Spatial indexing and library preparation of genetic material using hydrogel beads and flow cells

Abstract

Embodiments of a method for seeding a sequence library on a surface of a sequencing flow cell are provided, which allows spatial isolation of the library on the surface. Spatial isolation can be used to index sequence readout from each sequencing library to improve the efficiency of subsequent data analysis. In some examples, hydrogel beads containing an encapsulated sequencing library are captured in a sequencing flow cell and degraded in the presence of a liquid diffusion barrier to allow the sequencing library to be spatially isolated and seeded on the surface of the flow cell. Additionally, examples of systems, methods, and compositions related to flow cell devices configured for nucleic acid library preparation and single cell sequencing are provided. Some examples include a flow cell device having a hydrogel containing genetic material therein and retaining it within the hydrogel during nucleic acid processing.

Description

[0001] This application is a divisional application of the patent application with application number 201880044550.X and invention name “Spatial indexing and library preparation of genetic material using hydrogel beads and flow pools”.

[0002] Related Applications

[0003] This patent application claims priority to U.S. Provisional Patent Application No. 62 / 663,129 filed on April 26, 2018 and U.S. Provisional Patent Application No. 62 / 539,949 filed on August 1, 2017, the entire contents of which are incorporated herein by reference. Background Art

[0004] Sequencing by synthesis (SBS) technology provides high-quality sequencing data. However, SBS methods can be limited by the length of sequence reads, as in some cases, the length of SBS sequencing reads does not exceed 300 nucleotides. The short read lengths of SBS technology can involve extensive data analysis to align and reconstruct long nucleic acid sequences from multiple overlapping short sequence reads generated during the SBS procedure. Pre-sequencing steps (such as barcoding of specific nucleic acid molecules) can simplify data analysis but also increase the complexity of SBS methods. Summary of the invention

[0005] Provided herein is an example of a method for seeding a sequencing library produced by genetic material (e.g., a target nucleic acid molecule or a cell or cell lysate containing a target nucleic acid molecule) on a sequencing flow cell, which allows spatial isolation of each library on a flow cell. Spatial isolation can be used to index the sequence reads from each sequencing library to improve the efficiency of subsequent data analysis. This "spatial index" of a sequencing library allows simplification of the processing and sequence reconstruction of the genetic material from which the sequencing library is produced. In other improvements, the disclosed method can reduce and in some cases even eliminate the need for cumbersome barcode steps for identifying sequence reads related to specific genetic material. The examples described herein also increase the data resolution for sequencing of target nucleic acid molecules, and further simplify the assembly of genomes (e.g., for new organisms), and provide improved identification of rare genetic variations and mutation co-occurrences in target nucleic acid molecules.

[0006] In some examples, a method is provided, which includes loading degradable hydrogel beads onto a sequencing flow cell under conditions sufficient to capture the hydrogel beads on the surface of the sequencing flow cell. In some examples, the degradable hydrogel beads contain a sequencing library prepared from encapsulated genetic material. In some examples, the degradable hydrogel beads contain encapsulated genetic material, and the method further includes preparing a sequencing library from the genetic material in the captured degradable hydrogel beads. A liquid diffusion barrier surrounding the captured hydrogel beads is then loaded onto the sequencing flow cell, and the captured hydrogel beads are degraded in the presence of the liquid diffusion barrier to allow the sequencing library to be transported and seeded onto the surface of the sequencing flow cell.

[0007] The genetic material can be, for example, a target nucleic acid molecule, such as genomic DNA (eg, human genomic DNA), as well as cells and cell lysates containing the target nucleic acid molecule.

[0008] In some examples, the sequencing library comprises DNA or RNA that is at least 150 nucleotides in length.

[0009] In some examples, the liquid diffusion barrier is an oil, such as mineral oil, silicone oil or perfluorinated oil, or a combination of two or more thereof. In some examples, the liquid diffusion barrier is a viscous aqueous solution, such as containing polyethylene glycol (PEG), polyvinyl pyrrolidone, pluronic dextran, sucrose, poly (N-isopropylacrylamide) or polyethylene oxide-polypropylene oxide-polyethylene oxide (PEO-PPO-PEO) / hectorite, or a combination of two or more thereof.

[0010] In some examples, the degradable hydrogel beads are degraded by one or more of the following: (a) contacting with a reagent that is a shear-reversible cross-linker that cross-links polymers of the hydrogel (e.g., dithiothreitol (DTT), tris(2-carboxyethyl)phosphine (TCEP), tris(3-hydroxypropyl)phosphine (THP), or a combination of two or more); (b) heating to about 90° C.; and (c) exposing the hydrogel beads to light of a wavelength of a shear-reversible cross-linker that cross-links polymers of the hydrogel.

[0011] In some examples, the hydrogel beads have a diameter of about 5 μm to about 120 μm.

[0012] In some examples, the hydrogel bead is a hollow hydrogel bead comprising a hollow core that houses genetic material.

[0013] The hydrogel beads contain pores of a diameter size large enough to allow reagents to diffuse through the beads while retaining encapsulated genetic material and sequencing libraries in the hydrogel beads. In some examples, the diameter of the pores is about 10 nm to about 100 nm.

[0014] In some examples, preparing the sequencing library includes performing a tagging reaction on the target nucleic acid molecules encapsulated in the hydrogel beads. For example, the tagging reaction can be performed when the hydrogel beads are captured on the sequencing flow cell or before the hydrogel beads are loaded on the sequencing flow cell. In some examples, the tagging reaction includes contacting the target nucleic acid molecules with a transposase mixture comprising an adapter sequence and a transposome.

[0015] In some examples, capture of hydrogel beads on the surface of the sequencing flow cell includes one or more of: physical confinement of the hydrogel beads on the surface of the sequencing flow cell; and specific binding of the first member of the specific binding pair on the hydrogel beads to the second member of the specific binding pair on the surface of the sequencing flow cell (e.g., located at the hole of the patterned flow cell). In some examples, the diameter of the hydrogel beads is about 5% to about 30% greater than the height of the flow cell to physically confine the beads in the flow cell. In some examples, the sequencing flow cell is a patterned flow cell, and the second member of the specific binding pair is located at the hole of the patterned flow cell.

[0016] In some examples of the disclosed methods, the diameter of the hydrogel bead is about 110 μm, and the height of the sequencing flow cell is about 100 μm.

[0017] Some examples of the disclosed methods further include: amplifying the target nucleic acid molecule encapsulated with the degradable hydrogel beads. In some examples, the amplification involves multiple displacement amplification. In some examples, the encapsulated target nucleic acid molecule is genomic DNA, and the amplification involves whole genome amplification.

[0018] In some examples, the sequencing library is not barcoded to identify individual hydrogel beads. In some examples, the method further includes sequencing the sequencing library seeded on the surface of the flow cell. In some examples, the position of the sequencing library seeded from the corresponding degradable hydrogel bead on the surface of the flow cell is used as a spatial index for reads generated by sequencing the sequence library.

[0019] In addition, examples of systems, methods, and compositions related to flow cell devices configured for nucleic acid library preparation and for single-cell sequencing are provided herein. In some examples, the flow cell device includes a solid support comprising a surface having a degradable hydrogel deposited thereon. In some examples, the degradable hydrogel includes holes, the size of which is set to allow reagents to diffuse through the hydrogel, but too small to allow genetic material to pass through the holes. Some examples provided herein relate to systems, such as systems for single-cell sequencing. In some examples, the system includes: a station configured to hold a flow cell device as described herein, the flow cell device including a solid support comprising a surface having a degradable hydrogel deposited thereon; the flow cell device itself; and a detector for obtaining sequencing data. Some examples provided herein relate to methods for preparing a nucleic acid library on a flow cell device. In some examples, the method includes: providing a flow cell device as described herein, the device including a solid phase support comprising a surface having a degradable hydrogel deposited thereon; separating nucleic acids from genetic material in the hydrogel; and, preparing a nucleic acid library from the separated nucleic acids.

[0020] It should be appreciated that all combinations of the foregoing concepts and additional concepts discussed in greater detail below (provided such concepts are not mutually inconsistent) are contemplated as being part of the inventive subject matter disclosed herein.

[0021] The foregoing and other features and advantages of the present disclosure will become more apparent from the following detailed description of several examples with reference to the accompanying drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 is a schematic diagram of an example of a disclosed method for seeding a sequencing library generated from genetic material (eg, a target nucleic acid molecule, such as genomic deoxyribonucleic acid (DNA)) on a sequencing flow cell and sequencing the sequencing library.

[0023] Figure 2A and 2B is a flow chart of an example of the disclosed method for seeding a sequencing library generated from genetic material (eg, a target nucleic acid molecule, such as genomic DNA) onto a sequencing flow cell.

[0024] Figures 3A-3D is a schematic diagram and micrograph showing the creation and loading of hydrogel beads containing genetic material onto a sequencing flow cell. ( Figure 3A ) A solution of target nucleic acid molecules mixed with polymer precursors is loaded into a sample container of a droplet generator cartridge, the cartridge is loaded onto a droplet generator, and processed to generate droplets containing polymer precursors of target nucleic acid molecules. Figure 3B) Photomicrograph of hydrogel beads containing encapsulated target nucleic acid molecules. In this example, the beads have an average diameter of about 120 μm. The hydrogel beads are formed by exposing droplets prepared using a droplet generator to a free radical initiator dissolved in oil, or by exposing the droplets to UV radiation using a UV free radical initiator. ( Figure 3C ) Illustration and micrograph of hydrogel beads captured on a sequencing flow cell. In this example, the beads have an average diameter of approximately 120 μm and are loaded onto a sequencing flow cell where they are captured due to physical confinement in a 100 μm high flow cell channel. ( Figure 3D ) Insert the sequencing flow cell into the SBS sequencer for further processing and sequencing.

[0025] Figures 4A-4C is a schematic diagram and micrographs showing on-bead sequencing library preparation and flow cell seeding. ( Figure 4A ) shows a schematic diagram of hydrogel beads containing encapsulated target nucleic acid molecules captured on a sequencing flow cell. In this example, the beads have an average diameter of about 120 μm and are loaded onto a sequencing flow cell where they are captured due to physical confinement in a 100 μm high flow cell channel. The pore size of the captured hydrogel beads allows diffusion of enzymes, chemicals, and smaller sized oligonucleotides (e.g., less than 50 base pairs), but retains larger sized nucleic acid molecules (e.g., greater than 300 base pairs). ( Figure 4B ) shows a schematic diagram of preparing a sequencing library from a target DNA bead encapsulated in a hydrogel bead. A library preparation solution containing enzymes and reagents for preparing a sequencing library from a target nucleic acid molecule is loaded into a flow cell to prepare a sequencing library in a hydrogel bead. In this example, sequencing library preparation is performed by a tagmentation assay. ( Figure 4C ) schematic diagram and micrograph, which shows the liquid diffusion barrier loaded onto the sequencing flow cell to fill the void volume between the beads and surround the captured hydrogel beads containing the sequencing library. In this example, the liquid diffusion barrier is mineral oil. The flow cell is then heated to degrade the hydrogel beads and allow the sequencing library to be transported to the surface of the flow cell that captures the sequencing library. In another example, instead of or in addition to heating the beads, mineral oil containing a sufficient concentration of DTT to depolymerize the beads and release the library can also be used. In several embodiments, the flow cell is heated before seeding to denature the library. The presence of mineral oil inhibits the diffusion of the sequencing library beyond the diameter of the hydrogel beads. Therefore, in the presence of oil, seeding occurs at the imprint close to each hydrogel bead (based on the hydrogel beads of 120 μm diameter, the library seeding is limited to about 120 μm diameter area).

[0026] Figures 5A-5C Schematic diagram depicting three different workflows for nucleic acid molecule sequencing.

[0027] Figure 6Depicted are sequencing results of a flow cell seeded with hydrogel beads housing human genomic DNA with a fragment size of -100 kb, with -100 fragments per bead.

[0028] Figure 7 Depicted are sequencing results of a flow cell seeded with hydrogel beads housing human genomic DNA with a fragment size of ~100 kb with ~50 fragments per bead. Genomic DNA in the hydrogel beads was amplified by MDA amplification prior to flow cell capture and in-bead library generation.

[0029] Figure 8 Depicted are sequencing results of a flow cell seeded with hydrogel beads housing human genomic DNA with a fragment size of ~10 kb with ~100 fragments per bead. Genomic DNA in the hydrogel beads was amplified by MDA amplification prior to flow cell capture and in-bead library generation.

[0030] Figures 9A-9C A schematic diagram is depicted ( Fig.9A ) and a set of micrographs ( Fig. 9B and 9C ), which illustrates hollow hydrogel beads used in the disclosed examples. Fig.9A A schematic diagram illustrating the construction of a hollow hydrogel bead is provided. First, an inner hydrogel layer (core) is formed to accommodate an encapsulated sample (e.g., genetic material, such as a cell or a target nucleic acid molecule). The core is then encapsulated with an outer hydrogel layer (shell). The inner hydrogel layer is then depolymerized using a reagent that does not depolymerize the outer hydrogel layer, thereby leaving the outer hydrogel layer with a hollow space containing genetic material.

[0031] Figures 10A-10C A schematic diagram showing an example workflow ( Fig. 10A )、island size distribution diagram( Fig. 10B ) and island maps ( Fig. 10C ), which uses cell lysate input to generate hydrogel beads that house genetic material.

[0032] Fig.11 Shown is an image generated from superimposed hydrogel DNA spots of two different samples processed using a sequential seeding strategy (each with a different DNA barcode introduced during the tagmentation step). Clustered spots from the first sample are marked with an asterisk (*); spots from the second sample are not marked.

[0033] Fig. 12A and 12BA set of micrographs is shown, which shows that the intergranular spaces between the hydrogel bead clusters are seeded with a standard short read library to maximize the utilization of the flow cell. The micrographs are before and after the intergranular spaces between the hydrogel bead clusters from the hydrogel beads are seeded with a standard short read library to maximize the utilization of the flow cell ( Fig. 12A ) and after ( Fig. 12B ), using libraries seeded with hydrogel beads for spatial indexing.

[0034] Fig.13A and 13B A schematic overview according to one example of a method for preparing a nucleic acid library is depicted. Fig.13A Steps (a)-(d) for preparing a gel matrix containing cellular or genomic DNA on a flow cell surface are shown. Fig. 13B Describes the use of Figure 1 The steps (a)-(e) of preparing a nucleic acid library on the surface of a flow cell.

[0035] Figures 14A-14F A schematic representation of hydrogel bead capture within a flow cell is depicted. Figures 14A-14C In , hydrogel beads are shown captured in a flow cell and used for downstream assays using different reagents. Fig.14D In Figure 1, a sample of DNA fragments is shown trapped within a hydrogel for use in flow library preparation. Fig.14E In , the microbiome is shown to be entrapped within a hydrogel for use in flow library preparation. Fig.14F In , mammalian cells are shown entrapped within hydrogel beads for library preparation on a flow cell.

[0036] Figures 15A-15C An example of a patterned surface capturing hydrogel beads is depicted. Fig.15A A cross-sectional view showing the structure of hydrogel beads captured on a microarray-patterned flow cell. Fig. 15B is a bright-field image of a rehydrated gel bead located on and in the center of a patterned well. Fig. 15C is an image showing fluorescence imaging of rehydrated hydrogel beads in the wells. The scale bar is 50 μm.

[0037] Figures 16A-16C Depicted is the hydration of a hydrogel bead in one example described herein. Fig.16A In the figure, the hydrogel beads are shown to be dehydrated and their initial size is about 70 μm in diameter. Fig. 16B In, from Fig.16A The beads are partially hydrated and begin to grow. Fig. 16C In the figure, the beads are fully hydrated with a diameter of approximately 105 μm. Scale bar is 200 μm.

[0038] Fig.17Micrographs of reversible hydrogel beads of 10-100 μm size are shown, illustrating the release of encapsulated genetic material from the hydrogel beads. Reversible hydrogel beads with dye-stained bacteria are degraded upon contact with a reducing agent, resulting in bacterial release. Each image is 300 μm x 225 μm.

[0039] Figures 18A-18B Depicted are experimental results of flow cell library preparation and cluster generation using chemically decomposable hydrogel beads. Fig.18A In the figure, the hydrogel beads in the oil appear to be fused together. Fig.18B In the figure, the derivatives are shown. Fig.18A Clusters of amplified DNA fragments on the hydrogel beads shown in. Scale bar is 100 μm.

[0040] Figures 19A-19B Depicted is the fluorescence imaging of a hydrogel containing stained human gDNA ( Fig.19A ) and the cluster gradient density of the seeded amplified DNA ( Fig.19B ). The scale bar is 100 μm.

[0041] Figures 20A-20B Sequencing results of human gDNA prepared and sequenced on a flow cell device are provided. Fig. 20A is the overall Q score of the reads from the first experiment. Fig. 20B Mismatch rates from the same experiment are shown.

[0042] Figures 21A-21D Depicted are examples of flow cell library preparation and cluster generation and release of DNA libraries from hydrogel beads as visualized with SYTOX intercalator dye. Fig.21A is a schematic diagram of an example of library preparation. Fig. 21B is a micrograph showing DNA of sheared bacterial cells in hydrogel beads stained with SYTOX intercalator dye. Fig. 21C is a micrograph of hydrogel beads during the release of DNA from the hydrogel beads. Fig.21D is a micrograph of a DNA library seeded and accumulated on the flow cell surface, as shown by staining with SYTOX intercalator dye. Scale bar is 100 μm. DETAILED DESCRIPTION

[0043] Provided herein is an example of a method for seeding multiple sequence libraries on a sequencing flow cell, the method allowing spatial isolation of multiple libraries. Spatial isolation can be used to index sequence reads from each sequencing library to improve the efficiency of subsequent data analysis.

[0044] Additional embodiments relate to devices, systems, and methods for preparing nucleic acid libraries on a flow cell device. For example, a flow cell device can include a hydrogel containing genetic material, wherein the hydrogel can be configured to retain the genetic material while allowing reagents, enzymes, chemicals, and primers of a smaller size of less than about 50 base pairs to pass through the hydrogel.

[0045] In some examples of standard sample preparation methods, each template contains a linker at either end of the insert, and often several steps are used to modify both the nucleic acid and the desired product of the modification reaction. These steps are performed in solution, and the adapted fragments are then added to a flow cell where they are coupled to a surface by a primer extension reaction that replicates the hybridized fragments onto the ends of primers covalently attached to the surface. These seeded templates then generate monoclonal clusters of replicated templates through several amplification cycles.

[0046] By using transposase-mediated fragmentation and tagging, the number of steps involved in converting nucleic acids into adapter-modified templates in solution to prepare for cluster formation and sequencing can be reduced, or in some cases even minimized. This process is referred to as "tagmentation" in this article and involves the modification of nucleic acids by a transposase-containing transposome complex that is complexed with an adapter containing a transposon end sequence. Tagmentation may simultaneously result in the fragmentation of DNA and the connection of the 5' ends of the two chains of the double-stranded fragment to the adapter. In one example, after a purification step to remove the transposase, additional sequences are added to the ends of the adapted fragments by PCR. In some cases, solution-based tagging has disadvantages and may involve multiple labor-intensive steps. In addition, deviations may be introduced during the PCR amplification step.

[0047] The equipment, system and method proposed herein overcome these shortcomings, and allow unbiased sample preparation, cluster formation and sequencing on a single solid support, while minimizing the requirements for sample manipulation or transfer, and also allow different genetic materials to be sequenced, such as single-cell sequencing on a solid support. In some embodiments, the spatial index of the sequencing library allows simplified processing and sequence reconstruction (such as by reducing the need for barcode steps) of the genetic material (such as target nucleic acid molecules) from which the sequencing library is produced. The embodiments described herein also improve the data resolution for sequencing of target nucleic acid molecules, and further simplify the assembly of genomes (such as for new organisms), and provide improved recognition of the co-occurrence of mutations in rare gene variations and target nucleic acid molecules.

[0048] I. Terminology Summary

[0049] Unless otherwise indicated, technical terms are used according to conventional usage. As used herein, the singular forms "a", "an" and "the" refer to both the singular and the plural, unless the context clearly indicates otherwise. As used herein, the term "comprising" is synonymous with "including", "containing" or "characterized by", and is inclusive or open, and does not exclude other undescribed elements or method steps. Although many methods and materials similar or equivalent to those described herein can be used, specific suitable methods and materials are described herein. Unless the context indicates otherwise, the reference to the numerical range of endpoints includes all numbers contained in the range (e.g., 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc.).

[0050] Throughout the specification, references to "one example", "example", "certain examples" or "some examples" etc. mean that a particular feature, configuration, composition or characteristic described in conjunction with the example is included in at least one example of the present disclosure. Therefore, the appearance of these phrases in various places throughout the specification does not necessarily refer to the same example of the present disclosure.

[0051] In the present disclosure, reference is made to the accompanying drawings which form a part thereof. In the accompanying drawings, similar symbols identify similar components unless the context indicates otherwise. The illustrative examples described in the specific specification, drawings, and claims are not meant to be limiting. Other examples may be utilized, and other changes may be made, without departing from the spirit or scope of the subject matter presented herein. It will be readily understood that the various aspects of the present disclosure as generally described herein and shown in the accompanying drawings may be arranged, replaced, combined, separated, and designed in a variety of different configurations, all of which are expressly contemplated herein.

[0052] For any method disclosed herein that includes discrete steps, the steps may be performed in any feasible order. Also, any combination of two or more steps may be performed simultaneously, as appropriate. Furthermore, in one or more examples, specific features, configurations, compositions, or characteristics may be combined in any suitable manner.

[0053] In the event of a conflict, the present specification (including term explanations) shall prevail. To facilitate the review of the examples, the following term explanations are provided:

[0054] Adapter: A linear oligonucleotide that can be fused to a nucleic acid molecule by, for example, connection or labeling. In some examples, the adapter is substantially not complementary to the 3' end or 5' end of any target sequence present in the sample. In some examples, a suitable adapter length is within the range of about 10-100 nucleotides, about 12-60 nucleotides, or about 15-50 nucleotides. Typically, the adapter can include any combination of nucleotides and / or nucleic acids. In some aspects, the adapter can include one or more cleavable groups at one or more positions. On the other hand, the adapter can include a sequence complementary to at least a portion of a primer, such as a primer comprising a universal nucleotide sequence, such as a P5 or P7 sequence. In some examples, the adapter can include a barcode (also referred to herein as a label or index) to assist downstream error correction, identification, or sequencing. The terms "adapter" and "adaptor" are used interchangeably.

[0055] In some examples, the linker can be modified to prevent the formation of concatemers, for example by adding a blocking group that prevents extension of the linker at one or both ends. Examples of 3' blocking groups include 3'-spacer C3, dideoxynucleotides, and attachment to a substrate. Examples of 5' blocking groups include dephosphorylated 5' nucleotides, and attachment to a substrate.

[0056] In some examples, the joint can include a spacer polynucleotide, and its length can be 1 to 20 nucleotides, for example 1 to 15 or 1 to 10 nucleotides, for example 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleotides. In some examples, the spacer includes 10 nucleotides. In some examples, the spacer is a poly-T spacer, for example a 10T spacer. The spacer nucleotide can be included in the 5' end of the polynucleotide, which can be attached to a suitable carrier by attachment with the 5' end of the polynucleotide. Attachment can be achieved by sulfur-containing nucleophiles present in the 5' end of the polynucleotide, for example thiophosphate. In some examples, the polynucleotide will include poly-T spacers and 5' thiophosphate groups.

