Camellia sinensis anti-empoa ssr molecular marker and application thereof

Abstract

The application relates to the technical field of molecular markers, and discloses a tea tree anti-ephylla avaria SSR molecular marker and application thereof; the SSR molecular marker primer amplifies simple repeat sequences of genes including one or more of CsTIFY1, CsTIFY2, CsTIFY3, CsTIFY4, CsTIFY5 and CsTIFY6. The application finds that the expression amount of the six CsTIFY genes is significantly up-regulated in the anti-ephylia avaria response process; 132 primers are designed by searching the SSR sites of the six CsTIFY genes; 5 SSR bands with obvious polymorphism and clear bands are screened through capillary electrophoresis; and in combination with the tea ephylia avaria resistance phenotype of 24 tea tree germplasm resources, it is found that the typing success rate of the SSR molecular marker is from 58.3% (CsTIFY2-7) to 83.3% (CsTIFY4-33), which can provide a theoretical basis for early identification of tea tree anti-ephylia avaria and molecular genetic breeding.

Description

Technical Field

[0001] This invention relates to the field of molecular marker technology, and in particular to an SSR molecular marker for tea plant resistance to the small green leafhopper and its application. Background Technology

[0002] Tea (Camellia sinensis), as one of the world's important economic crops, faces threats from various pests, among which the tea green leafhopper is of particular concern due to its highly damaging effects on tea shoots and tender leaves. The rapid reproduction and strong selective infestation capabilities of the tea green leafhopper seriously threaten the growth and yield of tea.

[0003] TIFY transcription factors play a wide range of important functions in plant growth and development. Studies have shown that members of the TIFY family influence plant stress resistance and hormone response mechanisms by regulating the jasmonic acid (JA) signaling pathway. Based on the types of domains they contain, the TIFY family can be divided into four subfamilies: TIFY, ZML (ZIM & ZIM-like), JAZ (jasmonate-ZIM-domain), and PPD (PEAPOD). In recent years, the role of the TIFY transcription factor family in plant insect resistance mechanisms has attracted widespread attention. JAZ proteins of the TIFY family are key repressors in the JA signaling pathway, capable of regulating JA signal transduction to enhance plant insect resistance responses. In alfalfa (Medicago sativa L.), the expression of MsTIFY14 was significantly upregulated in both thrips-resistant and susceptible alfalfa varieties 14 days after thrips infection.

[0004] Simple repeat sequences (SSRs), as a class of repetitive sequences in the genome, are characterized by 1 to 6 nucleotide units, such as (CA)n, (AT)n, and (GGC)n. Due to their abundance, high polymorphism, low cost, and ease of operation, SSR molecular markers have been widely used in plant genetic mapping, genetic diversity analysis, gene localization, and cloning. Summary of the Invention

[0005] To address the aforementioned problems, this invention discloses an SSR molecular marker for tea plant resistance to the tea green leafhopper and its application. This invention discovered that the expression levels of six CsTIFY genes were significantly upregulated during the tea green leafhopper resistance response. Further SSR loci were searched for these six CsTIFY genes, and 132 primers were designed. Five SSR bands with significant polymorphism and clear bands were screened by capillary electrophoresis. Combined with the tea green leafhopper resistance phenotypes of 24 tea plant germplasm resources, the success rate of SSR molecular marker typing ranged from 58.3% (CsTIFY2-7) to 83.3% (CsTIFY4-33), providing a theoretical basis for early identification and molecular genetic breeding of tea plant resistance to the tea green leafhopper.

[0006] On one hand, the present invention provides an SSR molecular marker primer for tea tree resistance to small green leafhopper, wherein the SSR molecular marker primer amplifies simple repetitive sequences of one or more genes selected from CsTIFY1, CsTIFY2, CsTIFY3, CsTIFY4, CsTIFY5 and CsTIFY6.

[0007] CsTIFY1, CsTIFY2, CsTIFY3, CsTIFY4, CsTIFY5, and CsTIFY6 all belong to the TIFY family of genes. Specifically, the gene number for CsTIFY1 is GWHGACFB004081, for CsTIFY2 it is GWHGACFB028923, for CsTIFY3 it is GWHGACFB013026, for CsTIFY4 it is GWHGACFB021202, for CsTIFY5 it is GWHGACFB022136, and for CsTIFY6 it is GWHGACFB005241. These genes can be queried from the tea plant genome database at http: / / tpia.teaplants.cn / using their corresponding gene numbers.

