured vertically for 5 d, to obtain positive transformants.
[0033] Positive transformant re-screening: 10 positive transformant spots are picked up with a sterile toothpick and inoculated on PDA agar plates, and are cultured at 28°C for 3 d; part of the mycelium is picked up with a sterile toothpick and put into a 2 mL centrifuge tube containing 200 μL of lysozyme buffer, and is uniformly homogenized with a tissue grinder; the genomic DNA of the transformant is extracted by using TSINGKET SP501-50 high-purity plasmid DNA small-scale extraction kit, and the concentration is determined; the positive transformant genome is verified by PCR using verification primers YZpptlF and YZpptlR and sequencing Figure 3 ), and the genetically engineered strains of G. fimbriatum with high yield of gibberellins GA4 and GA7 are obtained, which are strains OE:pptl-1, 3, 4, and 5 respectively.
[0034] Gibberellic acid metabolism: Four positive transformants verified by rescreening on PDA agar plates, namely, the genetically engineered strains of Gibberellic acid fujikuraensis OE: ppt1-1, 3, 4, and 5 that produced high gibberellins GA4 and GA7, were shoveled into sterilized seed culture medium (seed culture medium: 20 g / L corn starch, 15 g / L sucrose, 15 g / L peanut powder, 3 g / L soybean meal, 1 g / L KH2PO4, 1 g / L MgSO4, and water as solvent) using a sterile inoculating spatula and incubated in a shaking incubator at 28°C and 250 rpm. After 2 days, the culture medium was transferred to fermentation medium (fermentation medium: corn starch 75 g / L, rice flour 87.5 g / L, soybean meal 5 g / L, peanut powder 5 g / L, KH2PO4 0.5 g / L, K2SO4 0.5 g / L, MgSO4·7H2O 0.11 g / L, and water as solvent). The inoculum size was 6% and the culture was carried out on a shaking table at 28°C and 250 rpm. After 7 days, the supernatant of the bacterial liquid was collected and the output of GA3, GA4 and GA7 was measured by high performance liquid chromatography after dilution. The results are shown in Table 1.
[0035] Comparative Example 1:
[0036] Wild-type Gibberella fujikurai was fermented and cultured under the same conditions as in Example 1. The supernatant of the bacterial solution was collected and diluted, and the production of GA3, GA4 and GA7 was determined by high performance liquid chromatography. The results are shown in Table 1.
[0037] Table 1. Gibberellic acid metabolism
[0038]
[0039] like Figure 3 As shown, among all 10 positive transformants, the GA3 production of OE:ppt1-1, 3, 4, and 5 was 0, while the GA4 and GA7 production increased significantly. 4+7 The mixture had the highest yield, reaching 934.5 mg / L, which was 36 times that of the wild-type Gibberella fujikura (Comparative Example 1), and the GA4 yield reached 147 mg / L, and the GA7 yield reached 787.5 mg / L.
[0040] Primer Table
[0041] F1: CACTTAACGTTACTGAAATC
[0042] R1:ATCTGGTGCACTCTCAGTACA
[0043] F2: GAGAGTGCACCAGATGCGGAGGTTTCATGGCCATA
[0044] R2: CAGTAACGTTAAGTGTCATGGTTTGGATGCCTGTTC
[0045] YZPPT1F: GTACTGAGAGTGCACCAGAT
[0046] YZPPT1R: TATATCCAGATTCGTCAAGCTG
[0047] The above-described embodiments are merely intended to describe the preferred embodiments of the present application, but not to limit the scope of the present application. Various changes and modifications of the present application, which are apparent to those skilled in the art, can be made without departing from the spirit and scope of the present application.
Claims
1. Use of a ppt1 gene for increasing gibberellins GA4 and / or GA7 production in filamentous fungi, characterized in that, The filamentous fungus is Gibberella fujikuroi, and the nucleotide sequence of the ppt1 gene is shown as SEQ ID NO.
1.
2. Use according to claim 1, characterized in that, The application provides a method for transforming the ppt1 expression frame into a filamentous fungus for expression.
3. Use according to claim 2, characterized in that, The ppt1 expression frame comprises a promoter, a ppt1 gene and a terminator.
4. Use according to claim 3, characterized in that, The nucleotide sequence of the ppt1 expression frame is shown as SEQ ID NO.
2.
5. A genetically engineered fungus of Gibberella fujikuroi for producing gibberellins GA4 and GA7, characterized by, The ppt1 expression frame is constructed into an expression vector and then transformed into Gibberella fujikuroi, and the nucleotide sequence of the ppt1 gene is shown as SEQ ID NO.
1.
6. The genetically engineered Gibberella fujikuroi of claim 5, wherein, The expression vector further comprises a resistance screening gene.
7. The genetically engineered Gibberella fujikuroi of claim 6, wherein the genetically engineered Gibberella fujikuroi is characterized by, The resistance screening gene comprises a hygromycin resistance gene.
8. A method for increasing production of gibberellins GA4 and GA7 by Gibberella fujikuroi by overexpressing the pptl gene, characterized in that, The method comprises the following steps: constructing the ppt1 expression frame into an expression vector and then transforming the expression vector into Gibberella fujikuroi protoplast to obtain transformants, taking hygromycin resistance as a screening marker, and fermenting and culturing the obtained positive transformants to synthesize GA4 and GA7; and the nucleotide sequence of the ppt1 gene is shown as SEQ ID NO. 1.
Citation Information
Patent Citations
Application of ppt1 gene as selection marker in auxotroph screening
CN117070538A
Application of transmembrane transport protein in increasing yield of microbial gibberellin
CN119490574A