[0057] Amplify, amplifying, and amplification: an action or process by which at least a portion of a nucleic acid molecule is replicated or copied into at least one other nucleic acid molecule. In some examples, such amplification can be performed using isothermal conditions; in other examples, such amplification can include thermal cycling. In some examples, the amplification is a multiplex amplification, which includes amplifying multiple target sequences simultaneously in a single amplification reaction. Non-limiting examples of amplification reactions include polymerase chain reaction (PCR), ligase chain reaction, strand displacement amplification reaction (SDA), rolling circle amplification reaction (RCA), multiple annealing and circularization-based amplification cycles (MALBAC), transcription-mediated amplification (TMA) methods (e.g., NASBA), loop-mediated amplification methods (e.g., "LAMP" amplification using loop-forming sequences). The nucleic acid molecule being amplified can be DNA comprising DNA or ribonucleic acid (RNA), or a mixture of DNA and RNA (including modified DNA and / or RNA), or DNA consisting of the above, or derived from the above. The products produced by amplification of one or more nucleic acid molecules (e.g., "amplification products" or "amplicons") can be DNA or RNA, or a mixture of DNA and RNA nucleosides or nucleotides, regardless of whether the starting nucleic acid is DNA, RNA, or both, or they can contain modified DNA or RNA nucleosides or nucleotides. "Copies" do not necessarily mean perfect sequence complementarity or identity to the target sequence. For example, copies can include nucleotide analogs (e.g., deoxyinosine or deoxyuridine), intentional sequence changes (e.g., sequence changes introduced by primers that can hybridize to the target sequence but are not complementary), and / or sequence errors that occur during the amplification process.

[0058] Several examples include solid phase amplification, which is an amplification reaction performed on or in conjunction with a solid support such that all or part of the amplification product is immobilized on the solid support as it is formed. Non-limiting examples of solid phase amplification include solid phase polymerase chain reaction (solid phase PCR) and solid phase isothermal amplification, which is a reaction similar to standard solution phase amplification except that one or both of the forward and reverse amplification primers are immobilized on a solid support.

[0059] Amplification site: A site on the surface of a sequencing flow cell where one or more amplicon of an amplification reaction can be generated. An amplification site can be further configured to capture, retain or attach to at least one amplicon generated at the site.

[0060] Array: A group of multiple sites that can be distinguished from each other based on relative position. Different molecules located at different sites of the array can be distinguished from each other based on the position of the site in the array. A single site of an array may include one or more molecules of a specific type. For example, a site may include a single target nucleic acid molecule with a specific sequence, or a site may include several nucleic acid molecules with the same sequence (and / or its complementary sequence). The sites of an array may be different features located on the same substrate. Example features include, but are not limited to, holes in a substrate, beads (or other particles) in or on a substrate, protrusions of a substrate, ridges on a substrate, or channels in a substrate. The sites of an array may be separate substrates each with different molecules. Different molecules attached to separate substrates can be identified based on the position on the surface to which the substrate is bound, or based on the position of the substrate in a liquid or gel. Example arrays in which separate substrates are located on the surface include, but are not limited to, those arrays with beads in holes.

[0061] Capture: Immobilization of target entities (e.g., hydrogel beads) on a target surface (e.g., flow cell surface). Capture sites are sites on the surface of a sequencing flow cell where one or more hydrogel beads or adapted fragments of a target nucleic acid molecule can be captured.

[0062] Capture agent: A material, chemical substance, molecule or part thereof that is capable of attaching, retaining or binding to a target molecule (e.g., a target nucleic acid). Example capture agents include, but are not limited to, capture nucleic acids (also referred to herein as capture oligonucleotides) that are complementary to at least a portion of a target nucleic acid, members of a receptor-ligand binding pair (e.g., avidin, streptavidin, biotin, lectins, carbohydrates, nucleic acid binding proteins, epitopes, antibodies, etc.), chemicals that are capable of binding to a target nucleic acid (or a linking portion attached thereto), or that are capable of forming a covalent bond with a target nucleic acid (or a linking portion attached thereto).

[0063] Hydrogel and hydrogel beads: A colloidal gel formed from an organic polymer (natural or synthetic) that is cross-linked by covalent, ionic, or hydrogen bonds to form a three-dimensional open lattice structure that captures water molecules to form a gel. In several examples, the hydrogel beads are spherical, although other shapes are possible. In some examples, the hydrogels and hydrogel beads used in the disclosed methods include 60-90% fluid (e.g., water) and 10-30% polymer. In certain examples, the water content of the hydrogel or hydrogel beads is about 70-80%.

[0064] Biocompatible hydrogels or hydrogel beads are hydrogels or hydrogel beads that are non-toxic to living cells and can allow sufficient diffusion of oxygen and nutrients into the captured cells to maintain viability.

[0065] Degradable hydrogels or hydrogel beads are hydrogels or hydrogel beads that can be selectively depolymerized. Depolymerization reduces or destroys the lattice structure of the hydrogel, which increases the porosity to the extent that large nucleic acid molecules (e.g., greater than 1 kb) can diffuse through the hydrogel. The degradation time is a function of the polymer composition and morphology.

[0066] Hydrogel Porosity: The fractional volume of a hydrogel that is composed of open spaces (e.g., pores or other openings) (dimensionless). Porosity is thus a measure of the void space in a material, expressed as a percentage between 0 and 100% (or a fraction between 0 and 1). In some examples, the porosity of a hydrogel may be in the range of about 50% to about 99%, about 75% to about 99%, or about 80% to about 95%.

[0067] Index: A nucleotide sequence that can be used as a molecular identifier and / or barcode to tag nucleic acids, and / or identify the source of nucleic acids. In some examples, an index can be used to identify a single nucleic acid or a subpopulation of nucleic acids.

[0068] Liquid diffusion barrier: a liquid in which the polynucleotides are hardly solvated. The sequencing libraries disclosed herein are poorly soluble in liquid diffusion barriers. In a non-limiting example, the liquid diffusion barrier is an oil, such as mineral oil. Other liquid diffusion barriers include viscous solutions that hinder the diffusion of DNA libraries, such as buffers containing polymers, such as polyethylene glycol (PEG), polyvinyl pyrrolidone, pluronic dextran, sucrose, etc. The liquid diffusion barrier can also be a temperature-responsive gel, in which it is a non-viscous solution at non-seeding temperatures, and becomes a gel after being heated to seeding conditions and forms a barrier for DNA diffusion. Examples include poly (N-isopropylacrylamide) and polyethylene oxide-polypropylene oxide-polyethylene oxide (PEO-PPO-PEO) / lithium bentonite nanoparticle complexes.

[0069] Nucleic acid molecule: a polymeric form of nucleotides of any length, and may include ribonucleotides, deoxyribonucleotides, analogs thereof, or mixtures thereof. The term should be understood to include analogs of DNA or RNA made from nucleotide analogs as equivalents, and is applicable to single-stranded (e.g., sense or antisense) and double-stranded polynucleotides. The term used herein also encompasses cDNA, which is a complementary or replicating DNA produced by an RNA template, such as by the action of a reverse transcriptase. The term refers only to the primary structure of the molecule. Therefore, the term includes triple-stranded, double-stranded, and single-stranded DNA, as well as triple-stranded, double-stranded, and single-stranded RNA. The terms nucleic acid molecule and polynucleotide are used interchangeably herein.

[0070] When used in reference to nucleic acid molecules, the term "target" in the context of the methods described herein is intended as a semantic identifier for the nucleic acid and does not necessarily limit the structure or function of the nucleic acid unless explicitly stated.

[0071] Nucleotides in nucleic acid molecules can include naturally occurring nucleic acids and functional analogs thereof. Particularly useful functional analogs can hybridize with nucleic acids in a sequence-specific manner, or can be used as templates for replicating specific nucleotide sequences. Naturally occurring nucleic acids typically have a backbone comprising a phosphodiester bond. Analog structures can have alternative backbone connections, including various backbones known in the art. Naturally occurring nucleic acids typically have deoxyribose (e.g., found in DNA) or ribose (e.g., found in RNA). Nucleic acids can include any of a variety of analogs of these sugar moieties known in the art. Nucleic acids can include natural or non-natural bases. In this regard, natural DNA can have one or more bases selected from adenine, thymine, cytosine, or guanine, while ribonucleic acids can have one or more bases selected from adenine, uracil, cytosine, or guanine. Useful non-natural bases that can be included in nucleic acids are known in the art. Examples of non-natural bases include locked nucleic acids (LNA) and bridged nucleic acids (BNA). LNA and BNA bases can be integrated into DNA oligonucleotides and increase the intensity and specificity of oligonucleotide hybridization.

[0072] P5 and P7: When referring to a universal P5 or P7 sequence, or a P5 or P7 primer for capture and / or amplification purposes, P5 and P7 may be used. P5' and P7' represent the complementary sequences of P5 and P7, respectively. It will be understood that any suitable universal sequence may be used in the methods presented herein, and the use of P5 and P7 is merely exemplary. In some examples, the P5 sequence comprises the sequence defined by SEQ ID NO: 1 (AATGATACGGCGACCACCGA), and the P7 sequence comprises the sequence defined by SEQ ID NO: 2 (CAAGCAGAAGAGACGGCATACGA). The disclosures of WO2007 / 010251, WO2006 / 064199, WO2005 / 065814, WO2015 / 106941, WO1998 / 044151 and WO2000 / 018957 illustrate non-limiting uses of P5 and P7 or their complements on flow cells, the entire contents of which are incorporated herein by reference in their entirety.

[0073] Primer: A nucleic acid molecule that can hybridize to a target sequence. In some embodiments, a primer is used as a substrate on which nucleotides can be polymerized by a polymerase. However, in some examples, a primer can be incorporated into a synthetic nucleic acid strand and provide a site to which another primer can hybridize to initiate primer synthesis of a new strand complementary to the synthetic nucleic acid molecule. A primer can include any combination of nucleotides or their analogs. In some examples, a primer is a single-stranded oligonucleotide or polynucleotide.

[0074] Reactants: A reagent or a mixture of two or more reagents that can be used to react, interact, dilute or add to a sample, and may include, for example, reagents used in nucleic acid amplification, labeling and sequencing reactions, including, for example, buffers, chemical reagents, enzymes, polymerases, primers less than 50 base pairs in size, template nucleic acids, nucleotides, markers, dyes or nucleases. In some examples, the reactants include lysozyme, proteinase K, random hexamer, polymerase (e.g., Φ29 DNA polymerase, Taq polymerase, Bsu polymerase), transposase (e.g., Tn5), primers (e.g., P5 and P7 adapter sequences), ligases, catalytic enzymes, triphosphate deoxynucleotides, buffers or divalent cations. In some examples, the reactants may include lysing agents, nucleic acid purification agents, DNA amplifiers, labeling agents, PCR agents or other reagents used for genetic material processing.

[0075] Seeding the sequencing library: Adapted fragments of the target nucleic acid molecule are immobilized on a solid support in a sequencing flow cell.

[0076] Sequencing flow cell: A chamber comprising a surface over which one or more fluid reactants can flow and on which adapted fragments of a sequencing library can be transported and bound. Non-limiting examples of sequencing flow cells and associated fluid systems and detection platforms that can be readily used in the methods of the present disclosure are described, for example, in Bentley et al., Nature 456:53-59 (2008); WO04 / 018497; US7,057,026; WO91 / 06678; WO07 / 123744; 7,329,492; US7,211,414; US7,315,019; US7,405,281 and US2008 / 0108082, the entire contents of which are incorporated herein by reference.

[0077] The sequencing flow cell includes a solid support having a surface on which a sequencing library is combined. In some examples, the surface includes a flat plateau of capture nucleotides, which can be combined with the adaptation fragments of the sequencing library. In some examples, the surface is a patterned surface. "Patterned surface" refers to the arrangement (e.g., array) of different regions (e.g., amplification sites) in or on the exposed surface of a solid support. For example, one or more regions can be features in which one or more amplification and / or capture primers are present. The features can be separated by gap regions where primers are not present. In some examples, the pattern can be an xy format of features in rows and columns. In some examples, the pattern can be a repeated arrangement of features and / or gap regions. In some examples, the pattern can be a random arrangement of features and / or gap regions. In some examples, the surface is a patterned surface, which includes an array of holes with capture and / or amplification nucleotides combined with the adaptation fragments of the sequencing library, and capture and / or amplification nucleotides are lacking in the gap regions between the holes.

[0078] The features in the patterned surface can be holes (e.g., micropores or nanopores) in a hole array on glass, silicon, plastic or other suitable solid, which have a patterned covalently attached gel (e.g., poly(N-(5-azidoacetamidopentyl)acrylamide) (PAZAM, see, e.g., U.S. Publication Nos. 2013 / 184796, WO2016 / 066586, and WO2015 / 002813, the entire contents of which are incorporated herein by reference). This method produces a gel pad for sequencing that can remain stable during a sequencing run with a large number of cycles. The covalent attachment of the polymer to the pores facilitates the formation of a gel pad on the structured substrate during various uses. The gel is maintained in the structured features throughout the lifespan. However, in many examples, the gel does not have to be covalently attached to the pores. For example, under certain conditions, a silane-free acrylamide (SFA, see, e.g., U.S. Patent No. 8,563,477, the entire contents of which are incorporated herein by reference) that is not covalently attached to the pores on the surface can be used as a gel material. Examples of flow cells with patterned surfaces that can be used in the methods set forth herein are described in U.S. Patent Nos. 8,778,848, 8,778,849, and 9,079,148, and U.S. Publication No. 2014 / 0243224, the entire contents of which are incorporated herein by reference as a whole.

[0079] The features in the patterned surface can have any of a variety of densities, including, for example, at least 10 (e.g., at least 100, at least 500, at least 5,000, at least 10,000, at least 50,000, at least about 100,000, at least about 1,000,000, or at least about 5,000,000 or more) features / cm 2 .

[0080] Sequencing library: A collection of nucleic acid fragments or amplicons of fragments of one or more target nucleic acid molecules. In several embodiments, the nucleic acid fragments of the sequencing library are linked to known universal sequences (e.g., P5 and P7 sequences) at their 3' and 5' ends. In several examples, the sequencing library is prepared from one or more target nucleic acid molecules encapsulated in a hydrogel or hydrogel beads as described herein.

[0081] Tagmentation: Modification of nucleic acid molecules by transposome complexes to fragment the nucleic acid molecules and couple adapters to the 5' and 3' ends of the fragments in a single step. Tagmentation reactions can be used to prepare sequencing libraries. Tagmentation reactions combine random fragmentation and adapter ligation into a single step to increase the efficiency of the sequencing library preparation process.

[0082] Transport: The movement of molecules in a fluid. The term can include passive transport, such as the movement of molecules along their concentration gradient (e.g., passive diffusion). The term can also include active transport, whereby molecules can move along or against a concentration gradient of molecules. Thus, transport can include applying energy to move one or more molecules in a desired direction or to a desired location, such as an amplification site.

[0083] Transposome complex: an integrase and a nucleic acid comprising an integration recognition site. A transposome complex is a functional complex formed by a transposase and a transposase recognition site capable of catalyzing a transposition reaction (see, e.g., Gunderson et al., WO2016 / 130704). Examples of integrases include, but are not limited to, integrases or transposases. Examples of integration recognition sites include, but are not limited to, transposase recognition sites.

[0084] Under sufficient conditions: A phrase used to describe any circumstances that allow a desired activity.

[0085] Universal nucleotide sequence: a sequence region common to two or more nucleic acid molecules, wherein the molecules also have sequence regions that are different from each other. Universal sequences present in different members of a molecular set can allow a group of universal capture nucleic acids to capture a variety of different nucleic acids, such as capture oligonucleotides that are complementary to a portion of a universal sequence, such as a universal capture sequence. Non-limiting examples of universal capture sequences include sequences that are identical or complementary to P5 and P7 primers. Similarly, universal sequences present in different members of a molecular set can allow a group of universal primers used to amplify or replicate (e.g., sequence) a variety of different nucleic acids, and the universal primers are complementary to a portion of a universal sequence, such as a universal anchor sequence. Therefore, capture oligonucleotides or universal primers include sequences that can specifically hybridize with universal sequences. Two universal sequences that hybridize are called universal binding pairs. For example, a hybridized capture oligonucleotide and a universal capture sequence are universal binding pairs.

[0086] II. Spatial Indexing and Sequencing of Target Nucleic Acid Molecules

[0087] Provided herein is an example of a method for seeding multiple sequence libraries on a sequencing flow cell, which allows spatial isolation of multiple libraries. Spatial isolation can be used to index the sequence reads from each sequencing library to improve the efficiency of subsequent data analysis. This "spatial index" of a sequencing library allows simplification of the processing and sequence reconstruction of the genetic material from which the sequencing library is produced. In other improvements, the disclosed method avoids the need for cumbersome barcode steps to identify the sequence reads associated with a specific target nucleic acid molecule. Embodiments described herein also improve the data resolution for target nucleic acid molecule sequencing, and further simplify the assembly of genomes (e.g., for new organisms), and provide improved identification of rare gene variations and mutation co-occurrences in target nucleic acid molecules.

[0088] Figure 1 Certain features of the disclosed examples are shown and are described in detail herein. Figure 1 As shown, in some examples of the disclosed methods, hydrogel beads containing encapsulated target nucleic acid molecules are captured on a sequencing flow cell. Sequencing libraries are prepared from the target nucleic acid molecules encapsulated in the hydrogel beads and seeded onto the flow cell surface in the presence of a liquid diffusion barrier, which results in spatially isolated seeding of the sequencing libraries from individual hydrogel beads. In the example shown, two seeded sequencing libraries are amplified by cluster amplification, forming two groups of clusters called "cluster spots". Spatial indexing of the cluster spots on the flow cell surface enables the sequence of the target nucleic acid molecule to be reconstructed from shorter sequence reads from each cluster spot.

[0089] Figure 2A An example method 100 for seeding a sequencing library associated with specific genetic material onto a sequencing flow cell is shown.

[0090] At step 102, degradable hydrogel beads containing encapsulated genetic material (e.g., target nucleic acid molecules or cells containing target nucleic acid molecules) are captured on a sequencing flow cell. The beads are loaded onto the sequencing flow cell under conditions sufficient to capture the hydrogel beads onto the flow cell. Capture of the beads on the flow cell can be achieved, for example, by physical restraint of the hydrogel beads on the flow cell, for example, where the diameter of the hydrogel beads is about 10% greater than the height of the flow cell.

[0091] In step 104, a sequencing library is prepared from the genetic material in the captured hydrogel beads. In several examples, the hydrogel beads include holes that allow reagents to diffuse through the hydrogel beads while retaining the genetic material within the beads. A sequencing library is prepared from the genetic material in the captured hydrogel beads by flowing appropriate enzymes, reagents, and components through a flow cell. Enzymes, reagents, and components pass through the holes of the hydrogel beads for the preparation of sequencing libraries, while the genetic material (e.g., target nucleic acid molecules) and the resulting sequencing libraries are still encapsulated in the hydrogel beads. As a result, each hydrogel bead contains a separate sequencing library generated by the encapsulated genetic material.

[0092] In step 106, a liquid diffusion barrier is loaded onto the sequencing flow cell to surround the hydrogel beads. The liquid diffusion barrier is a liquid in which the sequencing library encapsulated in the hydrogel beads is barely solvated. Surrounding the captured hydrogel beads with the liquid diffusion barrier inhibits diffusion of the sequencing library outside the volume of the beads when the beads are degraded in step 108.

[0093] In step 108, the hydrogel beads are degraded to allow the sequencing library to be transported to the surface of the sequencing flow cell by, for example, passive diffusion. The sequencing library is bound to the capture agent on the surface of the flow cell. The liquid diffusion barrier inhibits the sequencing library from diffusing beyond the diameter of the hydrogel beads. Therefore, in the presence of the liquid diffusion barrier, seeding occurs near the footprint of each hydrogel bead. In some examples, prior to the sequencing step, a cluster amplification reaction is performed to amplify the sequencing library on the surface of the flow cell. The seeded nucleic acid molecules from a single bead group are together as cluster spots on the flow cell. It is known that the nucleic acid molecules inside each cluster spot are from a single hydrogel bead, simplifying the subsequent analysis of the sequence reads and the reconstruction of the target nucleic acid sequence originally encapsulated in the hydrogel beads.

[0094] Figure 2B An example method 200 for seeding a sequencing library associated with specific genetic material (eg, a target nucleic acid molecule) onto a sequencing flow cell is shown.

[0095] In step 202, the degradable hydrogel beads of the sequencing library prepared by the genetic material (such as target nucleic acid molecules or cells containing target nucleic acid molecules) that are encapsulated are captured on the sequencing flow cell.Before the hydrogel beads are captured on the sequencing flow cell, beads are prepared to encapsulate the genetic material.The hydrogel beads include holes that allow reagents to diffuse through the hydrogel beads while retaining the genetic material in the beads.By incubating the beads of the encapsulated genetic material with appropriate enzymes, reagents and components to produce a sequencing library, a sequencing library is prepared from the genetic material in the captured hydrogel beads.Enzymes, reagents and components pass through the holes of the hydrogel beads for the preparation of sequencing libraries, while the genetic material and the resulting sequencing library are still encapsulated in the hydrogel beads.As a result, each hydrogel bead accommodates the sequencing library separated by the encapsulated genetic material.Then under conditions sufficient to capture the hydrogel beads on the flow cell, the degradable hydrogel beads of the sequencing library that are encapsulated are loaded on the sequencing flow cell. Capture of beads on a flow cell can be achieved, for example, by physical confinement of the hydrogel beads on the flow cell, for example, where the diameter of the hydrogel beads is about 10% greater than the height of the flow cell.

[0096] In step 204, a liquid diffusion barrier is loaded onto the sequencing flow cell to surround the hydrogel beads. The liquid diffusion barrier is a liquid in which the sequencing library encapsulated in the hydrogel beads is barely solvated. Surrounding the captured hydrogel beads with the liquid diffusion barrier inhibits diffusion of the sequencing library outside the volume of the beads when the beads are degraded in step 206.

[0097] In step 206, the hydrogel beads are degraded to allow the sequencing library to be transported to the surface of the sequencing flow cell by, for example, passive diffusion. The sequencing library is bound to the capture agent on the surface of the flow cell. The liquid diffusion barrier inhibits the sequencing library from diffusing beyond the diameter of the hydrogel beads. Therefore, in the presence of the liquid diffusion barrier, seeding occurs near the footprint of each hydrogel bead. In some examples, prior to the sequencing step, a cluster amplification reaction is performed to amplify the sequencing library on the surface of the flow cell. The seeded nucleic acid molecules from a single bead group are together as cluster spots on the flow cell. It is known that the nucleic acid molecules inside each cluster spot are from a single hydrogel bead, simplifying the subsequent analysis of the sequence reads and the reconstruction of the target nucleic acid sequence originally encapsulated in the hydrogel beads.

[0098] In some examples, the seeded sequencing library is sequenced. Any suitable sequencing technology, such as SBS, can be used. Additional descriptions of the disclosed methods are provided below.

[0099] A. Degradable hydrogel beads encapsulating genetic material

[0100] Embodiments provided herein relate to degradable hydrogel beads encapsulating genetic material (e.g., target nucleic acid molecules and cells and cell lysates containing target nucleic acid molecules). Beads may include hydrogel polymers and crosslinking agents, which are mixed in the presence of genetic material, and form hydrogel beads of encapsulated genetic material. Hydrogel beads may include holes that allow reagents to diffuse through the hydrogel beads while retaining genetic material in the beads, thereby allowing reactions to occur in the beads.

[0101] Non-limiting examples of target nucleic acid molecules that can be encapsulated within the hydrogel beads include DNA, such as genomic or cDNA; RNA, such as mRNA, sRNA, or rRNA; or a hybrid of DNA and RNA.