[0008] This invention re-annotated the online published transcriptome data on tea plant resistance to leafhopper (PRJNA553681) into the 'Longjing 43' genome. Differentially expressed genes were screened using the DESeq2 software package (q value < 0.005 & |log2(Foldchange) > 1|), yielding 3795 differentially expressed genes (DEGs). KEGG pathway enrichment analysis was then performed to identify key genes for leafhopper resistance. Six members of the tea plant TIFY family—CsTIFY1, CsTIFY2, CsTIFY3, CsTIFY4, CsTIFY5, and CsTIFY6—were found to be significantly upregulated, indicating that CsTIFY genes exhibit similar expression trends during the leafhopper resistance response. It is speculated that CsTIFY family members regulate the leafhopper resistance mechanism in tea plants through JA signal transduction. Subsequent experiments involved SSR locus retrieval and primer design for members of the CsTIFY family, and verified that primers amplifying the genes of CsTIFY family members could serve as SSR molecular marker primers for tea tree resistance to the green leafhopper, thus enabling genotyping of tea tree resistance to the green leafhopper.

[0009] Therefore, based on the role of the six tea plant TIFY family member genes discovered in this invention in the tea plant's resistance to the green leafhopper pathway, SSR molecular marker primers can be designed for these six tea plant TIFY family member genes. This invention has searched for SSR sites in the six tea plant TIFY family member genes, and found 15 single nucleotide repeat units, 8 dinucleotide repeat units, and 2 trinucleotide repeat units based on different repeating nucleotide units. It does not exclude the possibility that other SSR sites may also exist in the genes. It is understood that different primers can be designed for different SSR sites in the six tea plant TIFY family member genes, and different primers can also be designed for the same SSR site. The only difference between different primers is their efficacy level in genotyping tea plant's resistance to the green leafhopper. Therefore, any SSR molecular marker primers designed for one or more of the genes CsTIFY1, CsTIFY2, CsTIFY3, CsTIFY4, CsTIFY5, and CsTIFY6 are within the protection scope of this invention.

[0010] Preferably, the SSR molecular marker primers include one or more of the following: CsTIFY2-7 primers, CsIFY2-11 primers, CsTIFY3-6 primers, CsTIFY3-15 primers, and CsTIFY4-33 primers;

[0011] The forward primer of the CsTIFY2-7 primer has a nucleotide sequence as shown in Seq ID NO.1, and the reverse primer of the CsTIFY2-7 primer has a nucleotide sequence as shown in Seq ID NO.2;

[0012] The forward primer of the CsTIFY2-11 primer has a nucleotide sequence as shown in Seq ID NO.3, and the reverse primer of the CsTIFY2-7 primer has a nucleotide sequence as shown in Seq ID NO.4;

[0013] The forward primer of the CsTIFY3-6 primer has a nucleotide sequence as shown in Seq ID NO.5, and the reverse primer of the CsTIFY2-7 primer has a nucleotide sequence as shown in Seq ID NO.6;

[0014] The forward primer of the CsTIFY3-15 primer has a nucleotide sequence as shown in Seq ID NO.7, and the reverse primer of the CsTIFY2-7 primer has a nucleotide sequence as shown in Seq ID NO.8;

[0015] The forward primer of the CsTIFY4-33 primer has a nucleotide sequence as shown in Seq ID NO.9, and the reverse primer of the CsTIFY2-7 primer has a nucleotide sequence as shown in Seq ID NO.10.

[0016] The names of the CsTIFY2-7 primer, CsIFY2-11 primer, CsTIFY3-6 primer, CsTIFY3-15 primer, and CsTIFY4-33 primer are used for naming purposes only and have no other meaning. Their core characteristic lies in their nucleotide sequences.

[0017] This invention first designed and obtained a total of 132 SSR primers, including 15 primers for the CsTIFY1 gene, 13 primers for the CsTIFY2 gene, 47 primers for the CsTIFY3 gene, 40 primers for the CsTIFY4 gene, 15 primers for the CsTIFY5 gene, and 2 primers for the CsTIFY6 gene. Nine primers with clear amplification bands and good polymorphism were screened out by agarose gel electrophoresis. Further screening by capillary electrophoresis revealed the aforementioned primers CsTIFY2-7, CsTIFY2-11, CsTIFY3-6, CsTIFY3-15, and CsTIFY4-33. These primers have clear amplification conditions and good polymorphism, and are therefore preferred embodiments of this invention.

