Gamma-lactam podophyllotoxin compound as well as preparation method and application thereof

Abstract

The invention provides a gamma-lactam podophyllotoxin compound as well as a preparation method and application thereof, and belongs to the technical field of bioengineering. A series of podophyllotoxin analogues with new skeletons are finally obtained by chemically synthesizing a series of lactam ring substituted lactonic ring substrate analogues and combining in-vitro protein catalytic activity tests, and a new method of gamma-lactam podophyllotoxin analogues is successfully developed. According to the present invention, the ShDS protein is adopted as the catalyst, such that the substrate selectivity is high, the reaction condition is mild, the other functional groups are not affected while the specific reaction is catalyzed so as to easily protect the sensitive functional groups in the drug molecule, avoid the damage to the drug molecule, and reduce the generation of the side reaction and the consumption of the energy and the resource. The ShDS protein serving as a catalyst can catalyze multiple reaction cycles, the cost of the synthesis process is reduced, no harmful chemical reagent is used in the method, environmental pollution and waste generation can be effectively reduced, and the method conforms to the green chemistry principle.

Description

Technical Field

[0001] The present invention relates to the field of bioengineering technology, and in particular to a gamma-lactam podophyllotoxin compound and a preparation method and application thereof. Background Art

[0002] Podophyllotoxin Figure 1 ) is the main medicinal ingredient of Podophyllum plants such as Podophyllum sibiricum, Polygonum multiflorum and Podophyllum truncatum. It belongs to the aryl tetralin class of lignans and has a characteristic structure including five rings (A–E) and four consecutive chiral centers (C1–C4). Its chemical semi-synthetic derivatives, such as etoposide and teniposide, have been widely used in the clinical treatment of various cancers.

[0003] Podophyllotoxin is a typical example of natural products used in new drug development. However, its current source mainly relies on natural extraction, which has led to a gradual increase in the contradiction between supply and demand. Biosynthesis has become a new way to produce podophyllotoxin and its derivatives because of its advantages such as no resource restrictions and mild reaction conditions.

[0004] The research and development of new podophyllum drugs is very active internationally, and the demand for synthetic precursor podophyllotoxin is increasing. At present, podophyllotoxin mainly relies on natural extraction, which has caused wild podophyllum plants to become rare and endangered protected plants in the country, and there are problems such as limited resources and unsustainability. For natural products with complex structures, chemical synthesis often has poor selectivity, complex routes and low yields. The efficient production of active ingredients and analogues of rare plants based on efficient biocatalytic systems not only protects medicinal plant resources and the environment, but also provides a new way for drug development.

[0005] Antitumor drugs Etoposide (VP-16) and Teniposide (VM-26) ( Figure 2 ) are all developed based on the podophyllotoxin parent. However, the compounds reported are all based on the skeleton of podophyllotoxin with a series of modifications, but without any changes to its skeleton. Summary of the invention

[0006] The purpose of the present invention is to provide a γ-lactam podophyllotoxin compound and a preparation method thereof. The present invention chemically synthesizes a series of substrate analogs in which a lactam ring replaces a lactone ring, and combines the in vitro protein catalytic activity test to finally obtain a series of podophyllotoxin analogs with new skeletons, successfully develops a new method for γ-lactam podophyllotoxin analogs, and obtains the product at the same time.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The present invention provides a γ-lactam podophyllotoxin compound, the structural formula of the γ-lactam podophyllotoxin compound is:

[0009]

[0010] Where R 1 OCH 3 or H, R 2 OCH 3 or H, R 3 OCH 3 or H, R 4 OCH 3 or H, R 5 OCH 3 or H.

[0011] Preferably, the γ-lactam podophyllotoxin compounds include

[0012]

[0013] The present invention also provides a method for preparing a γ-lactam podophyllotoxin compound, comprising the following steps: using ShDS protein to react with γ-lactam podophyllotoxin at 25-35° C. for 50-70 minutes, terminating the reaction, collecting the supernatant, and obtaining the γ-lactam podophyllotoxin compound.

[0014] Preferably, the ShDS protein can be obtained by the following steps:

[0015] (1) Optimize the ShDS encoding gene;

[0016] (2) Design primers based on the optimized ShDS coding gene and obtain the target gene through PCR amplification;

[0017] (3) Connecting the target gene to the vector to construct a recombinant plasmid;

[0018] (4) The recombinant plasmid is transformed into Escherichia coli to obtain the target protein, which is purified to obtain ShDS protein.