[0102] Exemplary biological samples from which genetic material (e.g., target nucleic acid molecules) can be obtained include, for example, those from mammals such as rodents, mice, rats, rabbits, guinea pigs; ungulates, horses, sheep, pigs, goats, cattle, cats, dogs; primates, humans, or non-human primates; plants such as Arabidopsis, corn, sorghum, oats, wheat, rice, rapeseed, or soybeans; algae such as Chlamydomonas reinhardtii; nematodes such as Caenorhabditis elegans; insects such as fruit flies, mosquitoes, fruit flies, bees, or spiders; fish such as zebrafish; reptiles; amphibians such as frogs or African clawed frogs; slime molds; fungi such as Pneumocystis carinii, Takifugu rubripes, yeast, Saccharamoyces cerevisiae, or Schizosaccharomyces pombe; pombe); or Plasmodium falciparum. Genetic material may also be obtained from prokaryotes, such as bacteria, Escherichia coli, Staphylococcus aureus, or Mycoplasma pneumoniae; archaea; viruses such as hepatitis C virus or human immunodeficiency virus; or viroids. The target nucleic acid molecule may be obtained from a homogenous culture or population of the above organisms, or alternatively, from a collection of several different organisms, such as in a community or ecosystem. The genetic material need not be obtained from a natural source, but may be synthesized using known techniques.

[0103] In some examples, target nucleic acid molecules for encapsulation in hydrogel beads can be obtained from the genetic material of a single cell. For example, a single cell can be encapsulated in a hydrogel bead, and nucleic acid molecules (e.g., genomic DNA) can be isolated from the single cell using an in-bead isolation assay.

[0104] In some examples, target nucleic acid molecules for encapsulation in hydrogel beads can be obtained from cell lysates encapsulated in hydrogel beads. Target nucleic acid molecules (e.g., genomic DNA) are prepared in beads from lysates and processed to produce sequencing libraries for use in methods provided herein.

[0105] The genetic material encapsulated with the hydrogel beads is of sufficient size to be trapped within the hydrogel beads so that it cannot pass through the pores of the hydrogel beads. In some examples, the target nucleic acid molecule encapsulated within the hydrogel beads is at least 100 nucleotides in length, at least 150 nucleotides in length, at least 200 nucleotides in length, at least 300 nucleotides in length, at least 500 nucleotides in length, at least 1,000 nucleotides in length, at least 5,000 nucleotides in length, at least 10,000 nucleotides in length, at least 20,000 nucleotides in length, at least 50,000 nucleotides in length, at least 100,000 nucleotides in length, or more nucleotides. In several examples, the nucleic acid molecules encapsulated in the hydrogel beads are genomic DNA fragments having a length of about 1,000 to about 10,000 nucleotides, a length of about 10,000 to about 20,000 nucleotides, a length of about 10,000 to about 50,000 nucleotides, a length of about 10,000, a length of 50,000 to about 100,000 nucleotides, or a length of about 300, about 500, about 1000, about 10,000, about 20,000, about 50,000 or about 100,000 nucleotides, or a range between any two of the above sizes, or a length longer than the above sizes. In some examples, the encapsulated nucleic acid molecules are up to about 3M bases in length.

[0106] The hydrogel beads used in the disclosed methods can have any diameter suitable for the methods described herein. In some examples, the diameter of the hydrogel beads is about 2, about 3, about 4, about 5, about 10, about 15, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 110, about 120, about 130, about 140, or about 150 μm. In some examples, the diameter of the hydrogel beads is 2, 3, 4, 5, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140 or 150 μm, or a size within a range limited by any two of the aforementioned values. In some examples, the size of the beads is uneven, so the size of the beads includes beads of various diameters.

[0107] Hydrogel beads can be prepared by cross-linking hydrophilic biopolymers or synthetic polymers under appropriate conditions. Therefore, in some examples, the hydrogel beads may include a cross-linking agent. As used herein, the term "cross-linking agent" refers to a molecule that can form a three-dimensional network when reacted with a suitable base monomer. Examples of polymers that may include one or more cross-linking agents include, but are not limited to, hyaluronic acid, chitosan, agar, heparin, sulfates, cellulose, alginates (including alginate sulfate), collagen, dextran (including dextran sulfate), pectin, carrageenan, polylysine, gelatin (including type A gelatin), agarose, (meth)acrylate-oligolactic acid-PEO-oligolactic acid-(meth)acrylate, PEO-PPO-PEO copolymers (Pluronics), poly(phosphazene), poly(methacrylate), poly(N-vinylpyrrolidone), PL(G)A-PEO-PL(G)A copolymers, poly(ethyleneimine), polyethylene glycol (PEG)-thiol, PEG-acrylate, acrylamide, N,N'-bis(acryloyl)cystamine , PEG, polypropylene oxide (PPO), polyacrylic acid, polyhydroxyethyl methacrylate (PHEMA), polymethyl methacrylate (PMMA), poly N-isopropylacrylamide (PNIPAAm), polylactic acid (PLA), polylactic-glycolic acid (PLGA), polycaprolactone (PCL), poly(vinyl sulfonic acid) (PVSA), poly(L-aspartic acid), poly(L-glutamic acid), bisacrylamide, diacrylate, diallylamine, triallylamine, divinyl sulfone, diethylene glycol diallyl ether, ethylene glycol diacrylate, polymethylene glycol diacrylate, polyethylene glycol diacrylate, trimethylolpropane trimethacrylate, ethoxylated trimethylol triacrylate, or ethoxylated pentaerythritol tetraacrylate, or a combination or mixture thereof. Thus, for example, a combination may include a polymer and a cross-linker, such as polyethylene glycol (PEG)-thiol / PEG-acrylate, acrylamide / N,N'-bis(acryloyl)cystamine (BACy), or PEG / polypropylene oxide (PPO).

[0108] In some examples, the cross-linking agent forms disulfide bonds in the polymer of the hydrogel beads.

[0109] In some examples, the crosslinker is a reversible crosslinker. In some examples, the reversible crosslinker can reversibly crosslink the hydrogel polymer and can not crosslink in the presence of a cleaving agent. In some examples, the crosslinker can be sheared by the presence of a reducing agent, by an elevated temperature, or by an electric field. In some examples, the reversible crosslinker can be N, N'-bis (acryloyl) cystamine, a reversible crosslinker of a polyacrylamide gel, in which the disulfide bonds can be sheared in the presence of a suitable reducing agent. Contacting the crosslinker with a reducing agent shears the disulfide bonds of the crosslinker, thereby destroying the hydrogel beads. The hydrogel beads degrade and release the contents, such as the DNA library retained therein. In some examples, the crosslinker is sheared by raising the temperature to greater than about 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100 ° C. In some examples, the crosslinker is sheared by contacting the hydrogel beads with a reducing agent. In some examples, the reducing agent includes a phosphine compound, a water-soluble phosphine, a nitrogen-containing phosphine and its salts and derivatives, dithioerythritol (DTE), dithiothreitol (DTT) (the cis and trans isomers of 2,3-dihydroxy-1,4-dimercaptobutane, respectively), 2-mercaptoethanol or β-mercaptoethanol (BME), 2-mercaptoethanol or aminoethanethiol, glutathione, thioglycolic acid or thioglycolic acid, 2,3-dimercaptopropanol, tris(2-carboxyethyl)phosphine (TCEP), tris(hydroxymethyl)phosphine (THP) or P[tris(hydroxymethyl)phosphine]propionic acid (THPP), or a combination of two or more of these. In some examples, the crosslinker can be N,N'-(1,2-dihydroxyethylene)bisacrylamide, a reversible crosslinker for polyacrylamide gels, in which 1,2-diol linkages can be cleaved in the presence of an oxidizing agent, such as sodium periodate, and amidohydroxymethyl linkages can be cleaved in the presence of a strong acid, such as periodic acid, or a strong base, such as sodium hydroxide, to degrade the beads. In some examples, the crosslinker is cleaved by increasing the temperature to greater than about 80, 85, 90, 95, or 100°C.

[0110] In some examples, the reagents include reagents for processing genetic material, such as reagents for isolating nucleic acids from cells, for amplifying or sequencing nucleic acids, or for preparing sequencing libraries. The reagents pass through the pores of the hydrogel beads, while the genetic material (e.g., target nucleic acid molecules) and the sequencing library generated thereby are retained within the hydrogel beads.

[0111] In some examples, the polymer cross-linking of the hydrogel beads forms a hydrogel matrix (e.g., a porous hydrogel matrix) with holes. These holes can retain sufficiently large genetic material in the hydrogel beads, but allow small substances (e.g., reagents) to pass through the holes, thereby entering and exiting the hydrogel beads. The hydrogel can have any pore size, and its diameter is sufficient to allow the reagent to diffuse through the beads while retaining the encapsulated nucleic acid molecules. The term "pore size" can also refer to the average diameter or average effective diameter of the pore cross section based on the measured values ​​of multiple holes. The effective diameter of a non-circular cross section is equal to the diameter of a circular cross section with the same cross-sectional area as the non-circular cross section. In some examples, when the hydrogel is hydrated, the hydrogel beads can swell. Then, the pore size can be changed according to the water content in the hydrogel of the hydrogel beads. In some examples, the diameter of the hole is about 10nm to about 100nm.

[0112] In some examples, the pore size of the hydrogel beads is adjusted by changing the ratio of the concentration of the polymer to the concentration of the cross-linking agent. In some examples, the ratio of polymer to cross-linking agent is 30:1, 25:1, 20:1, 19:1, 18:1, 17:1, 16:1, 15:1, 14:1, 13:1, 12:1, 11:1, 10:1, 9:1, 8:1, 7:1, 6:1, 5:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, or 1:30, or about any of these ratios, or a ratio within a range defined by any two of the above ratios. In some examples, additional functionalities such as DNA primers or electrochemical groups can be grafted onto the polymer matrix to meet the requirements of different applications.

[0113] Any suitable method can be used to prepare hydrogel beads containing encapsulated nucleic acid molecules.

[0114] In some examples, the hydrogel beads are prepared by vortex-assisted emulsion. As used herein, vortex-assisted emulsion refers to vortexing the hydrogel monomers or polymers with the long nucleic acid molecules in a container, such as a tube, vial, or reaction vessel. The components are mixed, for example, by manual or mechanical vortexing or shaking.

[0115] In some examples, beads are prepared by microfluidic flow technology. Microfluidic flow includes using microfluidic devices to assist the production of gel emulsions, as shown in Figure 2. In some embodiments, the microfluidic device includes a microchannel, which is configured to produce hydrogel beads of desired size, and is configured to encapsulate the genetic material (such as a single cell or a predetermined amount of target nucleic acid molecules) of each bead selected amount. In addition to the size of the microfluidic device and the width of the channel, the flow rate of the aqueous channel and the immiscible fluid channel may also affect the size of the hydrogel beads. In some examples, the height of the microfluidic device is about 50, about 60, about 70, about 80, about 90, about 100, about 110, about 120, about 130, about 140, about 150, about 160, about 170, about 180, about 190 or about 200 μm, or a height within the range defined by any two of the above values. In some examples, the microfluidic device includes one or more channels. In some examples, the microfluidic device includes a channel for aqueous logistics and a channel for immiscible fluids such as oil. In some examples, the width of one or more channels is the same. In some examples, the width of one or more channels is different. In some examples, the width of one or more channels is about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100, about 105, about 110, about 115, about 120, about 125, about 130, about 135, about 140, about 145, or about 150 μm, or a width within the range defined by any two of the above values. In some examples, the width of the aqueous channel is about 75 μm. In some examples, the width of the immiscible fluid channel is about 78 μm. Other width values ​​are possible because the width can be varied to fine-tune the size of the beads. In addition to the size of the microfluidic device and the width of the channel, the flow rate of the aqueous channel and the immiscible fluid channel also affects the size of the hydrogel beads. In some examples, the flow rate of the solution in the aqueous phase channel is about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 110, about 120, about 130, about 140, or about 150 μL / min, or a flow rate within the range defined by any two of the above values. In some examples, the flow rate of the immiscible fluid in the immiscible fluid channel is about 150, about 160, about 170, about 180, about 190, about 200, about 225, about 250, about 275, about 300, about 325, about 350, about 375, or about 400 μL / min, or a flow rate within the range defined by any two of the above values. In some examples, a solution in an aqueous phase includes a hydrogel polymer, a crosslinker, and genetic material, which flows into an immiscible fluid, such as a carrier oil, through an aqueous channel at a flow rate less than the flow rate of the immiscible fluid, thereby forming droplets. In some examples, the hydrogel droplets containing the genetic material are formulated into a uniform size distribution.In some examples, the size of the hydrogel beads is fine-tuned by adjusting the size of the microfluidic device, the size of one or more channels, or the flow rate of either or both of the aqueous solution or the immiscible fluid. In some examples, the diameter of the resulting hydrogel beads is 2 to 150 μm, such as about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100 μm, about 110 μm, about 120 μm, about 130 μm, about 130 μm, about 140 μm, or about 150 μm, or a diameter within the range defined by any two of the above values.

[0116] In some examples, the size and uniformity of the hydrogel beads encapsulating genetic material can be further controlled by contacting the hydrogel polymer with a fluid modifier, such as an alcohol (including isopropanol) prior to bead formation. The diameter of the beads formed in the absence of isopropanol is greater than the diameter of the beads formed in the presence of isopropanol. Isopropanol affects the fluid properties of the hydrogel polymer, thereby regulating the hydrogel beads.

[0117] In another example, the hydrogel bead comprises a hollow core and an outer shell, wherein the genetic material (e.g., target nucleic acid molecule) and / or sequencing library is contained in the hollow core (see, e.g., Figures 9A-9C ). The diameter of the hollow core is in the range of about 5% to about 75% of the diameter of the hydrogel bead. Hydrogel beads comprising a hollow core and an outer shell can be made, for example, by encapsulating an inner hydrogel layer in an outer hydrogel layer and then selectively degrading the inner hydrogel layer rather than the outer hydrogel layer. The inner hydrogel layer is a hydrogel bead that contains genetic material (e.g., a target nucleic acid molecule) and / or a sequencing library as described above. The inner hydrogel layer is depolymerized using a method that does not depolymerize the outer hydrogel layer to produce a hollow hydrogel bead. In one example, the inner layer is made of agarose and can be depolymerized by heating to 60°C, and the outer hydrogel layer is made of acrylamide with a chemically reversible crosslinker and is resistant to depolymerization at 60°C. In another example, both the inner and outer layers are made of acrylamide, but both layers use orthogonal crosslinker chemistry. For example, the inner layer crosslinker is sheared by an oxidizing agent such as sodium periodate, while the outer layer crosslinker is sheared by a reducing agent such as DTT. Depolymerization of the inner layer, but not the outer layer, produces hydrogel beads with a hollow core and an outer shell, wherein the genetic material and / or sequencing library is contained in the hollow core. The hollow inner core provides an aqueous medium for uniform enzymatic and chemical reactions on the encapsulated nucleic acids.

[0118] In some examples, the amount of genetic material (e.g., target nucleic acid molecule) in the beads can be controlled by diluting or concentrating the genetic material in the input sample. As described herein, the sample including the genetic material is mixed with a hydrogel polymer, and the hydrogel polymer containing the genetic material is placed in a vortex-assisted emulsion or a microfluidization-assisted emulsion.

[0119] The hydrogel beads can include any number of genetic materials suitable for the methods provided herein. For example, any suitable number of target nucleic acid molecules of any suitable length can be encapsulated in the hydrogel beads. In some examples, the length of the encapsulated nucleic acid molecules is up to about 3M bases. In some examples, the hydrogel beads encapsulate an average of 1-1000 target nucleic acid molecules, and its length is about 1,000 to about 500,000 nucleotides. In some examples, the hydrogel beads encapsulate an average of 1-1000 target nucleic acid molecules, and its length is 1,000 to 100,000 nucleotides. In some examples, the hydrogel beads encapsulate an average of 1-1000 target nucleic acid molecules, and its length is 10,000 to 150,000 nucleotides. In some examples, the hydrogel beads encapsulate an average of 1-1000 target nucleic acid molecules, and its length is 50,000 to 150,000 nucleotides. In some examples, the hydrogel beads encapsulate an average of 1-1000 target nucleic acid molecules with a length of 10,000 to 20,000 nucleotides. In some examples, the hydrogel beads encapsulate an average of 1-100 target nucleic acid molecules with a length of 1,000 to 500,000 nucleotides. In some examples, the hydrogel beads encapsulate an average of 1-100 target nucleic acid molecules with a length of 1,000 to 100,000 nucleotides. In some examples, the hydrogel beads encapsulate an average of 1-100 target nucleic acid molecules with a length of 10,000 to 150,000 nucleotides. In some examples, the hydrogel beads encapsulate an average of 1-100 target nucleic acid molecules with a length of 50,000 to 150,000 nucleotides. In some examples, the hydrogel beads encapsulate an average of 1-100 target nucleic acid molecules with a length of 10,000 to 20,000 nucleotides. In some examples, the hydrogel beads encapsulate an average of 10-100 target nucleic acid molecules with a length of 1000 to 500,000 nucleotides. In some examples, the hydrogel beads encapsulate an average of 10-100 target nucleic acid molecules with a length of 1000 to 100,000 nucleotides. In some examples, the hydrogel beads encapsulate an average of 10-100 target nucleic acid molecules with a length of 10,000 to 150,000 nucleotides. In some examples, the hydrogel beads encapsulate an average of 10-100 target nucleic acid molecules with a length of 50,000 to 150,000 nucleotides. In some examples, the hydrogel beads encapsulate an average of 10-100 target nucleic acid molecules with a length of 10,000 to 20,000 nucleotides. In some examples, the hydrogel beads encapsulate an average of 50-150 target nucleic acid molecules with a length of 1,000 to 500,000 nucleotides. In some examples, the hydrogel beads encapsulate an average of 50-150 target nucleic acid molecules that are 1,000 to 100,000 nucleotides in length. In some examples, the hydrogel beads encapsulate an average of 50-150 target nucleic acid molecules that are 10,000 to 150,000 nucleotides in length.In some examples, the hydrogel beads encapsulate an average of 50-150 target nucleic acid molecules having a length of 50,000 to 150,000 nucleotides. In some examples, the hydrogel beads encapsulate an average of 50-150 target nucleic acid molecules having a length of 10,000 to 20,000 nucleotides.

[0120] In some examples, the transposon binds to the target nucleic acid molecule (e.g., genomic DNA) before encapsulating the target nucleic acid molecule in the hydrogel bead while keeping the target nucleic acid molecule intact. This can be achieved, for example, by removing the catalytic metal ion Mg from the hydrogel bead. 2+ The target nucleic acid molecule is reacted with Tn5 transposase in the case of MgCl2 (e.g., as described in U.S. Patent Publication No. 2015 / 0368638 to Gunderson et al., which is incorporated herein by reference in its entirety). After the pre-tagged DNA is encapsulated in the hydrogel beads, it is captured on the surface of the flow cell and the MgCl2-containing 2+ A buffer containing ions flows into the flow cell to complete the tagmentation process. An extension or gap filling / ligation reaction is then performed to complete the addition of adapters to the DNA fragments to generate a sequencing library. The liquid diffusion barrier is then loaded onto the flow cell and the hydrogel beads degrade, thereby releasing the sequencing library in a spatially restricted manner for seeding onto the sequencing flow cell.

[0121] In another example, the target nucleic acid molecule (e.g., genomic DNA) is first labeled outside the flow cell using a tagging bead (e.g., 0.5-20 μm size) containing a transposon on the bead surface (e.g., as described in U.S. Publication No. 2014 / 0194324 of Gormley et al., which is incorporated herein by reference). After the tagging reaction, the tagged DNA is bound to the tagging bead. These beads are then encapsulated into larger hydrogel beads using a droplet generator for capture on the flow cell. The library is prepared on the flow cell by loading a PCR mixture containing P5 / P7 primers to release the tagged DNA from the tagging bead and adding a linker. In an alternative example, the tagging bead contains a complete linker sequence attached to a transposon, which is attached to the tagging bead by hybridization, and the library is released from the tagging bead by denaturation. The liquid diffusion barrier is then loaded onto the flow cell, and the hydrogel beads degrade, thereby releasing the sequencing library in a spatially restricted manner for seeding into the sequencing flow cell.

[0122] B. Flow Cell Capture of Hydrogel Beads

[0123] Embodiments provided herein include capturing hydrogel beads containing encapsulated genetic material on a sequencing flow cell. Hydrogel beads containing encapsulated genetic material are loaded onto a sequencing flow cell under conditions sufficient to capture the hydrogel beads on the sequencing flow cell.

[0124] Any suitable method can be used to capture the hydrogel beads on the surface of the flow cell. In some examples, due to the size difference between the diameter of the hydrogel beads and the height of the flow cell, the physical constraint of the hydrogel beads on the flow cell captures the hydrogel beads on the flow cell. For example, the diameter of the hydrogel beads is about 5% to about 30% (e.g., about 5%, about 10%, about 15%, about 20%, about 25%, or about 30%) greater than the height of the flow cell, thereby constraining the beads in the flow cell. In some examples, the diameter of the hydrogel beads is about 10% greater than the height of the flow cell, thereby constraining the beads in the flow cell, for example, the diameter of the hydrogel beads is about 110 μm, and the height of the flow cell is about 100 μm. This size difference can cause the hydrogel beads to "stick" to the flow cell.

[0125] In some examples, the hydrogel beads are captured on the flow cell by the interaction of the capture agent on the flow cell surface with the hydrogel beads. Examples of capture agents used to immobilize the hydrogel beads on the flow cell surface in the disclosed methods include, but are not limited to, capture nucleic acids complementary to at least a portion of the nucleic acids of the hydrogel or crosslinker attached to the beads, or members of a receptor-ligand binding pair (e.g., avidin, streptavidin, biotin, lectins, carbohydrates, nucleic acid binding proteins, epitopes, antibodies, etc.) that are capable of binding to a target nucleic acid (or a linking portion attached thereto), or chemical reagents that are capable of forming a covalent bond with a target nucleic acid (or a linking portion attached thereto).

[0126] In some examples, the capture agent is a first member of a specific binding pair located on a sequencing flow cell and is bound to a second member of the specific binding pair located on a hydrogel bead. For example, the flow cell is functionalized with the first member of the specific binding pair and the hydrogel bead is functionalized with the second member of the specific binding pair.

[0127] In some examples, the capture agent is present at isolated locations on the flow cell. For example, in examples where the flow cell is a patterned flow cell comprising an array of wells, the capture agent can be present in the wells of the patterned flow cell.

[0128] Additionally, the flow cell may contain bead capture structures, such as posts / pillars, weirs, cup-shaped structures, to immobilize / trap beads at defined locations within the flow cell. These capture structures can be fabricated by etching in glass or silicone, or by photolithography of photopatternable materials.

[0129] C. On-bead sequencing library preparation

[0130] In some examples, sequencing libraries can be prepared from genetic material (e.g., target nucleic acid molecules) encapsulated in hydrogel beads. Sequencing libraries can be prepared before, during, or after capturing beads on the surface of a sequencing flow cell. In several examples, sequencing libraries can be prepared from genetic material encapsulated in hydrogel beads while the beads are captured on the surface of a sequencing flow cell.

[0131] The genetic material (e.g., target nucleic acid molecule) encapsulated in the hydrogel beads is contacted with one or more reagents to prepare a sequencing library. The sequencing library is retained in the hydrogel beads, and the reagent can pass through the holes of the hydrogel beads. Therefore, the hydrogel beads provide a microenvironment for the controlled reaction of the encapsulated genetic material, thereby allowing the reagent to enter and exit the barrier of the hydrogel beads, while the corresponding sequencing library is retained in the beads. The preparation process of the entire sequencing library can be completed inside the hydrogel beads, and multiple reagent exchanges are performed by porous hydrogels, while the sequencing library products are retained in the hydrogel matrix.