[0018] Using the aforementioned primers CsTIFY2-7, CsIFY2-11, CsTIFY3-6, CsTIFY3-15, and CsTIFY4-33, total DNA from tea plants was amplified, yielding SSR molecular marker sequences of different fragment sizes. These fragment sizes were then used to genotype the tea plant's resistance to the leafhopper. Twenty-four tea plant germplasm resources were successfully classified into two categories: those with strong resistance to the leafhopper and those with weak resistance. Cross-matching revealed high accuracy, with the CsTIFY4-33 primer achieving a genotyping accuracy of 83.3%.

[0019] It is worth noting that the above typing uses a clustering method, and its accuracy is correlated with the sample abundance of the target germplasm resources for typing. The tea germplasm resources selected in this invention lack samples with severe or higher damage from the small green leafhopper. Therefore, the accuracy of some primers is not very high. It is understandable that when the sample abundance of the cluster analysis is increased, the accuracy of these primers will increase significantly. It is also possible that higher accuracy can be obtained by using other analysis methods that do not involve cluster analysis. Meanwhile, the accuracy does not affect the application of the above primers in the early identification of tea tree resistance to small green leafhoppers and / or in the breeding of tea tree resistance to small green leafhoppers. For any SSR molecular marker primers designed for one or more genes of CsTIFY1, CsTIFY2, CsTIFY3, CsTIFY4, CsTIFY5 and CsTIFY6, the key to their application lies in the role of the six tea tree TIFY family member genes discovered in this invention in the tea tree resistance to small green leafhopper pathway. For the five SSR molecular marker primers preferred in this invention, their clear amplification bands and good polymorphism are the key to the good application of the above preferred primers.

[0020] On the other hand, the present invention provides an SSR molecular marker for tea tree resistance to the small green leafhopper, the SSR molecular marker comprising a simple repeating sequence of one or more genes selected from CsTIFY1, CsTIFY2, CsTIFY3, CsTIFY4, CsTIFY5 and CsTIFY6.

[0021] On the other hand, the present invention provides a method for preparing an SSR molecular marker for tea plant resistance to the small green leafhopper, which involves amplifying total DNA of tea plant using primers to obtain a simple repeating sequence; the primers are the SSR molecular marker primers for tea plant resistance to the small green leafhopper.

[0022] On the other hand, the present invention provides the application of the SSR molecular marker primers for tea tree resistance to small green leafhopper in the early identification of tea tree resistance to small green leafhopper and / or in the breeding of tea tree resistance to small green leafhopper.

[0023] On the other hand, the present invention provides the application of the SSR molecular marker primers for tea tree resistance to small green leafhopper in the identification of tea tree plant germplasm resources, the study of genetic diversity, the construction of genetic maps, the identification of seed purity, the kinship of populations and evolution or genetic breeding.

[0024] On the other hand, the present invention provides the application of the SSR molecular markers for tea tree resistance to small green leafhopper in the early identification of tea tree resistance to small green leafhopper and / or in the breeding of tea tree resistance to small green leafhopper.

[0025] On the other hand, the present invention provides the application of the SSR molecular marker of tea tree resistance to small green leafhopper in the identification of tea tree plant germplasm resources, the study of genetic diversity, the construction of genetic maps, the identification of seed purity, the kinship of populations and evolution or genetic breeding.

[0026] On the other hand, the present invention provides an application of tea plant TIFY family member genes in the early identification of tea plant resistance to small green leafhopper and / or in tea plant resistance to small green leafhopper breeding, wherein the tea plant TIFY family member genes include one or more of CsTIFY1, CsTIFY2, CsTIFY3, CsTIFY4, CsTIFY5 and CsTIFY6.

[0027] On the other hand, the present invention provides the use of tea plant TIFY family member genes for preparing SSR molecular markers and / or tea plant SSR molecular marker primers for resistance to small green leafhopper, wherein the tea plant TIFY family member genes include one or more of CsTIFY1, CsTIFY2, CsTIFY3, CsTIFY4, CsTIFY5 and CsTIFY6.

[0028] To address the current gap in research on molecular markers related to tea plant resistance to the small green leafhopper, the research team of this invention obtained SSR molecular markers and primers for tea plant resistance to the small green leafhopper through gene screening, primer design screening, and validation. The research methods, SSR molecular markers, and primers of this invention can be widely applied to tea plant variety identification, genetic structure and resource diversity analysis, genetic map construction, functional gene mapping and QTL mapping, seed purity identification, and marker-assisted breeding research. This facilitates further research on tea plant resistance genes to the small green leafhopper and tea plant genetic polymorphism, promoting the in-depth development of tea plant resources.