[0019] Preferably, the optimized ShDS encoding gene sequence is shown as SEQ ID NO.2.

[0020] Preferably, the optimized primer sequences of the ShDS encoding gene are shown in SEQ ID NO.3 and SEQ ID NO.4.

[0021] Preferably, the structural formula of the γ-lactam apigenin is:

[0022]

[0023] Where R 1 OCH 3 or H, R 2 OCH 3 or H, R 3 OCH 3 or H, R 4 OCH 3 or H, R 5 OCH 3 or H.

[0024] Preferably, the synthesis steps of the γ-lactam apigenin are as follows:

[0025] (1) reacting the starting substrate with an alcohol under alkaline conditions to obtain compound A1;

[0026] (2) dissolving compound A1 in anhydrous dichloromethane and reacting with cycloisopropyl malonate to obtain compound A2;

[0027] (3) reacting compound A2 with sodium borohydride in a dichloromethane solution to obtain compound A3;

[0028] (4) reflux compound A3 in toluene solvent, remove the solvent, add dichloromethane and react with trifluoroacetic acid to obtain compound A4;

[0029] (5) Compound A4 is dissolved in anhydrous tetrahydrofuran and reacted with sodium hydride, and then benzyl bromide is added dropwise to obtain γ-lactam apigenin.

[0030] Preferably, the structural formula of the starting substrate is:

[0031]

[0032] Preferably, the ShDS protein and γ-lactam apigenin reaction system comprises the following components: 0.5 mM γ-lactam apigenin, 5 mM α-ketoglutaric acid (2-OG), 0.5 mM FeSO 4 , 1 mg / mL ShDS protein, 50 mM phosphate buffer.

[0033] The present invention also provides the use of gamma-lactam podophyllotoxin compounds as precursors for synthesizing etoposide and teniposide drug analogs.

[0034] Compared with the prior art, the present invention has the following beneficial effects: the present invention provides a γ-lactam podophyllotoxin compound and a preparation method and application thereof. The present invention chemically synthesizes a series of substrate analogs with lactam rings replacing lactone rings, and combines in vitro protein catalytic activity tests to finally obtain a series of podophyllotoxin analogs with new skeletons, and successfully develops a new method for γ-lactam podophyllotoxin analogs. The present invention uses ShDS protein as a catalyst, which is highly selective for γ-lactam podophyllotoxins, has mild reaction conditions, and does not affect other functional groups while catalyzing specific reactions, which helps to protect sensitive functional groups in drug molecules, avoid damage to drug molecules, and reduce the occurrence of side reactions and the consumption of energy and resources. Since ShDS protein is used as a catalyst in the present invention, ShDS protein can catalyze multiple reaction cycles, reduce the cost of the synthesis process, and no harmful chemical reagents are used in the present invention, which can also effectively reduce environmental pollution and waste generation, and conform to the principles of green chemistry. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 This is the structural diagram of Podophyllotoxin;

[0036] Figure 2 The structural diagrams of the anti-tumor drugs Etoposide (VP-16) and Teniposide (VM-26);

[0037] Figure 3 It is the chemical synthesis pathway of γ-lactam apigenin;

[0038] Figure 4 It is an enzyme-catalyzed pathway for the synthesis of γ-lactam podophyllotoxin-like compounds;

[0039] Figure 5 This is the mass spectrum of the products obtained by enzyme-catalyzed synthesis of γ-lactam podophyllotoxin compounds. DETAILED DESCRIPTION

[0040] The present invention provides a γ-lactam podophyllotoxin compound, the structural formula of the γ-lactam podophyllotoxin compound is:

[0041]

[0042] Where R 1 OCH 3 or H, R 2 OCH 3 or H, R 3 OCH 3 or H, R 4 OCH 3 or H, R 5 OCH3 or H.

[0043] In the present invention, the γ-lactam podophyllotoxin compounds include

[0044]

[0045] The present invention also provides a method for preparing a γ-lactam podophyllotoxin compound, comprising the following steps: using ShDS protein to react with γ-lactam podophyllotoxin at 25-35° C. for 50-70 minutes, terminating the reaction, collecting the supernatant, and obtaining the γ-lactam podophyllotoxin compound.