[0132] In several examples, preparing a sequencing library includes fragmenting the target nucleic acid molecules encapsulated in the hydrogel beads, and adding adapters comprising universal nucleotide sequences to the fragments of the target nucleic acid molecules. Any suitable method can be used to fragment the target nucleic acid molecules and add adapters. The fragments of the target nucleic acid molecules connected to one or more adapters are called "adapted fragments". The adapted fragments of the target nucleic acid molecules in each bead together provide a nucleic acid library representing the target nucleic acid molecules from the beads that can be fixed and then sequenced.

[0133] In several examples, the target nucleic acid molecules undergo a tagmentation procedure within the hydrogel beads for fragmentation and addition of adapters. In one non-limiting example, Nextera TM (Illumina, San Diego, CA) labeling scheme and reagents are used to implement the labeling procedure. The labeling reaction combines random fragmentation and joint connection into one step to improve the efficiency of the sequencing library preparation process. The result of fragmentation is a fragment group of the target nucleic acid molecule encapsulated in the hydrogel beads, which includes the sequence of the parent target nucleic acid molecule from the hydrogel beads connected to one or more joints. In several embodiments, the fragment includes at least one chain with a transposase index. The transposase is washed off, and additional sequences can be added to the ends of the adapted fragments, for example, by PCR, connection or any other suitable method.

[0134] Some examples may include the use of a highly active Tn5 transposase and a Tn5-type transposase recognition site (see, e.g., Goryshin and Reznikoff, J. Biol. Chem., 273:7367 (1998), which is incorporated herein by reference in its entirety), or a MuA transposase and a Mu transposase recognition site comprising R1 and R2 terminal sequences (see, e.g., Mizuuchi, K., Cell, 35:785, 1983 and Savilahti, H et al., EMBO J., 14:4893, 1995, which are incorporated herein by reference in their entirety). Tn5 mosaic end (ME) sequences may also be used.

[0135] Further examples of transposition systems that can be used with certain examples of the methods provided herein include Staphylococcus aureus Tn552 (see, e.g., Colegio et al., J. Bacteriol, 183:2384-8, 2001 and Kirby et al., Mol. Microbiol, 43:173-86, 2002, the entire contents of which are incorporated herein by reference in their entireties), Ty1 (see, e.g., Devine & Boeke, Nucleic Acids Res., 22:3765-72, 1994 and International Publication WO 95 / 23875, each of which is incorporated herein by reference in its entirety), transposon Tn7 (see, e.g., Craig, Science. 271:1512, 1996 and Craig, Review in: Curr Top Microbiol Immunol, 204:27-48, 1996, each of which is incorporated herein by reference in its entirety), Tn / O and IS10 (see, e.g., Kleckner et al., J. Bacteriol, 183:2384-8, 2001 and Kirby et al., Mol. Microbiol, 43:173-86, 2002, the entire contents of which are incorporated herein by reference in their entireties), al., Curr Top Microbiol Immunol, 204:49-82, 1996, which is incorporated herein by reference in its entirety), Mariner transposase (see, e.g., Lampe, et al., EMBO J., 15:5470-9, 1996, which is incorporated herein by reference in its entirety), Tel (see, e.g., Plasterk, Curr. Topics Microbiol. Immunol, 204:125-43, 1996, which is incorporated herein by reference in its entirety), P element (see, e.g., Gloor, Methods Mol. Biol, 260:97-114, 2004, which is incorporated herein by reference), Tn3 (see, e.g., Ichikawa & Ohtsubo, J Biol. Chem. 265: 18829-32, 1990, which is incorporated herein by reference in its entirety), bacterial insertion sequences (see, e.g., Ohtsubo & Sekine, Curr. Top. Microbiol. Immunol., 204: 1-26, 1996, which is incorporated herein by reference in its entirety), retroviruses (see, e.g., Brown et al, Proc Natl Acad Sci USA, 86: 2525-9, 1989, which is incorporated herein by reference in its entirety), and yeast retrotransposons (see, e.g., Boeke & Corces, Annu Rev Microbiol. 43: 403-34, 1989, which is incorporated herein by reference in its entirety).Further examples include IS5, Tn10, Tn903, IS911, and engineered forms of transposase family enzymes (see, e.g., Zhang et al, PLoS Genet. 5:el000689, 2009, and Wilson et al, J. Microbiol. Methods 71:332-5, 2007, each of which is incorporated herein by reference in its entirety).

[0136] Non-limiting examples of transposon sequences that can be used in the methods described herein are provided in U.S. Patent Application Publication No. 2010 / 0120098, U.S. Patent Application Publication No. 2012 / 0208705, U.S. Patent Application Publication No. 2012 / 0208724, and International Patent Application Publication No. WO2012 / 061832 (the entire contents of which are incorporated herein by reference in their entirety). In some examples, the transposon sequence includes a first transposase recognition site, a second transposase recognition site, and an index sequence present between the two transposase recognition sites.

[0137] In some examples, the target nucleic acid molecules are fragmented using an appropriate method, and then adapters are ligated to the fragments for sequencing library preparation. An example method includes: dephosphorylating the 5' ends of the fragments of the target nucleic acid molecules to prevent the formation of concatemers in the subsequent ligation step; ligating a first adapter to the 3' end of the dephosphorylated target using a ligase, wherein the 3' end of the first adapter is blocked; rephosphorylating the 5' end of the ligated target; ligating a second adapter to the 5' end of the dephosphorylated target using a single-stranded ligase, wherein the 5' end of the second adapter is not phosphorylated.

[0138] Another example includes partially digesting a fragment of a target nucleic acid molecule with a 5' exonuclease to form a double-stranded nucleic acid with a single-stranded 3' overhang. A joint containing a 3' blocking group can be connected to the 3' end of the double-stranded nucleic acid with a 3' overhang. A double-stranded nucleic acid with a 3' overhang and a joint connected can be hybridized to form a single-stranded nucleic acid. A joint containing a non-phosphorylated 5' end can be connected to the 5' end of a single-stranded nucleic acid.

[0139] A method of dephosphorylating a nucleic acid, such as a 5' nucleotide of a nucleic acid, comprises contacting the nucleic acid with a phosphatase. Examples of phosphatases include calf intestinal phosphatase, shrimp alkaline phosphatase, Antarctic phosphatase, and APEX alkaline phosphatase (Epicentre).

[0140] The method of connecting nucleic acids includes contacting the nucleic acids with a ligase. Examples of ligases include T4 RNA ligase 1, T4 RNA ligase 2, RtcB ligase, Methanobacterium RNA ligase, and TS2126 RNA ligase. TM ).

[0141] A method of phosphorylating a nucleic acid, such as a 5' nucleotide of a nucleic acid, comprises contacting the nucleic acid with a kinase. Examples of kinases include T4 polynucleotide kinase.

[0142] In several embodiments, the adapters attached to the fragments of the target nucleic acid molecule include sequences for subsequent seeding, sequencing, and analysis of sequence reads associated with the fragments of the target nucleic acid molecule. The adapters may include, for example, capture sequences, sequencing primer binding sites, amplification primer binding sites, and indexes.

[0143] In several examples, the adapter includes a universal nucleotide sequence for capturing nucleic acid molecules of a sequencing library on the surface of a sequencing flow cell, the surface of which has a flat or hole with a corresponding capture oligonucleotide that binds to the universal nucleotide sequence. The universal sequence present at the end of the fragment can be used to bind to a universal anchor sequence, which can be used as a primer and extended in an amplification reaction. In several embodiments, two different universal primers are used. One primer hybridizes with a universal sequence at the 3' end of one chain of the indexed nucleic acid fragment, and a second primer hybridizes with a universal sequence at the 3' end of another chain of the indexed nucleic acid fragment. Therefore, the anchor sequence of each primer can be different. Suitable primers can each contain additional universal sequences such as a universal capture sequence, and another index sequence. Because each primer can contain an index, this step results in the addition of one or two index sequences, which can be reverse complementary sequences of each other, or can have sequences that are not reverse complementary sequences of each other.

[0144] The adaptation fragment can be any suitable size for subsequent seeding and sequencing steps. In some examples, the length of the adaptation fragment is 150 to 400 nucleotides, such as 150 to 300 nucleotides.

[0145] In some examples, target nucleic acid molecules or fragments thereof, or suitable fragments thereof, can be amplified in hydrogel beads according to any suitable amplification method.

[0146] In some examples, amplification is isothermal amplification. Example isothermal amplification methods that can be used include, but are not limited to, multiple displacement amplification (MDA), which is a widely used technique for amplifying small amounts of DNA, such as illustrated by Dean et al., Proc. Natl. Acad. Sci. USA 99: 5261-66 (2002); or isothermal strand displacement nucleic acid amplification, such as illustrated by U.S. Patent No. 6,214,587, each of which is incorporated herein by reference in its entirety.

[0147] In other examples, amplification may include, but is not limited to, PCR, SDA, TMA, and nucleic acid sequence-based amplification (NASBA), as described in U.S. Pat. No. 8,003,354, the entire contents of which are incorporated herein by reference. The above amplification methods can be used to amplify one or more target nucleic acids. For example, PCR including multiplex PCR, SDA, TMA, NASBA, etc. can be used to amplify the encapsulated nucleic acid. In some examples, primers specific for the target nucleic acid are included in the amplification reaction.

[0148] In some examples, the amplification method may include a ligation probe amplification or oligonucleotide ligation assay (OLA) reaction, which includes primers specific for the target nucleic acid. In some examples, the amplification method may include a primer extension-ligation reaction, which includes primers specific for the target nucleic acid and can pass through the hydrogel pore. As a non-limiting example of primer extension and ligation primers that can be specially designed to amplify the target nucleic acid, the amplification may include primers for GoldenGate assays (Illumina, Inc., SanDiego, CA), such as those in U.S. Patent Nos. 7,582,420 and 7,611,869, all of which are incorporated herein by reference in their entirety.

[0149] Another nucleic acid amplification method useful in the present disclosure is tagging PCR, which uses a population of two-domain primers with a constant 5' region followed by a random 3' region, such as described in Grothues et al. Nucleic Acids Res. 21 (5): 1321-2 (1993), which is incorporated herein by reference in its entirety. A first round of amplification is performed to initiate a large number of times on heat-denatured DNA based on individual hybridizations from randomly synthesized 3' regions. Due to the nature of the 3' region, the start site is considered to be random throughout the genome. Thereafter, unbound primers can be removed and further replication can be performed using primers complementary to the constant 5' region.

[0150] In some examples, the adaptation fragments encapsulated in the hydrogel beads can be further modified or reacted to prepare for seeding on the sequencing flow cell and sequencing. In some examples, the adaptation fragments are reacted with capture oligonucleotides specific to the adaptation fragments (e.g., by binding to the adapter sequence), and the captured oligonucleotides can be fixed on the surface of the solid substrate. For example, the capture oligonucleotides can include a first member of a universal binding pair, and wherein the second member of the binding pair is fixed on the surface of the solid substrate.

[0151] D. Bead Degradation and Sequencing Library Seeding

[0152] The hydrogel beads degrade when surrounded by a liquid diffusion barrier to release the sequencing library from the beads and seed the sequencing library into the sequencing flow cell. The liquid diffusion barrier is loaded onto the sequencing flow cell to fill the void volume between the hydrogel beads and surround the hydrogel beads. When the beads degrade, surrounding the captured hydrogel beads with a liquid diffusion barrier inhibits the diffusion of the sequencing library outside the bead volume. After the beads are degraded, the encapsulated sequencing library will be transported to the surface of the flow cell and captured there. Therefore, in the presence of a liquid diffusion barrier, seeding on the flow cell occurs at the imprint close to each hydrogel bead.

[0153] Each hydrogel bead contains a sequencing library generated from a target nucleic acid molecule within the bead. Thus, the sequencing library seeded from each hydrogel bead corresponds to the target nucleic acid molecule encapsulated in the bead. Because seeding occurs near the blot on each hydrogel bead flow cell, the seeded sequencing library for each bead is spatially segregated (or "indexed") on the flow cell according to the position of the bead.

[0154] In some examples, the liquid diffusion barrier can be a hydrophobic liquid, such as an oil, such as a mineral oil or silicone oil, or a perfluorinated oil, or a combination of two or more thereof. In other examples, the liquid diffusion barrier can be a viscous solution that prevents the diffusion of the DNA library, such as a buffer containing a polymer, such as polyethylene glycol (PEG), polyvinyl pyrrolidone, pluronic dextran, sucrose, etc. In some examples, a temperature-responsive material can be used as a liquid barrier. The temperature-responsive material is a non-viscous liquid at a non-seeding temperature, which can be easily loaded onto the flow cell and occupy the intergranular space between the hydrogel beads. After heating to the seeding temperature, the material solidifies to form a physical barrier and prevents the library from diffusing. In some examples, the temperature-responsive material can be poly (N-isopropylacrylamide) or polyethylene oxide-polypropylene oxide-polyethylene oxide (PEO-PPO-PEO) / lithium bentonite nanoparticle complex. In some examples, the liquid diffusion barrier used in the disclosed embodiments is composed of a combination of any two or more liquid diffusion barriers discussed above.

[0155] The hydrogel beads can be degraded using any suitable method that does not substantially reduce the effectiveness of the liquid diffusion barrier to inhibit the diffusion of the sequencing library beyond the diameter of the hydrogel beads. The hydrogel beads do not need to be completely degraded to release the sequencing library from the beads and seed the sequencing library onto the sequencing flow cell. Sufficient degradation includes increasing the porosity of the hydrogel beads to allow the encapsulated sequencing library to diffuse and transport the sequencing library to the surface of the flow cell.

[0156] In some examples, the hydrogel beads are degraded by applying sufficient heat to the beads to break the hydrogel matrix and allow the sequencing library to diffuse within the degraded hydrogel matrix and seed the sequencing library on the flow cell surface. In some examples, heat can be applied by heating the flow cell to about 90° C. for about a sufficient time (e.g., 5 minutes) to degrade the hydrogel matrix.

[0157] In the example where the hydrogel matrix includes a reversible crosslinker, the matrix can be degraded by decrosslinking the matrix with a suitable cleaving agent. For example, in the case where the crosslinker includes a disulfide bond that crosslinks the polymers of the hydrogel, the cleaving agent can be a reducing agent, such as DTT. In some examples, the crosslinker includes a 1,2-diol bond that can be sheared by an oxidant, a strong base or a strong acid, such as sodium periodate and periodic acid. In some examples, the crosslinker includes a photo-cleavable portion that shears the hydrogel matrix to decrosslink. In such an example, the hydrogel matrix can be exposed to light of an appropriate wavelength to shear the photo-cleavable portion and degrade the hydrogel matrix.

[0158] In another example, the reducing agent is activated by UV light.These photodegradable reducing moieties can be present in the oil phase or can be introduced into the hydrogel beads by diffusion prior to the melting step.

[0159] After the beads are sufficiently degraded, the encapsulated sequencing library is transported to the surface of the flow cell and captured therein. Any suitable method can be used to capture the sequencing library on the flow cell surface.

[0160] In some examples, the sequencing library is captured on the flow cell through the interaction of the capture agent on the flow cell with the adapted fragments of the sequencing library.

[0161] In some examples, the capture agent is a first member of a specific binding pair located on a sequencing flow cell and binds to a second member of the specific binding pair located on an adapted fragment of a sequencing library. For example, the flow cell is functionalized with the first member of the specific binding pair, and the adapter of the adapted fragment comprises the second member of the specific binding pair.

[0162] In some examples, a capture agent, such as a capture oligonucleotide, can be attached to the surface of a sequencing flow cell. For example, a capture agent can be attached to a hole on the surface of a patterned flow cell. Attachment can be through an intermediate structure, such as a bead, a particle, or a gel. Examples of capture agents attached to the surface of a sequencing flow cell via a gel are commercially available from Illumina Inc. (San Diego, CA) or described in WO2008 / 093098, which is incorporated herein by reference in its entirety.

[0163] In a specific example, the patterned flow cell comprises a surface for binding a sequencing library, which is prepared by patterning a solid support with pores (e.g., micropores or nanopores); covering the patterned support with a gel material (e.g., PAZAM, SFA, or chemically modified variants thereof, such as azido-SFA); and polishing the gel-coated support by a method such as chemical or mechanical polishing, thereby retaining the gel in the pores, but removing or inactivating virtually all of the gel in the interstitial regions on the surface of the structured substrate between the pores. Primers and capture nucleic acids can be attached to the gel material for capturing and amplifying the sequencing library. The sequencing library can then be transported to the patterned surface so that each adapted fragment in the library will seed each pore by interacting with the primers attached to the gel material; however, due to the lack or inactivation of the gel material, the adapted fragment will not occupy the interstitial regions between the pores. Since the lack or inactivation of the gel in the interstitial regions between the pores prevents the outward migration of the growing nucleic acid colonies, the amplification of the adapted fragments is constrained to the pores. The method can be easily fabricated, is scalable, and utilizes conventional μm or nanofabrication methods.

[0164] In some examples, the seeded sequencing library can be amplified prior to sequencing. For example, the seeded sequencing library can be amplified using primer sites in the adapter sequence, and then sequenced using sequencing primer sites in the adapter sequence.

[0165] In some examples, the sequencing library of sowing is amplified by solid phase amplification. Primers for solid phase amplification (such as capture primers) are preferably fixed by covalent attachment to a solid support at or near the 5' end of the primer at a single point, so that the template-specific part of the primer is freed to anneal to a homologous template, and the 3' hydroxyl used for primer extension is freed. Any suitable covalent attachment means can be used for this purpose. The selected attachment chemistry will depend on the properties of the solid support and any derivatization or functionalization applied thereto. The primer itself can include a part that can be a non-nucleotide chemical modification, to facilitate connection. In a specific example, the primer can include a sulfur-containing nucleophile at the 5' end, such as phosphorothioate or phosphorothioate. In the case of a solid-loaded polyacrylamide hydrogel, the nucleophile will be attached to the bromoacetamide group present in the hydrogel. A more specific way of attaching primers and templates to a solid support is via 5' phosphorothioate attachment to a hydrogel composed of polymerized acrylamide and N-(5-bromoacetamidopentyl)acrylamide (BRAPA) as described in WO05 / 065814, which is incorporated by reference in its entirety.

[0166] Although the present invention encompasses solid phase amplification methods in which only one amplification primer is fixed (the other primer is typically present in free solution), in some examples, the solid support preferably provides fixed forward and reverse primers simultaneously. In practice, since the amplification process uses an excess of primers to maintain amplification, there will be "multiple" forward primers and / or "multiple" reverse primers fixed on the solid support. Unless the context otherwise indicates, reference to forward and reverse primers herein should be interpreted accordingly as covering "multiple" of such primers.

[0167] The surface of the sequencing flow cell can include multiple primers for generating amplicons from the sequencing library seeded on the flow cell. In some examples, the primers can have universal primer sequences complementary to the universal sequences present in the adapter sequences connected to each target nucleic acid. In specific examples, multiple primers can be attached to the amplification site. Primers can be attached to the amplification site for capturing nucleic acids as described above.

[0168] In some examples, cluster amplification methods can be used to amplify the sequencing library of seeding, as exemplified by the disclosure of U.S. Patent Nos. 7,985,565 and 7,115,400, the entire contents of which are incorporated herein by reference as a whole. The combined materials of U.S. Patent Nos. 7,985,565 and 7,115,400 describe a method for nucleic acid amplification, which allows the amplified product to be fixed on a solid support to form an array consisting of a cluster or "colony" of fixed nucleic acid molecules. Each cluster or colony on this array is formed by a plurality of identical or substantially identical fixed polynucleotide chains and a plurality of identical fixed complementary polynucleotide chains. The array so formed is generally referred to as a "cluster array" in this article. The product of the solid phase amplification reaction, such as those described in U.S. Patent Nos. 7,985,565 and 7,115,400, is a so-called "bridged" structure formed by annealing a paired fixed polynucleotide chain and a fixed complementary chain, and both chains are preferably fixed to a solid support at the 5' end by covalent attachment. Cluster amplification methodology is an example of a method in which an immobilized nucleic acid template is used to generate immobilized amplicons.

[0169] It should be understood that there may be a small amount of contamination in a colony or cluster without adversely affecting subsequent sequencing reactions. For specific applications, acceptable example contamination levels at each amplification site include, but are not limited to, up to 0.1%, 0.5%, 1%, 5%, 10% or 25% of contamination amplicons.

[0170] Other suitable methods can also be used to produce fixed amplicons from fixed DNA fragments produced according to the method provided herein. For example, whether or not one or both primers in each pair of amplification primers are fixed, one or more clusters or colonies can be formed by solid phase PCR. In some examples, the encapsulated nucleic acid is amplified in a bead and then deposited in the form of a solid support in an array or cluster.

[0171] E. Sample Multiplexing

[0172] In some examples, sample indexing methods can be used to interrogate multiple nucleic acid samples on a single sequencing flow cell.Any suitable multiplexing method can be used.

[0173] For example, in some examples, in order to generate connected long read information from multiple samples in the same flow cell lane, different index transposons are used to identify hydrogel spots from each sample. For example, the target nucleic acid molecules can be labeled before the beads are captured on the flow cell. Different nucleic acid samples (encapsulated in hydrogel beads as described herein) are labeled separately using different index transposons and then loaded into the flow cell for completing the preparation of the sequencing library and releasing the library from the hydrogel beads. This provides seeding spots containing different index sequences corresponding to different samples, which can be separated from each other during the read-out analysis process after sequencing.

[0174] Alternatively, the hydrogel beads of each sample are processed sequentially on the flow cell. The beads containing the first sample are loaded onto the flow cell and the target nucleic acid is tagged using a transposon. After the library of the first sample is released from the beads and seeded into the flow cell, a second round of hydrogel beads containing a second target nucleic acid sample is loaded into the flow cell and tagged using a unique transposon to generate a second index library, which is released in a spatially restricted manner for seeding on the flow cell surface. This provides seeding spots containing different DNA index sequences corresponding to different samples, which can be separated from each other during the read-out analysis process after sequencing.

[0175] In another method for sample multiplexing, exogenous nucleic acid molecules can be incorporated into different target nucleic acid samples during the bead encapsulation step. The exogenous nucleic acid molecules can be, for example, double-stranded or single-stranded DNA. Non-limiting examples of exogenous DNA that can be incorporated into the sample as labeling include Phi-X, λ1, λ3 or λ3DNA. Multiple samples are processed into hydrogel beads (each different sample contains a unique incorporated exogenous marker), and then these beads are pooled to be loaded into the flow cell. After labeling and library preparation and seeding in the flow cell, each resulting cluster spot of the seeded library contains a cluster / readout from the incorporated DNA sample, which can be used to identify the sample source during the readout analysis process.

[0176] In some examples, in order to maximize the use of flow cells for the generation of sequencing data, additional steps can be added to the workflow after the sequencing library is seeded from the hydrogel beads. At this stage, the intergranular spaces between the hydrogel bead prints have a lower seeding library density. In order to utilize the intergranular spaces, conventional short-read libraries can be used to seed from the same or different samples and libraries in the gap regions and in the blank regions within the hydrogel spots, implementing additional seeding steps. The short-read library contains different DNA indexes to separate the reads from the connected long read and short-read libraries.

[0177] F. Sequencing

[0178] In some examples, the seeded sequencing library is sequenced in whole or in part. The seeded sequencing library can be sequenced according to any suitable sequencing method, such as direct sequencing, including SBS, sequencing while connecting, sequencing while hybridizing, nanopore sequencing, etc. Non-limiting examples of methods for determining the sequence of fixed nucleic acid fragments are described in, for example, Bignell et al. (US8,053,192), Gunderson et al. (WO2016 / 130704), Shen et al. (US8,895,249), and Pipenburg et al. (US9,309,502), the entire contents of which are incorporated herein by reference in their entirety.