[0029] In summary, this invention has the following beneficial technical effects: This invention discovered that the expression levels of six CsTIFY genes were significantly upregulated during the resistance to the tea green leafhopper. Further, SSR loci were searched for these six CsTIFY genes, and 132 primers were designed. Five SSR bands with obvious polymorphism and clear bands were screened by capillary electrophoresis. Combined with the tea green leafhopper resistance phenotypes of 24 tea germplasm resources, the success rate of SSR molecular marker typing ranged from 58.3% (CsTIFY2-7) to 83.3% (CsTIFY4-33), providing a theoretical basis for the early identification of tea resistance to the tea green leafhopper and for molecular genetic breeding. Attached Figure Description

[0030] Figure 1 Heatmap of differentially expressed genes in tea trees affected by pests; where CK represents control; MD represents mechanical damage; and LD represents pest infestation.

[0031] Figure 2 : Diagram of differential gene pathway analysis;

[0032] Figure 3 Gene expression levels of 6 members of the TIFY family in tea plants;

[0033] Figure 4 Agarose gel electrophoresis detection bands of DNA extracted from 24 tea germplasm resources;

[0034] Figure 5 SSR-PCR capillary electrophoresis image of CsTIFY2-7 primers;

[0035] Figure 6 SSR-PCR capillary electrophoresis image of CsTIFY2-11 primers;

[0036] Figure 7 SSR-PCR capillary electrophoresis image of CsTIFY3-6 primers;

[0037] Figure 8 SSR-PCR capillary electrophoresis image of CsTIFY3-15 primers;

[0038] Figure 9 SSR-PCR capillary electrophoresis image of CsTIFY4-33 primers;

[0039] Figure 10 Genetic relationship clustering diagram of tea germplasm resources constructed by genotyping 24 tea germplasm resources using 5 polymorphic SSR molecular markers. Detailed Implementation

[0040] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available. Unless otherwise specified, the basic experimental methods involved in the following embodiments are experimental methods found in existing textbooks or literature, and routine adjustments to these methods do not affect the experimental results.

[0041] Example 1: Screening for tea plant genes resistant to small green leafhopper

[0042] In this embodiment, the online published transcriptome data on tea plant resistance to the small green leafhopper (PRJNA553681) was re-annotated into the 'Longjing 43' genome. Differentially expressed genes were screened using the DESeq2 software package (q value < 0.005 & |log2(Foldchange) > 1|), yielding a total of 3795 differentially expressed genes (DEGs). Figure 1As shown, CK represents the control; MD represents mechanical damage; and LD represents insect infestation. Differentially identified genes were mainly enriched in pathways such as sugar metabolism, environmental information processing, plant hormone signal transduction, and phenylpropanone biosynthesis. Figure 2 As shown.

[0043] Kobas software was used to perform KEGG pathway enrichment analysis on differentially expressed genes, generating enrichment factors and other indicators to determine the significance of enrichment, in order to screen for key genes against the small green leafhopper. From these genes, six members of the tea plant TIFY family—CsTIFY1 (GWHGACFB004081), CsTIFY2 (GWHGACFB028923), CsTIFY3 (GWHGACFB013026), CsTIFY4 (GWHGACFB021202), CsTIFY5 (GWHGACFB022136), and CsTIFY6 (GWHGACFB005241)—were found to be significantly upregulated. (The gene numbers in parentheses can be found in the tea plant genome database at http: / / tpia.teaplants.cn / ). Figure 3 As shown, the expression levels of CsTIFYs genes exhibit the same trend during the resistance to leafhoppers, suggesting that CsTIFY family members regulate the resistance mechanism of tea plants to leafhoppers through JA signaling.

[0044] Example 2: Design and screening of SSR molecular marker primers for the CsTIFYs gene

[0045] DNA was extracted from 24 collected tea germplasm resources (Yujinxiang, 5-81, Fuding Dabaicha, Jingbai No. 2, Longjing 43, Jiaming No. 1, Yuehuang No. 1, Zhenong 404, Zhenong 410, Zhenong 417, Zhongcha 108, Zhonghuang No. 3, Jin Guanyin, Zijuan, Baiye No. 1, Zhenong 418, 1-35, Huangjinya, Soubei, Zhenong 408, Zhenong 415, Zhenong 428, Zhenong Bai, and Ziya) using the CTAB method. Agarose gel electrophoresis showed clear bands without diffusion. Figure 4 As shown, the OD260 / OD280 values ​​are both around 1.8, indicating that the extracted DNA is of high quality and purity, and can be used for subsequent SSR marker analysis.