[0046] In the present invention, the ShDS protein and γ-lactam apigenin reaction system comprises the following components: 0.5 mM γ-lactam apigenin, 5 mM α-ketoglutaric acid (2-OG), 0.5 mM FeSO 4 , 1mg / mL ShDS protein, 50mM phosphate buffer. The reaction temperature is 25-35°C, preferably 27-32°C, more preferably 30°C, the reaction time is 50-70min, preferably 55-65min, more preferably 60min, the solution used to terminate the reaction is methanol, the termination reaction time is 5min, the supernatant is obtained by centrifugation, the centrifugal force of the centrifugation is 12000g, the centrifugation time is 5min, and the γ-lactam podophyllotoxin compound is obtained by filtration using a 0.22μm organic filter membrane.

[0047] In the present invention, the ShDS protein can be obtained by the following steps:

[0048] (1) Optimize the ShDS encoding gene;

[0049] (2) Design primers based on the optimized ShDS coding gene and obtain the target gene through PCR amplification;

[0050] (3) Connecting the target gene to the vector to construct a recombinant plasmid;

[0051] (4) The recombinant plasmid is transformed into Escherichia coli to obtain the target protein, which is purified to obtain ShDS protein.

[0052] In the present invention, the ShDS is from Sinopodophyllum hexandrum, and its coding sequence is shown in SEQ ID NO.1, which is as follows:

[0053] ATGGGTTCTACAGCACCCCTAAGGCTTCCAGTTATAGATTTATCCATGAAGAACTTGAAGCCTGGAACAACTTCTTGGAACTCGGTACGCACCCAGGTACGGGAGGCACTGGAAGAATACGGTTGCTTTGAAGCTGTGATCGATGCTGTGTCTCCAGAGCTGCAGAAGGCAGTATGTAACAAAGGACACGAGCTGCTTAATCTTCCATTAGAAACCAAGATGTTGAACGGAAACAAACCAGAATATGATGGATTTACGTCAATACCAAACCTCAACGAAGGCATGGGAGTCGGCAGAATAACAGATTTGGAAAAAGTTGAGAGGTTCACTAATCTTATGTGGCCCGAGGGGAATAAGGATTTCTGTGAAACTGTGTATTCTTATGGCAAACGAATGGCGGAGGTGGACCACATATTGAAAATGATGGTTTTCGAGAGTTTTGGAATGGAGAAGCACTTCGACTCGTTCTGCGAATCAACAAATTACCTTCTCCATTTCATGAGATACCAACAACCAGGGAAGGATGGACGTTCACCTGCTCTTTCGTTGCATAAGGACAAGAGCATCTTGACCATAGTAAACCAAAATGATGTCAAGGGATTGGAATTTGAAACCAAGGATGGAGAATGGATTTTACCTACAGCTGACAACCATATTGTTCTTCTAGGAGACTGCTTCATGGCATGGAGCAATGGTAGATTACATAGTCCTCTTCACCGGGTCACGTTGGTCGCGAACCAGGCGAGGTTATCTACATCATCGTTTTCGTTTCCAAAGGACATAATAGAGACCCCTGCAGAGCTGGTGGATGAAGAGCATCCTTTGCTATTTAATCCCTTTGAGATAACGGAGTTGCTTGCTTACTGTTTCACAAAAGAGGGTGCAAAGGCGGTGTGTGACCTCAAGCAATACAAGGCGTACACAGGTGCA。

[0054] In the present invention, the optimized ShDS coding gene sequence is as shown in SEQ ID NO.2, specifically as follows:

[0055] ATGGGAAGCACCGCACCTCTGCGTCTGCCTGTTATTGATCTGAGCATGAAAAATCTGAAACCGGGCACCACCAGCTGGAATAGCGTGCGTACACAGGTTCGTGAAGCGCTGGAAGAATATGGGTGTTTTGAAGCCGTTATTGATGCCGTGAGCCCTGAACTGCAGAAAGCGGTTTGTAATAAAGGCCACGAACTGCTGAATCTGCCGCTGGAAACCAAAATGCTGAATGGTAATAAACCGGAATATGATGGTTTTACAAGCATTCCGAATCTGAATGAAGGTATGGGTGTTGGGCGCATTACCGACCTGGAAAAAGTAGAACGTTTTACAAATCTGATGTGGCCGGAGGGCAATAAAGATTTCTGTGAAACCGTGTATAGCTATGGCAAACGTATGGCAGAAGTTGATCATATTCTGAAAATGATGGTGTTCGAGAGTTTTGGTATGGAGAAACATTTTGACAGCTTTTGCGAAAGCACCAATTATCTGCTGCATTTCATGCGTTACCAACAGCCGGGGAAAGATGGTCGCTCACCAGCACTGAGCCTGCATAAAGATAAATCGATTCTGACCATTGTTAATCAGAACGACGTAAAAGGACTGGAATTTGAAACCAAAGATGGTGAATGGATTCTGCCGACCGCAGATAATCACATTGTTCTGCTGGGTGATTGTTTTATGGCATGGAGCAACGGTCGCCTGCACAGTCCTCTGCATCGTGTTACCCTGGTTGCAAATCAGGCGCGTCTGAGCACCAGCAGTTTTAGTTTTCCGAAAGATATTATTGAAACCCCGGCAGAACTGGTTGATGAAGAACATCCGCTGCTGTTTAATCCTTTTGAAATTACAGAACTGCTGGCATATTGTTTCACCAAAGAAGGTGCAAAAGCCGTTTGTGATCTGAAACAGTATAAAGCATATACCGGTGCA。

[0056] In the present invention, primers are designed for the codon-optimized ShDS sequence, and the optimized primer sequences of the ShDS encoding gene are shown in SEQ ID NO.3 and SEQ ID NO.4, which are as follows:

[0057] SEQ ID NO.3: 5'-CGCGAACAGATTGGAGGTATGGGAAGCACCGCA CCTCTG-3';

[0058] SEQ ID NO. 4: 5'-GGTGGTGGTGCTCGAGTTATGCACCGGTATATGCT TTATAC-3'.

[0059] In the present invention, the ShDS protein is obtained by: using a conventional kit for PCR amplification to obtain the target gene. After the PCR product is recovered, a recombinant plasmid is constructed with pET-28b-SUMO by homologous recombination, and the recombinant plasmid is sequenced. The plasmid with correct sequencing is named pET28b-SUMO-ShDS, and pET28b-SUMO-ShDS is transformed into BL21 (DE3) competent state, coated on a solid plate containing 50 μg / mL kanamycin, and placed in a 37°C constant temperature incubator for overnight cultivation. The next day, a single clone is picked into 4mL of liquid LB containing kanamycin, and cultured overnight at 37°C shaking table and 220rpm. The next day, it is inoculated into 1L of liquid LB containing kanamycin antibiotics, and when OD600 reaches about 0.8, IPTG with a final concentration of 0.1mM is added to induce protein expression, and the culture is continued for 16h at 16°C and 220rpm, and the bacteria are collected. The cells were resuspended in lysis buffer (50mM phosphate buffer, pH 7.5), and the cells were broken by high pressure, centrifuged at 35,000g for 40min, and the supernatant protein solution was combined with a nickel column, and gradient eluted with elution buffer containing different concentrations of imidazole (20mM, 50mM, 200mM, respectively), and detected by SDS-PAGE. The target proteins with high purity were mixed and concentrated, and the imidazole was removed using a PD-10 desalting column (GE) to obtain ShDS protein.

[0060] In the present invention, the structural formula of the γ-lactam apigenin is:

[0061]

[0062] Where R 1 OCH 3 or H, R 2 OCH 3 or H, R 3 OCH 3 or H, R 4 OCH 3or H, R 5 OCH 3 or H.

[0063] In the present invention, the synthesis steps of the γ-lactam apigenin are as follows:

[0064] (1) reacting the starting substrate with an alcohol under alkaline conditions to obtain compound A1;

[0065] (2) dissolving compound A1 in anhydrous dichloromethane and reacting with cycloisopropyl malonate to obtain compound A2;

[0066] (3) reacting compound A2 with sodium borohydride in a dichloromethane solution to obtain compound A3;

[0067] (4) reflux compound A3 in toluene solvent, remove the solvent, add dichloromethane and react with trifluoroacetic acid to obtain compound A4;

[0068] (5) Compound A4 is dissolved in anhydrous tetrahydrofuran and reacted with sodium hydride, and then benzyl bromide is added dropwise to obtain γ-lactam apigenin.