[0179] The methods described herein can be used in combination with a variety of nucleic acid sequencing techniques. Particularly suitable techniques are those in which nucleic acids are attached to fixed positions in an array so that their relative positions remain unchanged, and in which the array is repeatedly imaged. Particularly suitable embodiments in which images are obtained in different color channels, for example, coincide with different labeling for distinguishing one nucleotide base type from another nucleotide base type. In some examples, the process of determining the nucleotide sequence of a fragment can be an automated process.

[0180] One sequencing method is SBS. In SBS, the extension of a nucleic acid primer along a nucleic acid template (e.g., a target nucleic acid or an amplicon thereof) is monitored to determine the sequence of nucleotides in the template. The underlying chemical process may be a polymerization reaction (e.g., catalyzed by a polymerase). In a specific polymerase-based SBS embodiment, fluorescently labeled nucleotides are added to the primers in a template-dependent manner (thereby extending the primers), so that the order and type of nucleotides added to the primers can be detected and used to determine the sequence of the template.

[0181] In one example, the nucleomonomer includes a locked nucleic acid (LNA) or a bridged nucleic acid (BNA). The use of LNA or BNA in the nucleomonomer can increase the hybridization strength between the nucleomonomer and the sequencing primer sequence present on the immobilized fragment.

[0182] SBS can use nucleotide monomers with terminator part or without any terminator part.The method using the nucleotide monomer lacking terminator includes for example pyrophosphate sequencing and the sequencing of nucleotides using γ-phosphate labeling, as further described in this article.In the method using the nucleotide monomer lacking terminator, the nucleotide quantity added in each cycle is usually variable, and depends on the pattern of template sequence and nucleotide delivery.For the SBS technology utilizing the nucleotide monomer with terminator part, in the case of traditional Sanger sequencing using dideoxynucleotides, terminator can be effectively irreversible under the sequencing conditions used, or in the case of the sequencing method developed by Solexa (now Illumina, Inc.), terminator can be reversible.

[0183] The SBS technique can use nucleotide monomers with or without a labeling portion. Thus, incorporation events can be detected based on properties of the label, such as fluorescence of the label; properties of the nucleotide monomer, such as molecular weight or charge; byproducts of nucleotide incorporation, such as release of pyrophosphate, etc. In embodiments where two or more different nucleotides are present in the sequencing reagent, the different nucleotides can be distinguished from each other, or two or more different labels may not be distinguishable under the detection technology used. For example, different nucleotides present in the sequencing reagent can have different labels, and appropriate optical devices can be used to distinguish them, as exemplified by the sequencing method developed by Solexa (now Illumina, Inc.).

[0184] Some examples include pyrophosphate sequencing techniques. Pyrophosphate sequencing detects the release of inorganic pyrophosphate (PPi) as specific nucleotides are incorporated into nascent chains (Ronaghi et al., Analytical Biochemistry, 242(1):84-9, 1996, Ronaghi, Genome Res., 11(1):3-11, 2001, Ronaghi, Uhlen, and Nyren, Science, 281(5375), 363, 1998, and U.S. Patent Nos. 6,210,891; 6,258,568 and 6,274,320, each of which is incorporated herein by reference in its entirety. In pyrophosphate sequencing, the released PPi can be detected by immediate conversion to adenosine triphosphate (ATP) by ATP thiolase, and the level of ATP generated is detected by photons generated by luciferase. The nucleic acids to be sequenced can be attached to features in an array, and the array can be imaged to capture the chemiluminescence generated by the incorporation of nucleotides on the features of the array. Signal. After treating the array with a specific nucleotide type (e.g., A, T, C, or G), an image can be obtained. The image obtained after adding each nucleotide type will be different in terms of the features in the detection array. These differences in the image reflect the different sequence contents of the features on the array. However, the relative position of each feature will remain unchanged in the image. The methods set forth herein can be used to store, process, and analyze images. For example, the images obtained after processing the array with each different nucleotide type, which are images obtained from different detection channels for a sequencing method based on a reversible terminator, can be processed in the same manner as exemplified herein.

[0185] In another exemplary type of SBS, cycle sequencing is accomplished by the stepwise addition of reversible terminator nucleotides comprising, for example, cleavable or photocleavable dye labels, as described, for example, in WO04 / 018497, WO91 / 06678, WO07 / 123,744, and U.S. Patent No. 7,057,026, the entire contents of which are incorporated herein by reference in their entirety. The availability of fluorescently labeled terminators in which terminators can be reversed and fluorescently labeled cleaved facilitates efficient cyclic reversible termination (CRT) sequencing. Polymerases can also be co-engineered to efficiently incorporate and extend from these modified nucleotides.

[0186] In some sequencing embodiments based on reversible terminators, the labeling will not substantially inhibit extension under SBS reaction conditions. However, the detection labeling can be removed, for example, by shearing or degradation. Images can be captured after the labeling is incorporated into the nucleic acid features of the array. In a specific example, each cycle involves delivering four different nucleotide types to the array simultaneously, and each nucleotide type has spectrally different labels. Four images can then be obtained, each of which uses a detection channel that is selective for one of the four different labels. Alternatively, different nucleotide types can be added sequentially, and the image of the array can be obtained between each addition step. In such an example, each image will show the nucleic acid features of a specific type of nucleotides that have been incorporated. Due to the different sequence content of each feature, different features will be present or absent in different images. However, the relative position of the feature will remain unchanged in the image. As described herein, the images obtained from this reversible terminator-SBS method can be stored, processed and analyzed. After the image capture step, the labeling can be removed and the reversible terminator portion can be removed for subsequent nucleotide addition and detection cycles. Removing the labeling after the labeling is detected in a specific cycle and before the subsequent cycle can provide the advantage of reducing background signals and crosstalk between cycles. This article illustrates examples of useful labeling and removal methods.

[0187] In a specific example, some or all of the nucleotide monomers may include a reversible terminator. In such an example, a reversible terminator / cuttable fluorophore may include a fluorophore connected to a ribose moiety by a 3' ester bond (see, e.g., Metzker, Genome Res., 15: 1767-1776, 2005, which is incorporated herein by reference in its entirety). Other methods have separated terminator chemistry from fluorescently labeled shearing (see, e.g., Ruparel et al., Proc Natl Acad Sci USA 102: 5932-7, 2005, which is incorporated herein by reference in its entirety). Ruparel et al. describe the development of a reversible terminator, which uses a small 3' allyl group to block extension, but is easily unblocked by a short treatment with a palladium catalyst. The fluorophore is connected to the base by a photo-cuttable joint, which is easily cut by exposure to long wavelength ultraviolet light for 30 seconds. Therefore, disulfide reduction or photo-cutting can be used as a cuttable joint. Another method of reversible termination is to use natural termination, which is carried out after placing a large amount of dye on the dNTP. The presence of charged macromolecular dyes on the dNTP can act as an effective terminator through steric hindrance and / or electrostatic hindrance. Unless the dye is removed, the presence of an incorporation event will prevent further binding. The shearing of the dye removes the fluorophore and effectively reverses the termination. Examples of modified nucleotides are also described in U.S. Patent Nos. 7,427,673 and 7,057,026, all of which are incorporated herein by reference in their entirety.

[0188] Additional exemplary SBS systems and methods that can be used with the methods and systems described herein are described in U.S. Patent Publication Nos. 2007 / 0166705, 2006 / 0188901, 2006 / 0240439, 2006 / 0281109, 2012 / 0270305, and 2013 / 0260372, U.S. Patent No. 7,057,026, PCT Publication No. WO05 / 065814, U.S. Patent Application Publication No. 2005 / 0100900, and PCT Publication Nos. WO06 / 064199 and WO07 / 010,251, the entire contents of which are incorporated herein by reference.

[0189] Some examples use less than four different tags to detect four different nucleotides.For example, SBS can be implemented using the method and system described in U.S. Patent Application Publication No. 2013 / 0079232, the entire contents of which are incorporated herein by reference.As a first example, a pair of nucleotide types can be detected at the same wavelength, but based on the intensity difference of a member in the pair relative to another member to distinguish, or based on the signal of other members in the pair detected to cause a significant signal to appear or disappear in the pair of a member's change (such as by chemical modification, photochemical modification or physical modification) to distinguish.As a second example, three of four different nucleotide types can be detected under specific conditions, and the fourth nucleotide type lacks a detectable mark under those conditions, or is detected least under those conditions (such as due to background fluorescence caused by the least detection, etc.).Can be based on the existence of their respective signals to determine that the first three nucleotide types are mixed in nucleic acid, and can be determined according to the absence of any signal or the minimum detection to determine that the fourth nucleotide type is mixed in nucleic acid.As a third example, a nucleotide type may include one or more marks detected in two different channels, and other nucleotide types are detected in no more than one channel. The three example configurations described above are not considered mutually exclusive and can be used in various combinations. An example that combines all three examples is a fluorescence-based SBS method that uses a first nucleotide type detected in a first channel (e.g., dATP, which has a label detected in the first channel when excited by a first excitation wavelength), a second nucleotide type detected in a second channel (e.g., dCTP, which has a label detected in the second channel when excited by a second excitation wavelength), a third nucleotide type detected in both the first channel and the second channel (e.g., dTTP, which has at least one label detected in both channels when excited by the first and / or second excitation wavelengths), and a fourth nucleotide type (e.g., dGTP, which has no label) that lacks a label in either channel or is not detected or is minimally detected.

[0190] In addition, as described in the combined materials of U.S. Patent Publication No. 2013 / 0079232, sequencing data can be obtained using a single channel. In this so-called single dye sequencing method, the first nucleotide type is marked, but the mark is removed after the first image is generated, and the second nucleotide type is marked only after the first image is generated. The third nucleotide type retains its mark in both the first image and the second image, while the fourth nucleotide type is not marked in both images.

[0191] Some examples can use sequencing while connecting. Such technology uses DNA ligase to incorporate oligonucleotides and identify the incorporation of such oligonucleotides. In several embodiments, the oligonucleotides have different tags, which are related to the identification of specific nucleotides in the sequence of oligonucleotide hybridization. As with other SBS methods, after the array of nucleic acid features is treated with labeled sequencing reagents, images can be obtained. Each image will show the nucleic acid features that have been merged with specific types of tags. Because the sequence content of each feature is different, different features will exist or not exist in different images, but the relative position of the features will remain unchanged in the image. As described herein, images obtained from sequencing methods based on connection can be stored, processed and analyzed. Exemplary SBS systems and methods that can be used with the methods and systems described herein are described in U.S. Patents No. 6,969,488, 6,172,218 and 6,306,597.

[0192] Some examples can use nanopore sequencing (see, for example, Deamer & Akeson, "Nanopores and nucleic acids: prospects for ultrarapid sequencing," Trends Biotechnol., 18, 147-151, 2000, Deamer and Branton, "Characterization of nucleic acids by nanopore analysis", Acc. Chem. Res., 35: 817-825, 2002, Li, Gershow, Stein, Brandin, and Golovchenko, "DNA molecules and configurations in a solid-state nanoporemicroscope," Nat. Mater., 2:611-615, 2003, the entire contents of which are incorporated herein by reference in their entirety. In such examples, the fragment passes through a nanopore. The nanopore can be a synthetic pore or a biological membrane protein, such as α-hemolysin. As the fragment passes through the nanopore, each base pair can be identified by measuring the fluctuations in the conductivity of the pore (see, e.g., U.S. Pat. No. 7,001,792, Soni & Meller, "A. Progress toward ultrafast DNA sequencing using solid-state nanopores," Clin. Chem. 53, 1996-2001, 2007, Healy, "Nanopore-based single-molecule DNA analysis," Nanomed., 2, 459-481, 2007, Cockroft, Chu, Amorin, and Ghadiri, "A single-molecule nanopore device detects DNA polymerase activity with single-nucleotide resolution,” J. Am. Chem. Soc., 130, 818-820, 2008, which is incorporated herein by reference in its entirety. As described herein, data obtained from nanopore sequencing can be stored, processed, and analyzed. In particular, the data can be processed into images according to the example processing of optical images and other images described herein.

[0193] Some examples can use methods involving real-time monitoring of DNA polymerase activity. The incorporation of nucleotides can be detected by fluorescence resonance energy transfer (FRET) interactions between a polymerase loaded with a fluorophore and a γ-phosphate labeled nucleotide, as described, for example, in U.S. Pat. Nos. 7,329,492 and 7,211,414 (the entire contents of which are incorporated herein by reference in their entirety); or, nucleotide incorporation can be detected by zero-mode waveguides, such as described in U.S. Pat. No. 7,315,019 (the entire contents of which are incorporated herein by reference in their entirety), and using fluorescent nucleotide analogs and engineered polymerases, such as described in U.S. Pat. No. 7,405,281 and U.S. Publication No. 2008 / 0108082 (the entire contents of which are incorporated herein by reference in their entirety). Illumination can be confined to a volume of a tol-scale around the surface-bound polymerase, so that incorporation of fluorescently labeled nucleotides can be observed with low background (see, e.g., Levene et al., Science, 299, 682-686, 2003, Lundquist et al., Opt. Lett., 33: 1026-1028, 2008, Korlach et al., Proc. Natl. Acad. Sci. USA, 105: 1176-1181, 2008, each of which is incorporated herein by reference in its entirety). Images obtained from this method can be stored, processed, and analyzed as described herein.

[0194] Some SBS examples include detecting protons released after nucleotides are incorporated into the extended product. For example, sequencing based on the detection of released protons can use electrical detectors, and related technologies commercially available from Ion Torrent (Guilford, CT, a subsidiary of Life Technologies), or sequencing methods and systems described in U.S. Patent Publication Nos. 2009 / 0026082; 2009 / 0127589; 2010 / 0137143; and 2010 / 0282617, each of which is incorporated herein by reference in its entirety. The method for amplifying target nucleic acids using kinetic repulsion set forth herein can be easily applied to substrates for detecting protons. More specifically, the method set forth herein can be used to generate clonal populations of amplicons for detecting protons.

[0195] G. Data Analysis

[0196] Any suitable bioinformatics workflow can be used to analyze and process sequence reads obtained using the published methods.

[0197] In some examples, reads originating from the same long DNA fragment are labeled with the same barcode to enable linked read analysis. Since clusters belonging to the same DNA fragment are spatially co-located in the flow cell and fall within the boundaries of the bead containing the fragment, accurate barcode assignment can be based on the identification of bead positions (or "cluster blocks") on the flow cell. Real-time analysis (RTA) images (e.g., in Illumina MiSeq TM The bead position identification can be done using cluster coordinates reported by RTA (e.g., available on the platform). Thus, this workflow can be used on platforms that support querying cluster coordinates, for example.

[0198] In some examples, given the coordinates of the RTA (x, y) readouts on each tile (taking into account both surfaces and all tile strips when appropriate), density-based spatial clustering can be implemented to identify bead locations on each tile, where each bead is assumed to correspond to a high-density cluster of readouts compared to the lower-density background created by readouts leaking into the intergranular voids. The clustering procedure detects an unknown number of clusters (because the number of beads on each tile is not fixed), handles variable cluster shapes and sizes (in the case of beads that are not uniform in size and are rounded after melting), and classifies gap readouts as noise. Clusters can be defined using any appropriate density-based clustering algorithm, such as the DBSCAN clustering algorithm. In several embodiments, bead boundaries are calculated from each resulting cluster by finding the convex hull of the points belonging to the cluster. To enhance clustering results, a density-based readout filtering procedure can be applied before clustering, which eliminates readouts based on the sparsity of the neighborhood on the tile (e.g., if there are fewer than n other readouts within a radius r surrounding it on the layer, the readout is filtered out, where n and r are configurable parameters). In some examples, manual curation steps may be implemented to evaluate and correct the final results of the clustering process.

[0199] In other examples, deep learning is used to determine bead positions from RTA coordinates. For example, a U-Net convolutional neural network architecture for image isolation or an appropriate CNN model can be used to determine cluster boundaries and corresponding bead positions. In some such examples, the training data set includes manually annotated images obtained from coordinate-based plots, as well as synthetically generated images. Enhancement of synthetic data is achieved by applying a set of transformations to the manually annotated images; these transformations include shape deformation, size, quantity and position changes, and inter-bead and intra-bead density changes.

[0200] When sequencing DNA from a known reference genome, genomic alignment information can be used to further refine bead identification, rescue interstitial reads and improve the resulting barcode assignments. For example, beads belonging to the same cluster can be further separated by considering the genomic windows to which the reads are mapped and their spatial proximity. Alternatively, crosstalk between beads can be quantified by counting reads mapped to the same genomic window in adjacent beads; bead pairs with significantly high crosstalk can then be merged to improve island continuity and performance in certain target applications (e.g., phasing). Probabilistic or "soft" barcode assignments are also considered to further improve performance in certain target applications (e.g., phasing and assembly).

[0201] In some examples, in post-identification, each detected bead is associated with a unique barcode, and reads contained within the bead boundaries are labeled with that barcode. As a result, reads originating from long DNA fragments initially captured in the same bead will be assigned to the same barcode and can be connected in subsequent analysis. In particular, for human genome phasing, barcoded reads can be connected to islands (corresponding to longer DNA fragments from the start position of the read) using proximity in their genomic arrangement position (e.g., if mapped close on the human genome, reads in the same barcode can be connected), enabling reconstruction of much larger phase blocks. In genome assembly, barcode information can be used to disambiguate repetitive sequences and significantly improve assembly continuity, such as by first mapping reads to partially assembled contigs and then connecting contigs using barcode information. Phasing and assembly pipelines have been included as subsequent steps in the data analysis workflow, following best practices for linked read analysis and applying hydrogel-specific performance optimizations when appropriate.

[0202] III. Flow cell equipment and its use

[0203] In some embodiments, the present disclosure relates to devices, systems and methods for preparing nucleic acid libraries on flow cell devices. For example, a flow cell device may include a hydrogel containing genetic material, wherein the hydrogel may be configured to retain the genetic material while allowing reagents, enzymes, chemicals and primers of smaller sizes of less than about 50 base pairs to pass through the hydrogel. The flow cell device can be used to prepare a nucleic acid library within the flow cell device and to sequence the genetic material retained in the hydrogel, including single cell sequencing.

[0204] In some examples, the device, system and method eliminates complex single-cell capture and library preparation methods by using the flow cell surface to capture the genomic content of a single cell and converting it in situ into a sequencing library. Due to the proximity of the cluster in space, the readout from the library can be mapped back to the original cell. In contrast to other flow cell library preparation methods, the examples provided herein start with capturing a single single cell on the surface of the flow cell, rather than starting with capturing long DNA molecules in cells with P5 / P7 connectors at the ends. Therefore, the examples provided herein reduce the complexity of DNA extraction, size selection and sequencing library preparation for long genomic fragments. Certain examples of devices, systems and methods can also use long DNA molecules (from tens to hundreds of kilobases) as input for synthetic long read assembly without connector connection.

[0205] A. Hydrogel Flow Cell Equipment

[0206] Some examples relate to flow cell devices having a hydrogel material deposited thereon. In some examples, the hydrogel includes genetic material disposed therein. In some examples, the hydrogel includes pores that allow reagents, enzymes, chemicals, and oligonucleotides or primers of less than about 50 base pairs to diffuse through the pores while retaining the genetic material therein.

[0207] In some examples, the channel height of the flow cell device is 50 μm, 60 μm, 70 μm, 80 μm, 90 μm, 100 μm, 110 μm, 120 μm, 130 μm, 140 μm, or 150 μm, or an amount within a range defined by any two of the above values.

[0208] The terms "solid surface", "solid support" and other grammatical equivalents herein refer to any material that is suitable or can be modified to be suitable for the attachment of materials for nucleic acid processing, including, for example, materials for nucleic acid library preparation, including transposome complexes. As will be appreciated by those skilled in the art, the number of possible solid support materials is very large. Possible materials include, but are not limited to, glass and modified or functionalized glass, plastics (including acrylic, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethane, Teflon, polyvinyl alcohol ... TM The invention relates to a kind of solid support and solid surface, and the solid support and solid surface of the present invention are particularly useful. For some examples, the solid support and solid surface are located in the flow cell device.

[0209] In some examples, the solid support includes a substrate based on silicon dioxide, such as glass, fused silica or other materials containing silicon dioxide. In some examples, the substrate based on silicon dioxide can also be silicon, silicon dioxide, silicon nitride or silicone hydride. In some examples, the solid support includes plastics, such as polyethylene, polystyrene, poly (vinyl chloride), polypropylene, nylon, polyester, polycarbonate, cycloolefin polymer or poly (methyl methacrylate). In some examples, the solid support is a material or plastic material based on silicon dioxide. In some examples, the solid support has at least one surface comprising glass.

[0210] In some examples, the solid support can be or can include a metal. In some such examples, the metal is gold. In some examples, the solid support has at least one surface including a metal oxide. In one example, the solid support includes tantalum oxide or tin oxide.

[0211] Acrylamide, ketene or acrylate can also be used as solid support material.Other solid support materials can include but are not limited to gallium arsenide, indium phosphide, aluminum, ceramics, polyimide, quartz, resins, polymers and copolymers.The foregoing list is intended to illustrate rather than limit the present application.

[0212] In some examples, the solid support and / or the solid surface can be quartz. In some examples, the solid support and / or the solid surface can be a semiconductor, such as GaAs or indium tin oxide (ITO).

[0213] Solid carrier can comprise single material or multiple different materials.Solid carrier can be composite material or laminate.Solid carrier can be plane, circular, texture and patterned.Pattern can be formed by metal pads forming features on non-metallic surface, for example, as described in U.S. Patent No. 8,778,849, which is incorporated herein by reference.Another kind of useful patterned surface is the surface with hole features formed on the surface, for example, as described in U.S. Patent Application Publication No. 2014 / 0243224A1, U.S. Patent Application Publication No. 2011 / 0172118A1 or U.S. Patent Application No. 7,622,294, each of which is incorporated herein by reference in its entirety.For the example of using patterned surface, gel can be associated with pattern features or deposited on pattern features, or gel can be uniformly deposited on both pattern features and gap regions.

[0214] In some examples, the solid carrier includes a patterned surface." Patterned surface "refers to the arrangement of different regions in or on the exposed layer of the solid carrier. In some examples, the pattern can be an xy format of features in rows and columns. In some examples, the pattern can be a repeated arrangement of features and / or gap regions. In some examples, the pattern can be a random arrangement of features and / or gap regions. The exemplary patterned surfaces that can be used in the methods and compositions set forth herein are described in U.S. Application No. 13 / 661,524 or U.S. Patent Publication No. 2012 / 0316086A1, each of which is incorporated herein by reference. The exemplary patterned surfaces that can be used in the methods and compositions set forth herein are described in U.S. Application No. 13 / 661,524 or U.S. Patent Publication No. 2012 / 0316086A1, each of which is incorporated herein by reference.

[0215] In some examples, the solid carrier includes an array of holes or pits on the surface. The device can be manufactured using a variety of techniques as known in the art, including but not limited to photolithography, imprinting technology, molding technology and micro-etching technology. As will be understood by those skilled in the art, the technology used will depend on the composition and shape of the array substrate. In some examples, the diameter of the array of the hole or pit is about 10 μm to about 50 μm, for example, a diameter of about 10 μm, about 15 μm, about 20 μm, about 25 μm, about 30 μm, about 35 μm, about 40 μm, about 45 μm or about 50 μm, or a diameter within the range defined by any two of the above values. In some examples, the depth of the hole or pit is about 0.5 μm to about 1 μm, for example, about 0.5 μm, about 0.6 μm, about 0.7 μm, about 0.8 μm, about 0.9 μm or about 1 μm, or a depth within the range defined by any two of the above values. In some examples, the hole or pit is made of a hydrophobic material. In some examples, the hydrophobic material includes an amorphous fluoropolymer, including, for example, CYTOP, or See, e.g., PCT Application No. PCT / US2017 / 033169, the entire contents of which are incorporated herein by reference.