[0046] SSR sites of the CsTIFYs gene were searched using the SSRminer plugin in TBtools software, with the following conditions: more than 10 single-base repeats, more than 6 double-base repeats, and more than 5 triple, tetra, penta, and hexa base repeats. SSR primers were designed in batches using the Batch Target Region Primer Design plugin in TBtools software and synthesized by Sangon Biotech (Shanghai) Co., Ltd. The SSR sites of the six key genes CsTIFYs in the tea plant JA signaling pathway obtained in Example 1 were statistically analyzed. There were three types of repeat units: 15 single nucleotide repeat units, 8 dinucleotide repeat units, and 2 trinucleotide repeat units, as shown in Table 1. A total of 132 SSR primers were obtained, including 15 primers for the CsTIFY1 gene, 13 primers for the CsTIFY2 gene, 47 primers for the CsTIFY3 gene, 40 primers for the CsTIFY4 gene, 15 primers for the CsTIFY5 gene, and 2 primers for the CsTIFY6 gene.

[0047] Table 1: SSR marker nucleotide repeat units and number of the 6 CsTIFY genes

[0048]

[0049]

[0050] Eight tea germplasm resources with different resistance to the green leafhopper ('Zhenong 418', 'Zijuan', 'Zhongcha') were used as examples.

[0051] Using DNA as a template, PCR reactions were performed with 132 primers. Nine primers with clear amplification bands and good polymorphism were selected. Then, a second screening was performed using capillary electrophoresis (high-resolution electrophoresis), and finally five candidate SSR primers were obtained, including two for the CsTIFY2 gene, two for the CsTIFY3 gene, and one for the CsTIFY4 gene, as shown in Table 2.

[0052] Table 2: Sequences of 5 Polymorphic SSRs

[0053]

[0054] SSR-PCR capillary electrophoresis image of CsTIFY2-7 primers is shown below. Figure 5 As shown, the SSR-PCR capillary electrophoresis image of the CsTIFY2-11 primers is as follows. Figure 6 As shown, the SSR-PCR capillary electrophoresis image of the CsTIFY3-6 primers is as follows. Figure 7As shown, the SSR-PCR capillary electrophoresis image of the CsTIFY3-15 primer is as follows. Figure 8 As shown, the SSR-PCR capillary electrophoresis image of the CsTIFY4-33 primer is as follows. Figure 9 As shown.

[0055] Example 3: Cluster Analysis of Tea Germplasm Resources

[0056] The tea germplasm resources used in the experiment were planted at the Tea Garden Experimental Base of Zhejiang Academy of Agricultural Sciences and the Panban Tea Science Experimental Base of Zhejiang University. DNA extraction from the leaves of the experimental materials was performed using the CTAB method. The degree of damage to the tea germplasm resources was investigated during the peak period of the small green leafhopper, and the grading standards are as follows:

[0057] Level 0: Undamaged or slightly damaged: buds and leaves are normal or temporarily wilted.

[0058] Level 1 obvious damage: The base of the main vein of the 2-3 leaves below the bud turns red or permanently withers.

[0059] Level 3 damage is more severe: the main vein of the 2-3 leaves below the bud turns red, the buds and leaves shrink and wrinkle, and the tips of the buds and leaves begin to wither.

[0060] Level 5 severe damage: buds and leaves show obvious signs of scorching, with the scorched area not exceeding 1 / 4.

[0061] Level 7 damage is extremely severe: buds and leaves wither and dry up, with more than 1 / 4 of the unfolded leaves showing signs of scorching, and buds and leaves drooping.

[0062] The phenotypes of damage to the tea green leafhopper in the field are shown in Table 3.

[0063] Table 3: Phenotypic characteristics of tea green leafhopper damage in the field

[0064]

[0065] Five polymorphic SSR molecular markers were used to genotype 24 tea germplasm resources using capillary electrophoresis. The banding patterns of the amplified products were statistically analyzed, with a band marked as 1 and no band as 0, constructing a 0 / 1 matrix. A genetic relationship clustering diagram of the tea germplasm resources was constructed using Popgen32 software, as shown below. Figure 10 As shown.