[0069] In the present invention, the starting substrate is: Formula XII: N-tert-butyloxycarbonyl-O-methyl-L-tyrosine methyl ester, Formula XIII: (R)-methyl 2-((tert-butyloxycarbonyl)amino)-3-(3-methoxyphenyl)propionate or Formula XIV: L-Tyrosine, N-[(1,1-dimethylethoxy)carbonyl]-3-methoxy-O-methyl-,methylester, wherein when R in the starting substrate is 1 OCH 3 , R 2 -H or R 1 For -H, R 2 OCH 3 purchased from Shanghai Haohong Biopharmaceutical Technology Co., Ltd., CAS No. 255849-24-2 and 94790-24-6, respectively. 1 and R 2 All are -OCH 3 It was purchased from Shanghai Bid Pharmaceutical Technology Co., Ltd. with a CAS number of 138908-56-2. The specific structural formula is:

[0070]

[0071] In the present invention, the benzyl bromide is: 4-methoxybenzyl bromide, 3,4-dimethoxybenzyl bromide or 3,4,5-trimethoxybenzyl bromide, wherein when R 4 OCH 3, R 3 and R 5 When it is -H, it is 4-methoxybenzyl bromide, purchased from Beijing Bailingwei Technology Co., Ltd., CAS No. 2746-25-0. 4 OCH 3 , R 3 and R 5 One of them is -H and the other is -OCH 3 3,4-dimethoxybenzyl bromide was purchased from Shanghai Haohong Biopharmaceutical Technology Co., Ltd. with a CAS number of 21852-32-4. 3 , R 4 and R 5 All are -OCH 3 3,4,5-trimethoxybenzyl bromide was purchased from Shanghai Bid Pharmaceutical Technology Co., Ltd. with a CAS number of 21852-50-6.

[0072] In the present invention, the specific method for obtaining compound A1 is as follows: the starting substrate is dissolved in ethanol, and an equal amount of 10% sodium hydroxide aqueous solution is added at room temperature (25°C), and stirred for 2 hours. After the starting substrate is completely consumed, the solvent is removed by a rotary evaporator. An equal amount of water and ethyl acetate are added, and the pH is adjusted to 1 with a 2M hydrochloric acid solution, and the organic phase is separated. Ethyl acetate is mixed with the aqueous phase, the aqueous phase is extracted twice, and the organic phases are combined. Drying is performed using anhydrous sodium sulfate to obtain compound A1.

[0073] In the present invention, the specific method for obtaining compound A2 is as follows: dissolve compound A1 in anhydrous dichloromethane, add 1.1 equivalents of cycloisopropyl malonate (CAS No.: 2033-24-1) and 1.5 equivalents of 4-dimethylaminopyridine (DMAP, CAS No.: 1122-58-3). At -5°C, add 1.1 equivalents of N,N'-dicyclohexylcarbodiimide (DCC, CAS No.: 538-75-0) in dichloromethane dropwise, and react overnight. After filtering out the solid, use 5% KHSO 4 The resulting mixture was dried over anhydrous sodium sulfate at -5°C for 5 hours to obtain compound A2, which was filtered and used in the next experiment without further separation and purification.

[0074] In the present invention, the specific method for obtaining compound A3 is as follows: at -5°C, add 2 equivalents of sodium borohydride and 10 equivalents of acetic acid to a dichloromethane solution of compound A2, and stir overnight. After the substrate is completely consumed, wash twice with saline and water, respectively. Dry the organic phase with anhydrous sodium sulfate and filter. Purify the product by using petroleum ether: ethyl acetate = 2:1 to obtain compound A3.

[0075] In the present invention, the specific method for obtaining compound A4 is as follows: dissolve compound A3 in toluene and reflux overnight. After the substrate is completely consumed, remove the solvent by a rotary evaporator. Add dichloromethane and trifluoroacetic acid, and stir the reaction for 3 hours. Wash the reaction solution with saturated sodium bicarbonate, water and brine, respectively, and then dry it with anhydrous sodium sulfate. After evaporating the solvent, purify the product by using petroleum ether: ethyl acetate = 2: 1 to obtain compound A4.

[0076] In the present invention, the specific method for obtaining γ-lactam Asia Pacific is as follows: dissolve compound A4 in anhydrous tetrahydrofuran, add 1.5 times the equivalent of sodium hydride, and stir the reaction for 30 minutes. Add the corresponding benzyl bromide dropwise and stir overnight at room temperature (25°C). Extract the product with equal amounts of water and ethyl acetate, and dry the organic phase with anhydrous sodium sulfate. Purify the product by using petroleum ether: ethyl acetate = 1:1 to 1:2, and obtain γ-lactam Asia Pacific.