[0216] In some examples, the solid support described herein forms at least a portion of a flow cell or is located in a flow cell. In one example, the solid support in the flow cell device is coated with a surface polymer comprising a functional group capable of forming a covalent bond with an oligonucleotide or a modified oligonucleotide, such as those described in PCT Publication Nos. WO2013 / 184796 or WO2016 / 066586. In some examples, the surface polymer comprises a repeating unit of formula (I) and a repeating unit of formula (II):

[0217]

[0218] in

[0219] R 1 and R 1 ' are each independently hydrogen, halogen, alkyl, alkoxy, alkenyl, cycloalkyl, aryl, heteroaryl, heterocyclyl or optionally substituted variants thereof;

[0220] R 2 and R 3 are each independently hydrogen, alkyl, alkylamino, alkylamido, alkylthio, aryl, or optionally substituted variants thereof;

[0221] R 4 , R 4 '、R 5 and R 5 ' are each independently hydrogen, R 6 , OR 6 、-C(O)OR 6 、-C(O)R 6 、-OC(O)R 6 、-C(O)NR 7 R 8 or -NR 7 R 8 ;

[0222] Where R 6 is hydrogen, hydroxy, alkyl, cycloalkyl, hydroxyalkyl, aryl, heteroaryl, heterocyclyl, or optionally substituted variants thereof; and

[0223] R 7 and R 8 are each independently hydrogen or alkyl, or R 7 and R 8 Together with the atom or atoms to which they are attached they form a heterocyclic ring.

[0224] In some examples, R 1 , R 1 '、R 3 , R 5 and R 5 ' are each hydrogen. In some examples, R 4 ' is hydrogen or alkyl. In some examples, R 4 -C(O)NR 7 R 8 In some examples, R 2is -(CH2)5-NHC(O)CH2N3. In some examples, the surface polymer is poly(N-(5-azidoacetamidopentyl)acrylamide-co-acrylamide) (PAZAM) or silane-free acrylamide (SFA). In some examples, the surface polymer is covalently bound to the solid support. In other examples, the surface polymer is non-covalently bound to the solid support. In this example, the flow cell device includes a solid support having a surface polymer coating on which a hydrogel including genetic material can flow.

[0225] As used herein, the term "alkyl" refers to a fully saturated straight or branched hydrocarbon chain. In some examples, the alkyl group contains 1 to 20 carbon atoms, or 1 to 6 carbon atoms, or 1 to 4 carbon atoms. "Lower alkyl" has 1-4 carbon atoms and can be referred to as C 1-4 Alkyl. Examples of the alkyl group of 1 to 6 carbons are methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl or hexyl.

[0226] As used herein, the term "alkenyl" refers to an alkyl group containing one or more double bonds.

[0227] As used herein, the term "cycloalkyl" refers to a fully saturated monocyclic or polycyclic system. When multiple rings are present, they may be fused, bridged, or spirocyclic systems. The cycloalkyl may contain 3 to 10 carbon ring atoms, or 3 to 8 carbon ring atoms, or 3 to 6 carbon ring atoms. Examples include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl.

[0228] As used herein, the term "aryl" refers to a carbocyclic, monocyclic or polycyclic aromatic ring system. The aryl ring may include fused non-aromatic rings. In some examples, the aryl group has 6, 10 or 14 carbon ring atoms. Examples of aryl groups are benzene, naphthalene and anthracene.

[0229] The terms "heterocyclyl" and "heterocycle" refer to ring systems that include at least one heteroatom, such as oxygen, nitrogen or sulfur. Such systems can be unsaturated, partially saturated, aromatic or combinations thereof.

[0230] As used herein, "heteroaryl" refers to a monocyclic or polycyclic aromatic ring system containing one or more heteroatoms, such as nitrogen, oxygen or sulfur. "Heteroaryl" groups include fused systems that contain at least one aromatic heteroatom-containing ring, while the other ring can be carbocyclic or heterocyclic and can be aromatic or non-aromatic. Examples of heteroaryl groups include furan, furazan, thiophene, benzothiophene, phthalazine, pyrrole, oxazole, benzoxazole, 1,2,3-oxadiazole, 1,2,4-oxadiazole, thiazole, 1,2,3-thiadiazole, 1,2,4-thiadiazole, benzothiazole, imidazole, benzimidazole, indole, indazole, pyrazole, benzopyrazole, isoxazole, benzisoxazole, isothiazole, triazole, benzotriazole, thiadiazole, tetrazole, pyridine, pyridazine, pyrimidine, pyrazine, purine, pteridine, quinoline, isoquinoline, quinazoline, quinoxaline, cinnoline, and triazine.

[0231] As used herein, "alkylamino" refers to an alkyl group in which one or more hydrogen atoms are replaced by an amino group. Exemplary alkylamino groups include, but are not limited to, aminomethyl, 2-aminoethyl, and 3-aminoethyl.

[0232] As used herein, "alkylamido" refers to an alkyl group in which one or more hydrogen atoms are replaced by a C-amido or N-amido.

[0233] The term "halo" refers to fluorine, chlorine, bromine and iodine substituents, ie, fluoro, chloro, bromo and iodo.

[0234] Whenever a group is described as "optionally substituted," that group may be unsubstituted or substituted with one or more of the indicated substituents.

[0235] Thus, some examples provided herein relate to a hydrogel flow cell device. As used herein, a hydrogel flow cell device is a flow cell device having a solid support as described herein, and further comprising a hydrogel, wherein the hydrogel comprises a hydrogel polymer and genetic material.

[0236] The hydrogel can be prepared by cross-linking a hydrophilic biopolymer or a synthetic polymer. Thus, in some examples, the hydrogel can include a cross-linking agent. Examples of hydrogel polymers for use in hydrogel flow cell devices can include one or more cross-linking agents, including but not limited to those described above for hydrogel beads.

[0237] In some examples, the crosslinker is a reversible crosslinker, such as described above for hydrogel beads. In some examples, the hydrogel layer is a reversible hydrogel layer that can be crosslinked or uncrosslinked depending on the chemical to which it is exposed. In some examples, the reversible hydrogel layer is prepared with a crosslinker containing disulfide bonds, such as a bisacrylamide crosslinker, which can be disrupted by a reducing agent such as DTT, TCEP, or THP (phosphine). Fig.17As shown, 10-100 μm sized reversible hydrogel polymers encapsulating a load of dye-stained bacteria (top) can be degraded upon exposure to the reducing agent THP, resulting in bacterial release (bottom).

[0238] In some examples, elevated temperature or contact with a reducing agent degrades the cross-linking agent, thereby releasing the encapsulated genetic material from the hydrogel polymer.

[0239] In some examples, cross-linking of the cross-linking agent establishes pores in the hydrogel polymer, such as described above for hydrogel beads. In some examples, the size of the pores in the hydrogel polymer is adjustable and is configured to encapsulate genetic material, such as cells or nucleic acids greater than about 300 base pairs, but allow smaller particles, such as reagents, enzymes, chemicals, or nucleic acids of smaller size (such as primers) less than about 50 base pairs to pass through the pores. In some examples, the reagents include reagents for processing genetic material, such as reagents for separating nucleic acids from cells, for amplifying or sequencing nucleic acids, or for preparing nucleic acid libraries. The hydrogel can have any pore size and any porosity, such as the pore size or porosity described above for the hydrogel beads.

[0240] As used herein, "genetic material" refers to a cell, a microbiome, or a nucleic acid. In some examples, the cell is a single cell, including a prokaryotic or eukaryotic cell. In some examples, the cell is a mammalian cell. In some examples, the cell is a human cell. In some examples, the cell is a bacterial cell. In some examples, the genetic material is a viral particle. In some examples, the nucleic acid is a long DNA molecule, genomic DNA, a viral nucleic acid, a bacterial nucleic acid, or a mammalian nucleic acid. In some examples, the genetic material is retained in the hydrogel, while reagents, enzymes, chemicals, and small nucleic acids less than about 50 base pairs are able to enter and leave the hydrogel.

[0241] In some examples, the hydrogel is a hydrogel layer covering the solid surface of the flow cell device. In some examples, the hydrogel layer is prepared from a hydrogel precursor solution including genetic material, and the hydrogel precursor solution flows onto the surface of the flow cell device and can be further cross-linked on the surface of the flow cell device to form a polymerized hydrogel layer. In some examples, the hydrogel precursor solution includes a viscosity modifier, such as PEG or dextran, to adjust the viscosity of the solution. In some examples, the hydrogel precursor solution includes a sample containing genetic material.

[0242] In some examples, the hydrogel is a hydrogel bead captured in a flow cell device. For example, in some examples, the hydrogel bead forms a column along a channel in a flow cell device. In some examples, the hydrogel bead includes genetic material. In some examples, the hydrogel bead includes a hydrogel polymer, a cross-linking agent, and genetic material. In some examples, the hydrogel polymer includes 60-90% fluid (e.g., water) and 10-30% polymer. In some examples, the water content of the hydrogel is about 70-80%.

[0243] Any suitable method may be used to prepare the hydrogel beads, such as the methods described above for preparing hydrogel beads, such as vortex-assisted emulsion or microfluidic flow techniques.

[0244] In some examples, the hydrogel beads encapsulate single or different genetic materials, whether prepared by vortex-assisted emulsion or microfluidic inertial flow-assisted emulsion. For example, in some examples, the hydrogel beads encapsulate single cells. In some examples, the amount of genetic material within the hydrogel beads can be controlled by diluting the sample containing the genetic material. As described herein, the sample including the genetic material is mixed with a hydrogel polymer, and the hydrogel polymer containing the genetic material is placed in a vortex-assisted emulsion or a microfluidic inertial flow-assisted emulsion.

[0245] In some examples, after preparing the hydrogel beads containing genetic material, the hydrogel beads are dehydrated to reduce the size of the hydrogel beads. In some examples, the size of the hydrogel beads is reduced by about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40%, or 50%, or an amount within the range defined by any two of the above values. Thus, for example, the hydrogel beads can be reduced from a hydrated size of 105 μm in diameter to a dehydrated size of less than 100 μm in diameter. In some examples, the dehydrated hydrogel beads with genetic material arranged therein flow onto a flow cell device and are rehydrated to a diameter greater than the channel height of the flow cell device, causing the hydrogel beads to be captured within the flow cell device.

[0246] B. Methods for Preparing Hydrogel Flow Cell Apparatus

[0247] Some examples provided herein relate to methods for preparing hydrogel flow cell devices. In some examples, flow cell devices with solid surfaces are provided. In some examples, the surface of the flow cell device is coated with surface polymers, such as those described herein, or such as PAZAM or SFA. In some examples, the hydrogel precursor solution described herein with hydrogel polymers, crosslinking agents and genetic material flows into the flow cell device, covering the solid surface of the flow cell device. In some examples, a large amount of hydrogel precursor solution is removed by passing an immiscible fluid through the flow cell device, which replaces most of the hydrogel precursor solution and leaves a residual layer of the hydrogel precursor solution with genetic material in the flow cell device. In some examples, the immiscible fluid is oil, such as mineral oil, hydrocarbon oil, silicone oil or polydimethylsiloxane oil, or a mixture thereof. In some examples, the thickness of the hydrogel precursor solution retained in the residual layer can be controlled by the viscosity of the hydrogel precursor solution, which can be adjusted in the presence of non-reactive polymer species, such as PEG or dextran. In some examples, an oil containing a cross-linking agent, such as tetramethylethylenediamine (TEMED), is added to the flow cell device, which initiates cross-linking of the residual layer of the hydrogel precursor solution. In some examples, the oil containing the cross-linking agent is removed, leaving a cross-linked hydrogel layer with genetic material on the surface of the flow cell device. In some examples, the cross-linked hydrogel layer covers the surface of the flow cell. In some examples, the flow cell device with a cross-linked hydrogel layer can be used to process genetic material, as described herein.

[0248] Some examples provided herein relate to methods for preparing a flow cell device in which a hydrogel layer column is arranged. In some examples, the method includes providing a flow cell device as described herein. In some examples, the method includes providing hydrogel beads of encapsulated genetic material as described herein. In some examples, the hydrogel beads are dehydrated to a diameter less than the channel height of the flow cell device. In some examples, the channel height of the flow cell is in the range of about 50 μm to about 100 μm, such as 50 μm, 60 μm, 70 μm, 80 μm, 90 μm, 100 μm, 110 μm, 120 μm, 130 μm, 140 μm or 150 μm, or in an amount within the range defined by any two of the above values. In some examples, the diameter of the dehydrated hydrogel beads is about 2 to about 140 μm, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 4%, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, or 140 μm, or a diameter within a range defined by any two of the above values. Thus, by way of example, a flow cell device may include a channel having a height of 100 μm and a corresponding dehydrated hydrogel bead having a diameter of less than 100 μm, such as a diameter of 70 μm. The dehydrated hydrogel beads are capable of rehydrating and in doing so increase in diameter by 1%-50%, for example, about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 30%, 40% or 50%, or an amount within a range defined by any two of the above values. The dehydrated hydrogel beads containing genetic material flow into a flow cell device and rehydrate, thereby being fixed within the flow cell device. In some examples, the fixed hydrogel beads form a column structure within the flow cell device. In some examples, as described herein, a flow cell device with fixed hydrogel beads can be used to process genetic material, wherein the fixed hydrogel beads have genetic material encapsulated therein.

[0249] C. Methods for handling genetic material in hydrogels in flow cell devices

[0250] Some examples provided herein relate to methods for treating genetic materials encapsulated in a hydrogel on a solid surface of a flow cell device. In some examples, the flow cell device includes a hydrogel layer covering the surface of the flow cell device. In some examples, the flow cell device includes captured hydrogel beads or columns in the flow cell device. Therefore, the hydrogel deposited in the flow cell device may include a hydrogel layer or hydrogel beads captured in the flow cell device. In some examples, the genetic material encapsulated in the hydrogel is contacted with one or more reagents to perform nucleic acid processing. In some examples, the genetic material is retained in the hydrogel, and the reagent can pass through the hole of the hydrogel, while the genetic material is retained in the hydrogel layer, thereby allowing the reagent to enter and exit the reagent during the genetic material processing. The reagent may include a lysing agent, a nucleic acid purification agent, a DNA amplification agent, a labeling agent, a PCR agent, or other reagents for genetic material processing. Therefore, the hydrogel retains the genetic material itself in the hydrogel by allowing the reagent to enter and exit the hydrogel barrier, thereby retaining the genetic material in the hydrogel for the effective treatment of the genetic material.

[0251] In some examples, preparation of an entire DNA library can be seamlessly accomplished through multiple reagent exchanges inside the hydrogel by flowing reagents into a flow cell device while retaining the gDNA and its library products in the hydrogel.

[0252] In some examples, reagents are passed through a flow cell device to contact a hydrogel encapsulating cells or viral particles to purify and separate nucleic acids from cells or particles. Thus, for example, a lysis buffer flows through a flow cell device. As used herein, "shearing" refers to the disturbance or change of a cell wall or viral particle, thereby facilitating access to or release of cell RNA or DNA. Overall disturbance and cell wall rupture are usually unnecessary. The term "lysis buffer" refers to a buffer comprising at least one lysing agent. Typical enzyme lysing agents include, but are not limited to, lysozymes, glucosidases, enzymolytic sugars, shearing enzymes, proteinases K, proteinases E, and viral endolysins and exolysins. Thus, for example, by introducing lysing agents such as lysozymes and proteinases K into a flow cell device, cells in a hydrogel are sheared. In some examples, after the shearing process, the separated nucleic acids remain in the hydrogel in the flow cell device and can be used for further processing.

[0253] As used herein, unless otherwise indicated, the terms "isolated," "for isolating," "separating," "purifying," "for purifying," "purification," and grammatical equivalents thereof, as used herein, unless otherwise indicated, refer to the reduction of the amount of at least one contaminant (e.g., protein and / or nucleic acid sequence) obtained from a sample or a source (e.g., a cell) from which the substance was isolated. Thus, purification results in "enrichment" or an increase in the amount of a desired protein and / or nucleic acid sequence in a sample.

[0254] In some examples, the DNA separated after cell lysis can be amplified by amplification techniques as described herein. In some examples, for example, for single-cell mRNA sequencing, cDNA synthesis after cell lysis and second-strand synthesis of ribosomal RNA, as well as double-stranded DNA consumption and second-strand synthesis can be performed. In some examples, for example, for synthetic loading readout, a shearing step is not required because the genetic material in the hydrogel precursor solution or the hydrogel beads is an isolated nucleic acid and can be amplified by amplification techniques as described herein. Those skilled in the art will recognize that the steps provided herein can be modified according to specific applications and the steps of specific applications, and the disclosure herein generally covers nucleic acid library preparations.

[0255] Can be according to any suitable amplification method known in the art, including method described herein, amplify the encapsulated nucleic acid separated in the hydrogel.In some examples, the encapsulated nucleic acid is amplified in the hydrogel.In some examples, the hydrogel is degraded, wherein the encapsulated nucleic acid is released on the solid support of the flow cell device, and the nucleic acid is amplified in the flow cell device.Amplification can be carried out by techniques such as multiple displacement amplification (MDA), which is widely used in amplifying a small amount of DNA, especially the DNA amplified from a single cell.In some examples, amplification primers and enzymes are introduced into the flow cell device, through the holes of the hydrogel and hybridized with the encapsulated nucleic acid.Therefore, any amplification method described herein or generally known in the art can be used together with universal or target-specific primers to amplify the encapsulated nucleic acid by making a suitable amplification reagent flow through the flow cell device, thereby amplifying the nucleic acid encapsulated in the hydrogel of the flow cell device.

[0256] In some examples, a cluster amplification method is used to amplify the encapsulated nucleic acid, as exemplified by the disclosure of U.S. Patent Nos. 7,985,565 and 7,115,400, the entire contents of which are incorporated herein by reference as a whole. The combined materials of U.S. Patent Nos. 7,985,565 and 7,115,400 describe a method for nucleic acid amplification, which allows the amplified product to be fixed on a solid support to form an array consisting of a cluster or "colony" of fixed nucleic acid molecules. Each cluster or colony on this array is formed by a plurality of identical or substantially identical fixed polynucleotide chains and a plurality of identical fixed complementary polynucleotide chains. The array formed in this way is generally referred to as a "cluster array" in this article. The product of the solid phase amplification reaction, such as those described in U.S. Patent Nos. 7,985,565 and 7,115,400, is a so-called "bridged" structure formed by annealing a paired fixed polynucleotide chain and a fixed complementary chain, and both chains are preferably fixed to a solid support at the 5' end by covalent attachment. Cluster amplification methodology is an example of a method in which a fixed amplicon is produced using a fixed nucleic acid template. Other suitable methodologies can also be used to produce fixed amplicon by fixed DNA fragments produced according to the method provided herein. For example, whether or not one or both primers in each pair of amplification primers are fixed, one or more clusters or colonies can be formed by solid phase PCR. In some examples, encapsulated nucleic acids are amplified in a hydrogel and then deposited on a flow cell device in the form of an array or cluster. The clustering of a single seeding DNA molecule on the flow cell surface can be performed, for example, by standard clustering.

[0257] In some examples, the hydrogel is a reversible hydrogel that can degrade under appropriate conditions as described herein, including at elevated temperatures or in contact with a reducing agent. Figures 18A-18B As shown, the hydrogel can be a degradable hydrogel bead, thereby releasing the genetic material in the form of clusters. Fig.18A In this method, hydrogel beads are encapsulated individually and the beads are chemically ruptured to release the DNA for clustering. Fig.18B As shown, the DNA is clustered on the flow cell surface and is ready for sequencing.

[0258] Other amplification methods include isothermal amplification. Other non-PCR-based methods that can be used in the present disclosure include, for example, strand displacement amplification (SDA), which is described in, for example, Walker et al., Molecular Methods for Virus Detection, Academic Press, Inc., 1995; U.S. Patent Nos. 5,455,166 and 5,130,238; and Walker et al., Nucl. Acids Res. 20: 1691-96 (1992); or hyperbranched chain displacement amplification, which is described in, for example, Lage et al., Genome Research 13: 294-307 (2003), each of which is incorporated herein by reference in its entirety. Isothermal amplification methods can be used with Phi29 polymerase or Bst DNA polymerase large fragment (5'->3'exo-) of the displacement chain for random primer amplification of genomic DNA. The use of these polymerases takes advantage of their high productivity and strand displacement activity. High productivity allows polymerase to produce fragments of 10-20kb in length. As mentioned above, using a polymerase with low productivity and strand displacement activity, such as Klenow polymerase, smaller fragments can be produced under isothermal conditions. Other descriptions of amplification reactions, conditions and components are disclosed in U.S. Patent No. 7,670,810, the entire contents of which are incorporated herein by reference. In some examples, polymerases, reagents and components for implementing these amplification reactions are introduced into flow cell equipment, and can pass through hydrogel holes to interact with encapsulated nucleic acids, thereby amplifying nucleic acids in hydrogels (as described herein, whether hydrogel is a layer or hydrogel beads or columns coating the surface of flow cell equipment).

[0259] In some examples, the encapsulated nucleic acid is sequenced in whole or in part within the hydrogel. The encapsulated nucleic acid can be sequenced according to any suitable sequencing method, including those described herein, such as direct sequencing, including sequencing by synthesis, sequencing by ligation, sequencing by hybridization, nanopore sequencing, etc.

[0260] In some examples, the encapsulated nucleic acid of one or more amplifications can be subjected to SBS or other detection techniques, which relate to repeatedly delivering reagents in a cycle. For example, in order to start the first SBS cycle, one or more labeled nucleotides, DNA polymerases, etc. can be flowed into / flowed through a flow cell containing a nucleic acid array prepared by the method described herein. It is possible to detect those array sites where primer extension causes labeled nucleotides to be involved. Optionally, nucleotides can further include a reversible termination characteristic, which once adds nucleotides to a primer, terminates further primer extension. For example, a nucleotide analog with a reversible terminator portion can be added to a primer so that subsequent extension does not occur until a deblocking agent is delivered to remove the portion. Therefore, for an embodiment using reversible termination, a deblocking agent can be delivered to a flow cell (before or after detection). Washing can be performed between each delivery step. The cycle can then be repeated n times to extend the primer by n nucleotides, thereby detecting a sequence of length n. Exemplary SBS procedures, fluidic systems, and detection platforms that can be readily adapted for use with arrays produced by the methods of the present disclosure are described, for example, in Bentley et al., Nature 456:53-59 (2008); WO 04 / 018497; US 7,057,026; WO 91 / 06678; WO 07 / 123744; US 7,329,492; US 7,211,414; US 7,315,019; US 7,405,281; and US 2008 / 0108082, which are incorporated herein by reference in their entirety.

[0261] Exemplary methods of array-based expression and genotyping analysis useful for detection according to the present disclosure are described in U.S. Patent Nos. 7,582,420; 6,890,741; 6,913,884 or 6,355,431 or U.S. Patent Publication Nos. 2005 / 0053980A1; 2009 / 0186349A1 or US2005 / 0181440A1, each of which is incorporated herein by reference in its entirety.