[0066] The results showed that all 24 tea plant materials could be divided into two groups: those with strong resistance to the green leafhopper (damage level 0) and those with weak resistance (damage levels 1 and 3). The classification was based on the combination of different fragment sizes, and the genotyping was performed using clustering. Combined with the field tea green leafhopper damage phenotype, the genotyping success rates of the five SSR molecular markers were 58.3% (CsTIFY2-7), 70.8% (CsTIFY2-11), 66.7% (CsTIFY3-6), 58.3% (CsTIFY3-15), and 83.3% (CsTIFY4-33), respectively. The relatively small number of samples with "damage level 3" may be one of the reasons for the low accuracy of some molecular markers.

[0067] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent modifications or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in the present invention should be included within the scope of protection of the present invention.

[0068] sequence list

[0069] Seq ID NO.1

[0070] CCTATTACTCAGCACCCATAC

[0071] Seq ID NO.2

[0072] ACCTCTACACATGCCTTCAC

[0073] Seq ID NO.3

[0074] CTATTACTCAGCACCCATACA

[0075] Seq ID NO.4

[0076] TCTTACATGGTATCAGAGCTA

[0077] Seq ID NO.5

[0078] GCGATAAGCCTTACCCTATT

[0079] Seq ID NO.6

[0080] CGAACTCGACATAGTTTCCA

[0081] Seq ID NO.7

[0082] GCCATATATTCCTCGTGCT

[0083] Seq ID NO.8

[0084] GTTTCCAGCAAACAAACTCAA

[0085] Seq ID NO.9

[0086] AACGGAGGTCAGTTTAATGT

[0087] Seq ID NO.10

[0088] GATTGGTAGATCTGCACCC

Claims

1. The application of SSR molecular marker primers for tea plant resistance to the small green leafhopper in early identification of tea plant resistance to the small green leafhopper and / or in tea plant breeding for resistance to the small green leafhopper, characterized in that, The SSR molecular marker primers include one or more of the following: CsTIFY2-7 primer, CsTIFY2-11 primer, CsTIFY3-6 primer, CsTIFY3-15 primer, and CsTIFY4-33 primer; The forward primer of the CsTIFY2-7 primer has a nucleotide sequence as shown in Seq ID NO.1, and the reverse primer of the CsTIFY2-7 primer has a nucleotide sequence as shown in Seq ID NO.2; The forward primer of the CsTIFY2-11 primer has a nucleotide sequence as shown in Seq ID NO.3, and the reverse primer of the CsTIFY2-11 primer has a nucleotide sequence as shown in Seq ID NO.4; The forward primer of the CsTIFY3-6 primer has a nucleotide sequence as shown in Seq ID NO.5, and the reverse primer of the CsTIFY3-6 primer has a nucleotide sequence as shown in Seq ID NO.6; The forward primer of the CsTIFY3-15 primer has a nucleotide sequence as shown in Seq ID NO.7, and the reverse primer of the CsTIFY3-15 primer has a nucleotide sequence as shown in Seq ID NO.8; The forward primer of the CsTIFY4-33 primer has a nucleotide sequence as shown in Seq ID NO.9, and the reverse primer of the CsTIFY4-33 primer has a nucleotide sequence as shown in Seq ID NO.

10.

2. The application of SSR molecular marker primers for tea plant resistance to the small green leafhopper in the identification of tea plant germplasm resources, the study of genetic diversity, the construction of genetic maps, the phylogenetic relationships of populations, and evolutionary or genetic breeding, characterized by: The SSR molecular marker primers include one or more of the following: CsTIFY2-7 primer, CsTIFY2-11 primer, CsTIFY3-6 primer, CsTIFY3-15 primer, and CsTIFY4-33 primer; The forward primer of the CsTIFY2-7 primer has a nucleotide sequence as shown in Seq ID NO.1, and the reverse primer of the CsTIFY2-7 primer has a nucleotide sequence as shown in Seq ID NO.2; The forward primer of the CsTIFY2-11 primer has a nucleotide sequence as shown in Seq ID NO.3, and the reverse primer of the CsTIFY2-11 primer has a nucleotide sequence as shown in Seq ID NO.4; The forward primer of the CsTIFY3-6 primer has a nucleotide sequence as shown in Seq ID NO.5, and the reverse primer of the CsTIFY3-6 primer has a nucleotide sequence as shown in Seq ID NO.6; The forward primer of the CsTIFY3-15 primer has a nucleotide sequence as shown in Seq ID NO.7, and the reverse primer of the CsTIFY3-15 primer has a nucleotide sequence as shown in Seq ID NO.8; The forward primer of the CsTIFY4-33 primer has a nucleotide sequence as shown in Seq ID NO.9, and the reverse primer of the CsTIFY4-33 primer has a nucleotide sequence as shown in Seq ID NO.10.

Images