[0077] The present invention also provides the use of gamma-lactam podophyllotoxin compounds as precursors for synthesizing etoposide and teniposide drug analogs.

[0078] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0079] Example 1 Synthesis of γ-lactam apigenin

[0080] The starting substrate is: N-tert-butyloxycarbonyl-O-methyl-L-tyrosine methyl ester, (R)-methyl 2-((tert-butyloxycarbonyl)amino)-3-(3-methoxyphenyl)propionate or L-Tyrosine, N-[(1,1-dimethylethoxy)carbonyl]-3-methoxy-O-methyl-,methylester, wherein N-tert-butyloxycarbonyl-O-methyl-L-tyrosine methyl ester, i.e., R 1 OCH 3 , R 2 =H (purchased from Shanghai Haohong Biopharmaceutical Technology Co., Ltd., 255849-24-2), (R)-methyl 2-((tert-butyloxycarbonyl)amino)-3-(3-methoxyphenyl)propionate, i.e. R 1 For -H, R 2 OCH 3(purchased from Shanghai Haohong Biopharmaceutical Technology Co., Ltd., 94790-24-6), L-Tyrosine, N-[(1,1-dimethylethoxy)carbonyl]-3-methoxy-O-methyl-, methylester, namely R 1 and R 2 All are -OCH 3 (Purchased from Shanghai BiDe Pharmaceutical Technology Co., Ltd., 138908-56-2).

[0081] Benzyl bromide is: 4-methoxybenzyl bromide, 3,4-dimethoxybenzyl bromide or 3,4,5-trimethoxybenzyl bromide, among which 4-methoxybenzyl bromide is R 4 OCH 3 , R 3 and R 5 -H (purchased from Beijing Bailingwei Technology Co., Ltd., 2746-25-0), 3,4-dimethoxybenzyl bromide, i.e. R 4 OCH 3 , R 3 and R 5 One of them is -H and the other is -OCH 3 (purchased from Shanghai Haohong Biopharmaceutical Technology Co., Ltd., 21852-32-4), 3,4,5-trimethoxybenzyl bromide, i.e. R 3 , R 4 and R 5 All are -OCH 3 (Purchased from Shanghai BiDe Pharmaceutical Technology Co., Ltd., 21852-50-6).

[0082] Synthesis of compound A1: The starting substrate was dissolved in ethanol, and an equal amount of 10% sodium hydroxide aqueous solution was added at room temperature and stirred for 2 hours. After the starting substrate was completely consumed, the solvent was removed by a rotary evaporator. An equal amount of water and ethyl acetate were added, and the pH was adjusted to 1 with a 2M hydrochloric acid solution, and the organic phase was separated. The aqueous phase was mixed with ethyl acetate, the aqueous phase was extracted twice, and the organic phases were combined. Drying was performed using anhydrous sodium sulfate to obtain compound A1.

[0083] Synthesis of compound A2: Compound A1 was dissolved in anhydrous dichloromethane, and 1.1 equivalents of cycloisopropyl malonate (CAS No.: 2033-24-1) and 1.5 equivalents of 4-dimethylaminopyridine (DMAP, CAS No.: 1122-58-3) were added. At -5°C, 1.1 equivalents of N,N'-dicyclohexylcarbodiimide (DCC, CAS No.: 538-75-0) in dichloromethane was added dropwise and reacted overnight. After filtering out the solid, it was washed twice with 5% KHSO4 (potassium hydrogen sulfate) solution. The resulting mixture was dried over anhydrous sodium sulfate at -5°C for 5 hours, and the resulting mixture was filtered for the next experiment without further separation and purification.

[0084] Synthesis of compound A3: At -5°C, add 2 equivalents of sodium borohydride and 10 equivalents of acetic acid to a dichloromethane solution of compound A2 and stir overnight. After the substrate is completely consumed, wash twice with brine and water respectively. Dry the organic phase with anhydrous sodium sulfate and filter. Purify the product by using petroleum ether: ethyl acetate = 2:1 to obtain compound A3.

[0085] Synthesis of compound A4: Compound A3 was dissolved in toluene and refluxed overnight. After the substrate was completely consumed, the solvent was removed by a rotary evaporator. Dichloromethane and trifluoroacetic acid were added and stirred for 3 hours. The reaction solution was washed with saturated sodium bicarbonate, water and brine, respectively, and then dried with anhydrous sodium sulfate. After evaporating the solvent, the product was purified by using petroleum ether: ethyl acetate = 2:1 to obtain compound A4.