[0262] In the method for separating nucleic acid, amplification and sequencing as described herein, various reagents are used for nucleic acid separation and preparation. Such reagents can include, for example, lysozyme, proteinase K, random hexamer, polymerase (for example, Φ29 DNA polymerase, Taq polymerase, Bsu polymerase), transposase (for example, Tn5), primer (for example, P5 and P7 joint sequence), ligase, catalytic enzyme, triphosphate deoxynucleotide, buffer or divalent cation. According to the needs of each processing step, these reagents are introduced into the flow cell device individually or in combination, and through the hole of the hydrogel in the flow cell device, and the genetic material is retained in the hydrogel and processed therein. The advantage of the method set forth herein is that they provide an encapsulated microenvironment for processing nucleic acid in the hydrogel on the flow cell device, thereby providing a simplified nucleic acid processing system. This enables single cell processing to be performed to quickly and effectively process the target nucleic acid in the flow cell device. The joint can include sequencing primer site, amplification primer site and index. In some examples, a nucleic acid library can be prepared in the hydrogel on the flow cell device. In some examples, for example, genetic material encapsulated in a hydrogel can be used for combinatorial indexing of single cells, for example using the contiguity-preserving transposition (CPTSeq) method. In some examples, nucleic acids from single cells can be barcoded by encapsulating the single cells after WGA amplification with barcode transposons that dissolve the hydrogel by contacting it with a reducing agent, for example to release genomic DNA for barcoding.

[0263] In addition, the examples of "spatial indexing" methods and techniques described herein shorten data analysis and simplify the method for preparing libraries from single cells and long DNA molecules. For single-cell sequencing, existing schemes involve efficient physical separation of cells, and unique barcoding of each separated cell, and bringing all materials back together to implement sequencing. The current scheme for synthesizing long reads usually utilizes cumbersome barcode steps, and brings each barcode fragment together for sequencing, and makes data analysis distinguish the genetic information from each barcode cell. In these long processes, genetic material is also lost, resulting in sequence deletions. The examples described herein not only shorten the process, but also improve the data resolution of single cells. In addition, the examples provided herein simplify the assembly of the genome of new organisms. The examples described herein can be used to reveal rare genetic variations and mutation co-occurrences. In some examples, the DNA library constrained in the hydrogel beads until released provides the opportunity to control the fragment size released on the surface by controlling the release process and the hydrogel formulation.

[0264] D. Preparation of Nucleic Acid Libraries on Flow Cell Devices in Hydrogels

[0265] In some examples, a sequencing library can be prepared from genetic material (e.g., target nucleic acid molecules) encapsulated in a hydrogel on a flow cell device. For example, a sequencing library can be prepared as described above for preparing a sequencing library in a hydrogel bead. In several examples, a target nucleic acid is isolated from a single cell encapsulated in a hydrogel on a flow cell device.

[0266] In some examples, the genetic material (such as single cell) trapped in the hydrogel on the hydrogel flow cell device is sheared, and the separated nucleic acid is further processed by amplification, labeling or other nucleic acid library preparation methods, and then sown on the surface of the flow cell device. In some examples, the solid carrier includes an array of holes or pits in the surface. It can be manufactured using a variety of techniques as known in the art, including but not limited to photolithography, imprinting technology, molding technology and micro-etching technology. As will be understood by those skilled in the art, the technology used will depend on the composition and shape of the array substrate. In some examples, the diameter of the array of holes or pits is about 10 μm to about 50 μm, for example, a diameter of 10 μm, 15 μm, 20 μm, 25 μm, 30 μm, 35 μm, 40 μm, 45 μm or 50 μm, or a diameter within the range defined by any two of the above values. In some examples, the depth of the hole or pit is 0.5 μm to 1 μm, such as 0.5 μm, 0.6 μm, 0.7 μm, 0.8 μm, 0.9 μm or 1 μm, or a depth within a range defined by any two of the above values. In some examples, the hole or pit is made of a hydrophobic material. In some examples, the hydrophobic material includes an amorphous fluoropolymer, including, for example, CYTOP, or In some examples, the hydrophobic nature of the pores improves separation of individual cell genomic DNA during enzymatic processing and reduces cross-talk between seeded DNA populations.

[0267] Examples of the systems and methods provided herein include kits comprising any one or more of a hydrogel polymer, a cross-linking agent, or a microfluidic device for preparing hydrogel beads encapsulating genetic material, and also comprising components that can be used to process the genetic material, including components for cell lysis, nucleic acid amplification and sequencing, or for nucleic acid library preparation, including lysozyme, proteinase K, random hexamer, polymerase (e.g., Φ29 DNA polymerase, Taq polymerase, Bsu polymerase), transposase (e.g., Tn5), primers (e.g., P5 and P7 adapter sequences), ligase, catalytic enzyme, deoxynucleotide triphosphates, buffers, or divalent cations as described herein and used for genetic material processing, respectively.

[0268] Other Examples

[0269] Item 1. A flow cell device for performing single-cell sequencing, comprising:

[0270] A solid support comprising a surface having a degradable hydrogel deposited thereon, wherein the degradable hydrogel comprises pores having a size that allows an agent to diffuse through the hydrogel and that is too small to allow genetic material to pass through the pores.

[0271] Item 2. The flow cell device of Item 1, wherein the solid support is functionalized with a surface polymer.

[0272] Item 3. The flow cell device of Item 2, wherein the surface polymer is poly(N-(5-azidoacetamidopentyl)acrylamide-co-acrylamide) (PAZAM) or silane-free acrylamide (SFA).

[0273] Item 4. The flow cell device of any one of items 1 to 3, wherein the flow cell comprises a patterned surface.

[0274] Item 5. The flow cell device of Item 4, wherein the patterned surface comprises holes.

[0275] Item 6. The flow cell device of Item 5, wherein the diameter of the pore is about 10 μm to about 50 μm, for example, a diameter of 10 μm, 15 μm, 20 μm, 25 μm, 30 μm, 35 μm, 40 μm, 45 μm, 50 μm or 50 μm, or within the range defined by any two of the above values, and wherein the depth of the pore is about 0.5 μm to about 1 μm, for example, 0.5 μm, 0.6 μm, 0.7 μm, 0.8 μm, 0.9 μm, or 1 μm, or within the range defined by any two of the above values.

[0276] Item 7. The flow cell device of any one of items 5-6, wherein the pores are composed of a hydrophobic material.

[0277] Item 8. The flow cell device of Item 7, wherein the hydrophobic material comprises an amorphous fluoropolymer, such as CYTOP, or

[0278] Item 9. The flow cell device of any one of items 1 to 8, wherein the degradable hydrogel is a hydrogel bead or a hydrogel layer.

[0279] Item 10. The device of the flow cell of Item 9, wherein the diameter of the hydrogel beads is about 2 μm to about 120 μm.

[0280] Item 11. The flow cell device of any one of items 1 to 10, wherein the hydrogel comprises polyethylene glycol (PEG)-thiol, PEG-acrylate, acrylamide, N,N'-bis(acryloyl)cystamine (BACy), PEG, polypropylene oxide (PPO), polyacrylic acid, polyhydroxyethyl methacrylate (PHEMA), polymethyl methacrylate (PMMA), poly N-isopropylacrylamide (PNIPAAm), polylactic acid (PLA), polylactic glycolic acid (PLGA), polycaprolactone (PCL), poly(vinyl sulfonic acid) (PVSA), poly(L- aspartic acid), poly(L-glutamic acid), polylysine, agar, agarose, alginate, heparin, alginate sulfate, dextran sulfate, hyaluronic acid, pectin, carrageenan, gelatin, chitosan, cellulose, collagen, bisacrylamide, diacrylate, diallylamine, triallylamine, divinyl sulfone, diethylene glycol diallyl ether, ethylene glycol diacrylate, polymethylene glycol diacrylate, polyethylene glycol diacrylate, trimethylolpropane trimethacrylate, ethoxylated trimethylol triacrylate, or ethoxylated pentaerythritol tetraacrylate, or a combination or mixture thereof.

[0281] Item 12. The flow cell device of Item 11, wherein the hydrogel comprises PEG-thiol / PEG-acrylate, acrylamide / N,N'-bis(acryloyl)cystamine (BACy), or PEG / PPO.

[0282] Item 13. The flow cell device of any one of items 1 to 12, wherein the genetic material comprises cells, nucleic acids or microorganisms.

[0283] Item 14. The flow cell device of Item 13, wherein the cells are mammalian cells or bacterial cells.

[0284] Item 15. The flow cell device of Item 13, wherein the cells are human cells.

[0285] Item 16. The flow cell device of any one of items 13-14, wherein the cell is an Escherichia coli cell, a Bacillus subtilis cell, an Aeromonas hydrophila cell, or a fibroblast cell.

[0286] Item 17. The flow cell device of Item 13, wherein the nucleic acid is DNA or RNA of 300 base pairs or greater.

[0287] Item 18. The flow cell device of any one of items 1 to 17, wherein the reagents include enzymes, chemicals and primers having a size of less than 50 base pairs.

[0288] Item 19, the flow cell device of any one of items 1-18, wherein the reagents include lysozyme, proteinase K, random hexamer, polymerase (Φ29 DNA polymerase, Taq polymerase, Bsu polymerase), transposase (Tn5), primer (P5) and P7 adapter sequence), ligase, catalytic enzyme, deoxynucleotide triphosphates, buffer or divalent cations.

[0289] Item 20. A system for single-cell sequencing of a pancreas, comprising:

[0290] a stage configured to hold the flow cell device of any one of items 1 to 19; a flow cell device of any one of items 1-19; and

[0291] Detectors used to obtain sequencing data.

[0292] Item 21. A method for preparing a nucleic acid library on a flow cell device, comprising:

[0293] Providing a flow cell device according to any one of items 1 to 19;

[0294] isolating nucleic acids from the genetic material in the hydrogel; and, preparing a nucleic acid library from the isolated nucleic acids.

[0295] Item 22. The method of Item 21, further comprising:

[0296] releasing the nucleic acid library from the hydrogel, thereby seeding the nucleic acid library onto the surface of the flow cell device; and

[0297] Amplify and sequence the nucleic acid library.

[0298] Item 23. The method of any one of items 21-22, wherein separating the nucleic acid from the genetic material in the hydrogel comprises contacting the genetic material with a lysing agent to extract the nucleic acid.

[0299] Item 24. The method of Item 23, wherein the cleavage agent comprises lysozyme or proteinase K.

[0300] Item 25. The method of any one of items 21 to 24, wherein preparing the nucleic acid library comprises contacting the genetic material with a transposase mixture comprising an adaptor sequence and a transposome.

[0301] Item 26, the method of any one of items 22-25, wherein releasing the nucleic acid library from the hydrogel comprises decomposing the hydrogel by contacting the hydrogel with a shearing mixture or by heating the hydrogel to a temperature of about 90°C, thereby releasing the nucleic acid library.

[0302] Item 27, the method of Item 26, wherein the shear mixture comprises dithiothreitol (DTT), tris(2-carboxyethyl)phosphine (TCEP), or tris(3-hydroxypropyl)phosphine (THP).

[0303] This application includes the following items:

[0304] 1. A method comprising:

[0305] The degradable hydrogel beads are loaded onto the sequencing flow cell under conditions sufficient to capture the degradable hydrogel beads on the surface of the sequencing flow cell, wherein:

[0306] Degradable hydrogel beads contain sequencing libraries prepared from the encapsulated genetic material; or

[0307] The degradable hydrogel beads contain encapsulated genetic material, and the method further comprises preparing a sequencing library from the genetic material captured in the degradable hydrogel beads; and

[0308] loading a liquid diffusion barrier onto a sequencing flow cell, which surrounds the hydrogel beads; and

[0309] The captured hydrogel beads are degraded in the presence of a liquid diffusion barrier to allow transport and seeding of the sequencing library onto the surface of a sequencing flow cell.

[0310] 2. The method of item 1, wherein the genetic material is selected from at least one of a target nucleic acid molecule, or a cell and a cell lysate containing the target nucleic acid molecule.

[0311] 3. The method of item 1 or 2, wherein the sequencing library comprises DNA or RNA with a length of at least 150 nucleotides.

[0312] 4. The method of item 2, wherein the target nucleic acid molecule is genomic DNA.

[0313] 5. The method of any of the preceding items, wherein the liquid diffusion barrier is an oil, a viscous aqueous solution, or a combination thereof.

[0314] 6. The method of item 5, wherein the oil is mineral oil, silicone oil, perfluorinated oil, or a combination of two or more thereof.

[0315] 7. The method of item 5, wherein the viscous aqueous solution is a solution comprising polyethylene glycol (PEG), polyvinyl pyrrolidone, pluronic dextran, sucrose, poly (N-isopropylacrylamide) or polyethylene oxide-polypropylene oxide-polyethylene oxide (PEO-PPO-PEO) / lithium bentonite, or a combination of two or more thereof.

[0316] 8. The method of any of the preceding items, wherein the hydrogel beads are degraded by one or more of the following:

[0317] (a) contacting the hydrogel beads with a reagent that is a shear-reversible cross-linker that cross-links the polymers of the hydrogel;

[0318] (b) heating the hydrogel beads to about 90° C.;

[0319] (c) exposing the hydrogel beads to light of a wavelength that shears the photo-cleavable cross-linking agent, which cross-links the polymers of the hydrogel; or

[0320] (d) (a) and (b); (a) and (c); (b) and (c); or a combination of (a), (b) and (c).

[0321] 9. The method of item 8, wherein the reagent comprises dithiothreitol (DTT), tris(2-carboxyethyl)phosphine (TCEP), tris(3-hydroxypropyl)phosphine (THP), or a combination of two or more thereof.

[0322] 10. The method of any of the preceding items, wherein the hydrogel beads have a diameter of about 5 μm to about 120 μm.

[0323] 11. The method of any of the preceding items, wherein the hydrogel beads are hollow hydrogel beads comprising a hollow core containing genetic material.

[0324] 12. The method of any of the preceding items, wherein the hydrogel beads contain pores of a diameter size large enough to allow reagents to diffuse through the hydrogel beads while retaining the encapsulated sequencing library.

[0325] 13. The method of claim 12, wherein the diameter of the pores is from about 10 nm to about 100 nm.

[0326] 14. The method of any of the preceding items, wherein preparing the sequencing library comprises performing a tagmentation reaction on the target nucleic acid molecules within the hydrogel beads.

[0327] 15. The method of item 14, wherein the tagmentation reaction comprises contacting the target nucleic acid molecule with a transposase mixture comprising an adapter sequence and a transposome.

[0328] 16. The method of any of the preceding items, wherein capturing hydrogel beads on the surface of the sequencing flow cell comprises one or more of:

[0329] Physical confinement of the hydrogel beads on the surface of a sequencing flow cell; and

[0330] Specific binding of a first member of a specific binding pair on a hydrogel bead to a second member of a specific binding pair on a surface of a sequencing flow cell.

[0331] 17. The method of claim 16, comprising physical confinement of hydrogel beads on the surface of a sequencing flow cell, wherein the diameter of the hydrogel beads is about 5% to about 30% greater than the height of the flow cell to confine the beads in the flow cell.

[0332] 18. The method of any of the preceding items, wherein the diameter of the hydrogel beads is about 110 μm and the height of the sequencing flow cell is about 100 μm.

[0333] 19. The method of claim 16, wherein the sequencing flow cell is a patterned flow cell, and the second member of the specific binding pair is located at a well of the patterned flow cell.

[0334] 20. The method of any of the preceding items, wherein the sequencing library is not barcoded to identify individual hydrogel beads.

[0335] 21. The method of any of the preceding items, further comprising amplifying the target nucleic acid molecule encapsulated by the degradable hydrogel beads.

[0336] 22. The method of claim 21, wherein the amplification involves multiple displacement amplification.

[0337] 23. The method of claim 21, wherein the encapsulated target nucleic acid molecule is genomic DNA and the amplification involves whole genome amplification.

[0338] 24. The method of any of the preceding items, further comprising sequencing the sequencing library.

[0339] 25. The method of claim 24, wherein the position of the sequencing library seeded from the corresponding degradable hydrogel beads on the flow cell surface is used as a spatial index for the reads generated by sequencing the sequence library.

[0340] 26. A flow cell device comprising:

[0341] A solid support comprising a surface having a degradable hydrogel deposited thereon, wherein the degradable hydrogel includes pores sized to allow diffusion of reagents through the hydrogel but too small to allow genetic material to pass through the pores.

[0342] 27. A system comprising:

[0343] a stand for holding the flow cell apparatus of item 26;

[0344] flow cell equipment; and

[0345] Detectors used to obtain sequencing data.

[0346] 28. A method comprising:

[0347] Providing the flow cell device of item 26;

[0348] separating nucleic acids from genetic material in the hydrogel; and

[0349] A nucleic acid library is prepared from the isolated nucleic acid.

[0350] Working Example

[0351] The following examples are provided to illustrate specific features of certain examples, but the scope of the claims should not be limited to those features exemplified.

[0352] Example 1

[0353] Flow cell capture of degradable hydrogel beads containing encapsulated nucleic acid molecules

[0354] This example demonstrates the preparation of hydrogel beads encapsulating nucleic acid molecules using manual vortexing and a microfluidic droplet generator.

[0355] The pore size of the hydrogel beads is chosen to allow diffusion of enzymes, chemicals, and smaller sized primers (<50 bps), but retain larger sized DNA (>300 bps), thereby allowing genomic DNA and generated DNA libraries to be retained within the gel microbeads during library preparation.

[0356] A 12% hydrogel solution was prepared from 40% acrylamide / bis 19:1 (BioRad #161-0144) diluted with deionized water. A 40% (w / v) acrylamide / N,N'bis(acryloyl)cystamine (BACy) (19:1) monomer stock solution was prepared (3.8 g acrylamide, 0.2 g BACy, and 6 mL double distilled (dd) H2O). The mixture was brought to a final volume of 10 mL. To prepare the solution, acrylamide was dissolved in 6 mL of ddH2O, and the resulting solution was used to dissolve BACy. The dissolution of the monomer is endothermic, so slightly heating the mixture will help to completely dissolve the monomer. The hydrogel solution was kept at 4°C until use. 35 μL of saturated potassium persulfate solution (KPS; Sigma) was added to 200 μL of the 12% hydrogel solution and mixed thoroughly.

[0357] The genomic DNA samples were transferred to sterile 1.7 mL test tubes. 235 μL of hydrogel-KPS solution was added to each test tube containing the genomic DNA sample. The hydrogel genomic DNA solution was then loaded into 600 μL of mineral oil with surfactant (4.5% Span80, 0.4% Tween20, and 0.05% Triton X-100). The solution was vortexed for 30 seconds to produce a droplet emulsion, and 25 μL of TEMED (Sigma) was immediately added, followed by another vortex of 30 seconds.

[0358] To prepare a 10% gel with an acrylamide / BACy ratio of 19:1 (2 mL), mix 0.96 mL of ddH2O, 0.5 mL of 40% acrylamide / BACy (19:1), 0.5 mL of 10x tris / borate / EDTA buffer (TBE), 20 μL of TEMED, and 20 μL of KPS (saturated).

[0359] To prepare a 5% gel with an acrylamide / BACy ratio of 19:1 (2 mL), mix 1.21 mL of ddH2O, 0.25 mL of 40% acrylamide / BACy (19:1), 0.5 mL of 10x TBE, 20 μL of TEMED, 20 μL of KPS (saturated). Allow the reaction to polymerize until gelation (6 min).

[0360] Hydrogel beads encapsulating genomic DNA are then produced. After incubation for 15 minutes to allow the hydrogel beads to fully crosslink, approximately 900 μL of petroleum ether is added to each test tube. The test tubes are vortexed to wash off the oil, and the supernatant is removed. The hydrogel beads are washed, then vortexed, and the beads are spun. The beads are resuspended and can be stored at 4°C for at least 3 weeks.

[0361] A method using manual emulsion as described above was used to produce hydrogel beads having a size distribution ranging from about 2 μm to about 100 μm in diameter.

[0362] In order to produce hydrogel beads with uniform size distribution, a microfluidic droplet generator was used (see Figure 3). The aqueous solution containing the hydrogel polymer and genomic DNA fragments was loaded onto the cartridge of the microfluidic droplet generator and introduced into the mineral oil of the microfluidic droplet generator ( Figure 3A ). The height of the microfluidic device is 120 μm, the width of the aqueous channel is 75 μm, and the width of the carrier oil channel is 78 μm. When using this device, the flow rate of the aqueous channel is 60 μL / min, and the flow rate of the carrier oil channel is 300 μL / min. Using this device, hydrogel beads with a diameter of about 120 μm are produced ( Figure 3B ). The bead size can be fine-tuned by adjusting the channel width, microfluidic device dimensions, and flow rate.

[0363] The hydrogel beads containing genomic DNA fragments are fixed to the MiSeq TM Sequencing flow cell ( Figure 3C ) (Illumina, San Diego, CA). Due to physical constraints, the beads are trapped in the flow cell. The diameter of the hydrogel beads is about 120 μm, and the height of the channel of the sequencing flow cell is about 100 μm. The flow cell with the trapped beads is inserted into the MiSeq TM Sequencer for further processing ( Figure 3D ).

[0364] Example 2

[0365] On-bead sequencing library preparation and flow cell seeding

[0366] This example illustrates a method for preparing a sequencing library from genomic DNA contained in hydrogel beads captured on a sequencing flow cell, and a method for subsequently seeding the prepared nucleic acid library on a flow cell.

[0367] As described in Example 1, the MiSeq TM Hydrogel beads containing encapsulated genomic DNA fragments are captured on the surface of the flow cell. A solution containing enzymes and reagents for preparing a DNA library from the genomic DNA in the beads captured on the sequencing flow cell is flowed onto the flow cell to prepare a DNA library in the hydrogel beads ( Figure 4A and 4B The pore size of the captured hydrogel beads allows the diffusion of enzymes, chemicals, and smaller-sized primers (<50 bps), but retains larger-sized DNA (>300 bps). Mineral oil is then loaded onto the sequencing flow cell to fill the gaps between the beads and surround the captured hydrogel beads containing the DNA library. The MiSeq TM The temperature of the flow cell was raised to 90°C for 3 minutes to denature the DNA library and degrade the hydrogel beads. Figure 4C As shown, the denatured DNA library diffuses out of the hydrogel beads and is retained in a region defined by the diameter of the bead due to the presence of mineral oil. Thus, in the presence of oil, seeding occurs close to the footprint of each hydrogel bead (based on the 120 μm diameter hydrogel beads, library seeding is limited to a region of approximately 120 μm diameter). TM The temperature of the flow cell was lowered to 60°C for 6 minutes, 40°C for 2 minutes, and 20°C for 2 minutes, respectively, to allow the single-stranded DNA library to hybridize with the surface P5 / P7 primers on the flow cell, thereby seeding the library onto the surface of the flow cell.

[0368] The seeded libraries can then be clustered and sequenced using standard SBS chemistry.

[0369] Example 3

[0370] Sequencing nucleic acids using hydrogel beads

[0371] This example provides results from a sequencing assay that uses hydrogel beads to spatially index nucleic acid molecules on the surface of a flow cell.

[0372] Three different workflows were tested for sequencing long DNA molecules (see Figures 5A-5CTwo different DNA fragment lengths (~100 kb and ~10 kb) were tested, as well as an on-bead MDA step prior to sequencing library preparation to amplify genomic DNA in the hydrogel beads.

[0373] Hydrogel beads containing encapsulated genomic DNA fragments of -100 kb or -10 kb were generated as described in Example 1. For each fragment length, the on-bead MDA prior to library generation was assessed.

[0374] The resulting hydrogel beads were loaded into the MiSeq TM Sequencing flow cell and using Nextera TM (Illumina, San Diego, CA) reagents and procedures were used to generate sequencing libraries through the tagmentation reaction. Mineral oil was then loaded into the flow cell to surround the captured beads. The temperature of the flow cell was then raised to 90°C for 3 minutes to denature the DNA library and degrade the hydrogel beads. The denatured DNA library diffused out of the hydrogel microbeads and was retained in the area defined by the diameter of the microbead due to the presence of mineral oil. TM The temperature of the flow cell was lowered to 60°C for 6 minutes, 40°C for 2 minutes, and 20°C for 2 minutes, respectively, to allow the single-stranded DNA library to hybridize with the surface P5 / P7 primers on the flow cell, thereby seeding the library onto the surface of the flow cell. The seeded library was then clustered and sequenced using standard SBS chemistry, and the reads were processed using gated and linked read analysis.

[0375] In the first assay (see Figure 6 ), hydrogel beads were generated that housed human (Corriell) genomic DNA with a fragment size of ∼100 kb, with ∼100 fragments per bead. No in-bead MDA amplification was performed prior to in-bead sequencing library generation. Gated read analysis of the resulting sequence reads (1 read per 328 or 400 bp) showed an average of ∼405 sequence islands per bead, an average island size of 64 kb, and an average of 33 clusters per island.

[0376] In the second assay (see Figure 7 ), hydrogel beads were generated containing human (Corriell) genomic DNA with a fragment size of ~100 kb, with ~50 fragments per bead. MDA amplification was performed before in-bead sequencing library generation. Linked read analysis of the resulting sequence reads showed an average of ~166 sequence islands per bead, an average island size of 58 kb, and an average of 85 clusters per island.

[0377] In the third assay (see Figure 8), hydrogel beads were generated containing human (Corriell) genomic DNA with a fragment size of ~10 kb, with ~100 fragments per bead. In-bead MDA amplification was performed before in-bead sequencing library generation. Linked read analysis of the resulting sequence reads showed an average of ~85 sequence islands per bead, an average island size of 10.4 kb, and an average of 57 clusters per island.

[0378] In summary, the results demonstrate the utility of the assay using hydrogel beads to provide spatial indexing for seeding and sequencing of long DNA molecules. Furthermore, the spatial isolation of the spots on the flow cell surface enables the reconstruction of target nucleic acid molecules from shorter sequence reads from individual spots.

[0379] Example 4

[0380] Hollow hydrogel beads

[0381] This example illustrates the construction of hydrogel beads with hollow cores that house encapsulated target nucleic acid molecules.

[0382] Fig.9A A schematic diagram illustrating the construction of a hollow hydrogel bead is provided. First, an inner hydrogel layer is formed, which accommodates encapsulated genetic material, such as a target nucleic acid molecule. The inner hydrogel layer is then encapsulated with an outer hydrogel layer. The inner hydrogel layer is then depolymerized using a reagent that does not depolymerize the outer hydrogel layer, so that the outer hydrogel layer has a hollow space that accommodates the genetic material.

[0383] Fig. 9B Micrographs of an inner polyacrylamide hydrogel core containing encapsulated nucleic acid molecules are shown before (left) and after (right) depolymerization of the core hydrogel using a depolymerizing agent that shears the cross-linkers used to form the inner hydrogel, encapsulated with a polyacrylamide outer shell. Fig. 9C Shown are micrographs of the inner agarose gel core containing encapsulated nucleic acid molecules before (left) and after (right) encapsulation with an outer polyacrylamide shell and depolymerization of the core hydrogel by heating to 60°C.

[0384] As described herein, the resulting hollow hydrogel beads containing the encapsulated nucleic acid molecules can be loaded onto a sequencing flow cell to sequence the nucleic acid molecules.

[0385] Example 5

[0386] Generation of degradable hydrogel microbeads encapsulating target nucleic acid molecules using cell lysates

[0387] This example provides results of a sequencing assay that spatially indexes nucleic acid molecules on a flow cell surface using hydrogel beads containing encapsulated target nucleic acid molecules prepared in the beads from cell lysates.

[0388] Human cells from tissue culture were added directly to lysis buffer (50 mM Tris-HCl pH 8.0, 5 mM EDTA, 0.5% SDS and 50 μg / ml RNase A) and incubated for 5 minutes. The hydrogel precursor solution described in Example 1 was then added to the lysate in a 1:1 ratio and the resulting solution was provided to the input of the droplet generator to produce hydrogel beads. The beads were loaded onto a sequencing flow cell, a sequencing library was prepared and seeded onto the flow cell surface, and sequencing assays were performed as described in Examples 2 and 3. The island size distribution and the longest island observed are shown in Fig. 10B and 10C middle.

[0389] Example 6

[0390] Sample multiplexing

[0391] This example illustrates an example of a sample indexing method that can be used to interrogate multiple nucleic acid samples on a single sequencing flow cell.

[0392] In order to generate linked long read information from multiple samples in the same flow pool lane, transposons with different indexes can be used to mark each sample with a different index, which then relies on the index to identify the cluster spots corresponding to each sample. Before the beads are captured on the flow pool, the target nucleic acid molecules of each sample are labeled with a unique index. As described in Example 1, different human genomic DNA samples are encapsulated in hydrogel beads and labeled separately using different index transposons before the beads are loaded into the flow pool. The hydrogel beads containing the labeled DNA are gathered and captured on the sequencing flow pool, and then the preparation of the sequencing library is completed, the liquid diffusion barrier is loaded on the sequence flow pool, and the hydrogel beads are degraded in the presence of the liquid diffusion barrier to seed the sequencing library onto the surface of the flow pool. The seeded spots contain different DNA index sequences corresponding to different samples and can be separated from each other during the read-out analysis process after sequencing.

[0393] In another example, in order to generate linked long read information from multiple samples in the same flow cell lane, a different indexing transposon is used for each sample, and the hydrogel beads of each sample are processed sequentially on the flow cell to identify cluster spots corresponding to each sample. The beads containing the first sample are loaded onto the flow cell, and the target nucleic acid is labeled using the indexing transposon. After the library of the first sample is released from the beads and seeded onto the flow cell, a second round of hydrogel beads containing the second target nucleic acid sample is loaded into the flow cell and labeled using a different indexing transposon to generate a second index library, which is released in a spatially restricted manner for seeding on the flow cell surface. This provides seeding spots containing different DNA index sequences corresponding to different samples, which can be separated from each other during the read-out analysis process after sequencing. Fig.11 An image of superimposed hydrogel DNA spots generated using this sequential seeding strategy from two different samples (each with a different DNA barcode introduced during the tagmentation step) is shown. Clustered spots from the first sample are marked with an asterisk (*); spots from the second sample are not marked.

[0394] In another embodiment, in order to generate linked long read information from multiple samples in the same flow cell lane, exogenous nucleic acid molecules can be incorporated into different target nucleic acid samples in the encapsulation step. Different human genomic DNA samples are mixed with different exogenous DNA markers (e.g., Phi-X, λ1, λ3 or λ3DNA), and the mixture is encapsulated in hydrogel beads as described in Example 1. The hydrogel beads generated by each sample are pooled, loaded onto the sequencing flow cell, labeled to generate a sequencing library, and degraded in the presence of a liquid diffusion barrier to seed the sequencing library on the flow cell surface. Exogenous nucleic acid molecules are used as markers to identify the seeded spots corresponding to each sample.

[0395] In another embodiment, in order to maximize the use of the flow cell for sequencing data generation, and optionally generate read information from multiple samples in the same flow cell channel, additional steps are added to the workflow after the sequencing library is seeded from the hydrogel beads. At this stage, the intergranular gaps between the hydrogel bead imprints on the flow cell have a lower seeding library density. In order to utilize the intergranular gaps, an additional seeding step is implemented using a conventional short-read sequencing library, which is generated by the same target nucleic acid sample as the target nucleic acid sample encapsulated in the hydrogel beads. The short-read library is seeded into the sequencing flow cell using standard methods and contains a DNA index different from the DNA index used by the library encapsulated in the hydrogel beads to separate the reads from the connected long read and short read libraries. Figure 12 shows the corresponding pseudo images before and after seeding from the intergranular gaps. Using this method, a larger coverage of the target DNA sample can be achieved, thereby improving the accuracy of SNP identification.

[0396] Example 7

[0397] Method for manufacturing a flow cell device having a hydrogel layer

[0398] The following examples illustrate methods of making a flow cell device having a hydrogel layer deposited thereon.

[0399] like Figure 1 As shown, a surface polymer, such as PAZAM or SFA, is coated on a flow cell device having a surface. Fig.13AStep (a). As shown in step (b), a hydrogel precursor solution having a hydrogel polymer, a crosslinker and cells is flowed into a flow cell device, covering the solid surface of the flow cell device. Most of the hydrogel precursor solution is replaced with oil to produce a residual hydrogel film containing genetic material. Then, as shown in step (c), an oil containing TEMED (containing 25 μL of TEMED in 600 μL of mineral oil) is flowed over the surface to initiate crosslinking of the residual hydrogel film. As shown in step (d), the oil containing the crosslinker is removed, leaving the cells in the crosslinked hydrogel matrix.

[0400] Example 8

[0401] Method for clustering seeded DNA molecules in a flow cell device having a hydrogel layer

[0402] The following example illustrates a method for clustering seeded DNA molecules in a flow cell device fabricated in Example 7, having cells encapsulated in a hydrogel layer.

[0403] Prepare the flow cell device of Example 7, which has a hydrogel layer with cells deposited therein. Introduce lysis buffer into the flow cell device, such as Fig. 13B As shown in step (a), the lysing agent in the lysis buffer penetrates the cell wall of the cells in the cross-linked hydrogel layer. The lysing agent used includes lysozyme or a detergent. Proteinase K is introduced into the flow cell device to release the nucleic acid from the bound complex.

[0404] Next, if Fig. 13B As shown in step (b) of , single cell genomic DNA molecules are amplified using MDA to produce several copies of the DNA by introducing the MDA reagent into the flow cell device. The surface of the flow cell device is then washed with a buffer to allow short amplicons to diffuse out of the hydrogel layer, and then oil is introduced into the flow cell device to cover the layer. The surface is heated to 80°C to promote lateral diffusion of the DNA molecules to seed them out of the initial capture position, as shown in FIG. Fig. 13B As shown in step (c). Once the DNA is seeded onto the PAZAM layer, the cross-linked gel is washed away using a reducing agent such as THP, TCEP or DTT, which decrosslinks the gel. Fig. 13B As shown in step (d).

[0405] Finally, cluster the individual seeding DNA molecules using eXAMP or standard clustering, as Fig. 13B As shown in step (e), the resulting sequencing data is assembled using the spatial information of the clusters, which can be obtained because clusters from the same cell are seeded in the same physical proximity.

[0406] Example 9

[0407] Method for manufacturing flow cell device using hydrogel column

[0408] The following example illustrates a method of making a flow cell device with a hydrogel deposited in a columnar form.

[0409] Preparation of hydrogel beads with genetic material encapsulated therein To prepare the hydrogel beads, the following method was used.

[0410] A 12% (w / v) hydrogel solution was prepared from 40% acrylamide / bis 19:1 (BioRad #161-0144) diluted with deionized water. A 40% (w / v) acrylamide / N,N'-bis(acryloyl)cystamine (BACy) (19:1) monomer stock solution (3.8 g acrylamide, 0.2 g BACy, and 6 mL double distilled (dd) H2O) was prepared and the final volume was adjusted to 10 mL. The solution was prepared by first dissolving acrylamide in 6 mL of ddH2O, which was then used to dissolve BACy. The dissolution of the monomer is endothermic, so slightly heating the mixture helps to completely dissolve the monomer. The hydrogel solution was kept at 4°C until use. 35 μL of saturated potassium persulfate solution (KPS; Sigma) was added to 200 μL of the 12% hydrogel solution and mixed thoroughly. As described herein, the hydrogel solution can be used to encapsulate genetic material, including DNA or cells.

[0411] For DNA encapsulation, 20 μL of Coriell DNA solution (10 ng / μL) was added to 235 μL of hydrogel / KPS solution. 20 μL of hydrogel solution containing Coriell DNA was added to each sample well of the droplet generator plate (BioRAD QX200), and 70 μL of oil was added to each well. 20,000 droplets were formed 2 minutes after the plate was loaded into the droplet generator. 50 μL of TEMED oil (25 μL TEMED in 600 μL mineral oil) was added to each collected droplet to crosslink the beads. After incubation for 15 minutes, the hydrogel was completely crosslinked. The hydrogel beads containing Coriell DNA were directly loaded into the MiSeq TM The flow cell (Illumina, Inc., San Diego, CA) was then washed with PR2, as shown in Figure 14. The diameter of the hydrogel beads is approximately 120 μm, which allows them to be fixed within the 100 μm flow cell channel, forming a column within the flow cell device. The flow cell device with the hydrogel beads captured therein was then prepared for DNA processing.

[0412] For cell encapsulation, samples containing E. coli cells stored at -80°C were thawed at room temperature. 100 μL of the bacterial solution was transferred to a sterile 1.7 mL test tube, and the sample was washed once with 1 mL of 0.85% NaCl. The sample was pelleted and the wash solution removed. The bacterial pellet was stored as described below for mixing with the hydrogel solution.

[0413] 5 μL of the E. coli resuspension in PR2 was transferred to a clean PCR tube, 200 μL of the hydrogel plus KPS mixture was added, and the wells were mixed. 20 μL of the E. coli polymer mixture solution as described above was added to each sample well of the droplet generator plate (BioRADQX200), and 70 μL of oil was added to each oil well. After loading the plate into the droplet generator, approximately 20,000 droplets were formed within 2 minutes, and 50 μL of TEMED oil (25 μL TEMED in 600 μL mineral oil) was added to each droplet collected. After incubation for 15 minutes, the hydrogel was completely cross-linked. The beads were loaded directly into the MiSeq TM The flow cell is then washed with PR2 and the gel beads are approximately 120 μm in diameter and are stuck in the 100 μm high flow cell channels. The flow cell can then be used to process bacterial cells and nucleic acids for nucleic acid library preparation.

[0414] Hydrogel beads containing Coriell DNA or bacterial cells can be dehydrated to reduce the size of the beads before they are introduced into the flow cell device. Figures 16A-16C As shown in , the dehydrated beads containing the sample are engineered to dynamically adjust by adjusting their hydration level. The dehydrated beads ( Fig.16A ) fit easily into a flow cell with a channel height of 100 μm. As the hydrogel beads hydrate, they begin to grow ( Fig. 16B ), and eventually reaches its original size of 105 μm ( Fig. 16C ).

[0415] like FIG. 15A to FIG. 15C As shown, the flow cell device may include an etched surface that includes a pattern to individually isolate and locate each hydrogel bead. The patterned microwell array can be used to capture the hydrogel beads in a dehydrated state. Reagents can then be flowed through the flow cell to rehydrate the hydrogel beads to fix them in the channel and continue with downstream assays. The device can be coated with a hydrophobic material (which can be CYTOP, or or other hydrophobic materials) are then photolithographically patterned with an array of microwells (diameter and spacing vary with the target hydrogel bead size) and etched away so that the wells can be etched or the surface can be functionalized to capture hydrogel beads with an array. The patterned surface of the flow cell device can be used to increase the number of hydrogel beads within the flow cell device and to precisely release DNA at a specified location within the flow cell device.

[0416] Example 10

[0417] DNA library preparation in flow cell devices

[0418] The following example illustrates a method for preparing a DNA library on a flow cell device in which a hydrogel is deposited in the form of a hydrogel column.

[0419] The flow cell device as described in Example 9 has hydrogel beads fixed therein to form a hydrogel column for DNA library preparation. Tn5 transposome reagent (NexteraTM, Illumina Inc.) is loaded into the flow cell and incubated at 55°C for 5 minutes. The joint containing P5 and P7 ends is inserted into DNA. 50 μL of termination buffer is loaded into the flow cell to knock out the Tn5 enzyme. Bsu polymerase and a salt mixture of nucleotides for filling the gap are loaded into the flow cell device to prepare a nucleic acid library, which is prepared and fixed in a hydrogel bead matrix. PR2 washing buffer is loaded onto the flow cell device, and the temperature is raised to 90°C for 3 minutes to denature the DNA library, which diffuses out of the hydrogel beads. The temperature is then reduced to 60°C for 6 minutes, 40°C for 2 minutes and 20°C for 2 minutes, so that the single-stranded DNA library is hybridized with the surface P5 / P7 primers to perform cluster amplification. The flow cell is directly used for 30 cycles of bridge amplification, linearization and sequencing primer preparation. Then 2 x 150 sequencing cycles were performed and the determined sequences were aligned with the Coriell sequences.

[0420] Fig.19A and 19B Fluorescence imaging of dyed hydrogel beads containing Coriell DNA is shown ( Fig.19A ) and the cluster gradient density of the seeded amplified DNA ( Fig.19B ). The sequencing results of human gDNA are provided in FIG20 . Fig. 20A is the overall Q score of a single experimental read. Fig. 20B The mismatch rate from the same experiment is shown. The sequencing results include 151,101 clusters / blocks, 92% clusters, 67% alignment, 0.41% mismatch rate, and a median length of 186.

[0421] Embodiment 11

[0422] DNA Isolation and Library Preparation from Bacterial Cells in a Flow Cell Device

[0423] The following examples illustrate methods for isolating DNA from bacterial cells in a flow cell device and preparing a DNA library on a flow cell device in which a hydrogel is deposited in the form of a hydrogel column encapsulating the bacterial cells.

[0424] A flow cell device of Example 9 having hydrogel beads and bacterial cells encapsulated therein is provided. 100 μL of bacterial lysis reagent (Life Technologies, 0.5 mg lysozyme in 100 μL resuspension buffer Charge Switch kit) is loaded into the flow cell and incubated at 37°C for 10 minutes. Proteinase K reagent is then loaded into the flow cell and incubated at 55°C for 20 minutes to completely digest the protein. In this step, the E. coli gDNA is exposed but fixed within the hydrogel beads, which are captured in the flow cell device. After washing with PR2, the Tn5 transposome reagent (Nextera TM , Illumina Inc.) was loaded into the flow cell and incubated at 55°C for 5 minutes. The adapter containing P5 and P7 ends was inserted into the DNA. 50 μL of termination buffer was loaded into the flow cell device to inactivate the Tn5 enzyme. An extension mixture containing Bsu polymerase and nucleotides for filling the gap was loaded onto the device to prepare an E. coli nucleic acid library, which was fixed in the hydrogel beads captured in the flow cell device. Then PR2 washing buffer was added, and the temperature was raised to 90°C for 3 minutes to denature the DNA library, which diffused out of the hydrogel beads. The temperature was then lowered to 60°C for 6 minutes, 40°C for 2 minutes, and 20°C for 2 minutes to hybridize the single-stranded DNA library with the surface P5 / P7 primers for cluster amplification. The flow cell was directly used for 30 cycles of bridge amplification, linearization, and sequencing primer preparation. Then 2x150 sequencing cycles were performed, and the determined sequence was aligned with the E. coli sequence.

[0425] Fig.21A A method for preparing a nucleic acid library consistent with Example 11 is schematically shown. Cells are separated into hydrogel beads, loaded onto a flow cell device, and rehydrated to immobilize the hydrogel beads within the flow cell device. A lysing agent lyses the cells in the hydrogel beads and performs library preparation on bacterial DNA. The DNA is then released and seeded onto the surface of the flow cell device surrounding the beads. Fig. 21B As shown in , the DNA library is encapsulated in the hydrogel beads before release and diffuses from the hydrogel beads after release ( Fig. 21C ). Fluorescence imaging of SYTOX dye clusters revealed distinct clusters in close proximity to the original gel beads ( Fig.21D ). Scale bar = 50 μm.

[0426] All documents and similar materials cited in this application, including but not limited to patents, patent applications, articles, books, papers and web pages, regardless of the format of these documents and similar materials, are expressly incorporated herein by reference in their entirety. If one or more of the incorporated documents and similar materials differ or conflict with this application, including but not limited to defined terms, term usage, described technology, etc., this application shall prevail.

[0427] The terms "substantially" and "approximately" used throughout the specification are used to describe and explain small fluctuations. For example, they may refer to less than or equal to ±5%, such as less than or equal to ±2%, such as less than or equal to ±1%, such as less than or equal to ±0.5%, such as less than or equal to ±0.2%, such as less than or equal to ±0.1%, such as less than or equal to ±0.05%.

[0428] All combinations of all material combinations of the aforementioned concepts appearing at the end of this disclosure as claimed subject matter are intended to be disclosed herein as part of the subject matter of the present invention. It should also be understood that terms explicitly adopted herein that may also appear in any disclosure incorporated by reference should be given the meaning most consistent with the specific concepts disclosed herein.

[0429] It will be apparent that the precise details of the disclosed methods may be changed or modified without departing from the spirit of the described examples. We claim all such modifications and variations that come within the scope and spirit of the following claims.

Claims

1. A method comprising: loading the degradable hydrogel beads onto a substrate under conditions sufficient to capture the degradable hydrogel beads on the surface of the substrate, wherein each degradable hydrogel bead comprises (i) a copy of at least one sequencing library, or (ii) encapsulated genetic material, and the method further comprises preparing at least one sequencing library in each of the plurality of captured degradable hydrogel beads; loading a liquid diffusion barrier onto the substrate, which surrounds the hydrogel beads; and The captured hydrogel beads are degraded in the presence of a liquid diffusion barrier to substantially inhibit diffusion of at least one sequencing library beyond the diameter of the corresponding hydrogel bead and to allow transport and seeding of the at least one sequencing library onto a surface of a substrate relatively proximate to the corresponding hydrogel bead print.

2. The method of claim 1, wherein the hydrogel beads are degraded by: (a) contacting the hydrogel beads with a reagent that is a shear-reversible cross-linker that cross-links the polymers of the hydrogel; (b) heating the hydrogel beads to about 90° C.; (c) exposing the hydrogel beads to light of a wavelength that shears the photo-cleavable cross-linking agent, which cross-links the polymers of the hydrogel; or (d) (a) and (b); (a) and (c); (b) and (c); or a combination of (a), (b) and (c).

3. The method of claim 2, wherein the reagent comprises dithiothreitol (DTT), tris(2-carboxyethyl)phosphine (TCEP), tris(3-hydroxypropyl)phosphine (THP), or a combination of two or more thereof.

4. The method of any of the preceding claims, wherein the hydrogel beads have a diameter of about 5 μm to about 120 μm.

5. The method of any one of the preceding claims, wherein the hydrogel beads are hollow hydrogel beads comprising a hollow core housing the genetic material.

6. The method of any of the preceding claims, wherein the hydrogel beads contain pores of a diameter size large enough to allow the agent to diffuse through the hydrogel beads.

7. The method of claim 6, wherein the diameter of the pores is from about 10 nm to about 100 nm.

8. The method of any of the preceding claims, wherein preparing the sequencing library comprises performing a tagmentation reaction on the target nucleic acid molecules within the hydrogel beads.

9. The method of claim 8, wherein the tagmentation reaction comprises contacting the target nucleic acid molecule with a transposase mixture comprising an adapter sequence and a transposome.

10. The method of any of the preceding claims, wherein capturing hydrogel beads on the surface of the substrate comprises: Physical confinement of the hydrogel beads on the surface of the substrate; specific binding of a first member of a specific binding pair on the hydrogel bead to a second member of a specific binding pair on the substrate surface, or both.

11. The method of claim 10, comprising physically constraining the hydrogel beads to the surface of the substrate, wherein the diameter of the hydrogel beads is about 5% to about 30% greater than the height of the substrate to constrain the beads to the substrate.

12. The method of any of the preceding claims, wherein the diameter of the hydrogel beads is about 110 μm and the height of the substrate is about 100 μm.

13. The method of claim 12, wherein the substrate is a patterned flow cell and the second member of the specific binding pair is located at a well of the patterned flow cell.

14. The method of any of the preceding claims, further comprising amplifying the target nucleic acid molecules encapsulated by the degradable hydrogel beads.

15. The method of claim 14, wherein the amplification involves multiple displacement amplification.

16. The method of any preceding claim, wherein the substrate comprises a solid support.

17. The method of any preceding claim, wherein the substrate comprises a flow cell apparatus.

Images