[0086] Synthesis of γ-lactam apigenin: Compound A4 was dissolved in anhydrous tetrahydrofuran, 1.5 equivalents of sodium hydride were added, and the reaction was stirred for 30 minutes. The corresponding benzyl bromide was added dropwise and stirred overnight at room temperature. The product was extracted with equal amounts of water and ethyl acetate, and the organic phase was dried over anhydrous sodium sulfate. The product was purified by using petroleum ether: ethyl acetate = 1:1 to 1:2 to obtain the target compound.

[0087] The synthesis process is as follows Figure 3 As shown by Figure 3 It can be seen that according to the combination of substrates with different substituents, a total of 9 γ-lactam apigenins were obtained, namely

[0088]

[0089] Example 2

[0090] The ShDS gene sequence from Psoralea corylifolia was obtained through the NCBI public database, namely the original ShDS gene sequence (SEQ ID NO.1). The ShDS was optimized according to the codon preference of Escherichia coli to obtain the optimized ShDS gene sequence SEQ ID NO.2.

[0091] Vector construction: The vector pET-28b-SUMO was constructed by homologous recombination method of Yisheng Biotechnology. The vector was linearized by PCR.

[0092] Vector Primers:

[0093] F:CTCGAGCACCACCACCACCACCACTGAGATCC(SEQ ID NO.5)

[0094] R: CATACCTCCAATCTGTTTCCGGTGAGCCTC (SEQ ID NO. 6);

[0095] Gene primers:

[0096] F:CGCGAACAGATTGGAGGTATGGGAAGCACCGCACCTCTG(SEQ ID NO.3)

[0097] R:GGTGGTGGTGCTCGAGTTATGCACCGGTATATGCTTTATAC (SEQ ID NO. 4).

[0098] Primers were designed for the ShDS sequence after codon optimization, and the target gene was obtained by PCR amplification. After the PCR products were recovered, they were connected with the pET28b-SUMO vector cut by enzymes to construct a recombinant plasmid, and the plasmid was verified by sequencing.

[0099] The correctly sequenced plasmid pET28b-SUMO-ShDS was transformed into the competent medium of BL21 (DE3) (purchased from Yisheng Biotechnology (Shanghai) Co., Ltd.), spread on a solid plate containing 50μg / mL kanamycin, and placed in a 37°C constant temperature incubator for overnight culture. The next day, a single clone was picked into 4mL of liquid LB containing kanamycin, and cultured overnight at 37°C shaker and 220rpm. The next day, it was inoculated into 1L of liquid LB containing kanamycin antibiotics. When OD600 reached about 0.8, IPTG with a final concentration of 0.1mM was added to induce protein expression, and culture was continued for 16h at 16°C and 220rpm, and then the bacteria were collected. The cells were resuspended in lysis buffer (50mM phosphate buffer, pH 7.5), the cells were broken by high pressure, centrifuged at 35,000g for 40min, the supernatant protein solution was combined with a nickel column, and then gradient eluted with elution buffer containing different concentrations of imidazole (20mM, 50mM, 200mM, respectively), and SDS-PAGE was used for detection. The target protein with high purity was mixed and concentrated, and the imidazole was removed using a PD-10 desalting column (GE) to obtain the target protein. The protein concentration was determined by the Bradford method based on the standard curve prepared by BSA, and then quickly frozen in liquid nitrogen and stored in a -80℃ refrigerator.

[0100] The ShDS protein activity assay was performed in a 100 μL reaction system containing 0.5 mM γ-lactam apigenin, 5 mM α-ketoglutaric acid (2-OG), and 0.5 mM FeSO 4 , 1mg / mL ShDS protein, 50mM phosphate buffer (pH7.5), the reaction solution was placed in a 30℃ water bath for 60min. 100μL methanol was added, vortexed for five minutes to terminate the reaction, centrifuged at 12,000g for 5min, the supernatant was taken, filtered with a 0.22μm organic filter membrane, and detected by mass spectrometry.

[0101] Catalytic process such as Figure 4 As shown, since nine γ-lactam apigenins can be obtained according to the method of Example 1, nine different products can be obtained when the γ-lactam apigenin is used as a substrate for catalytic reaction, namely,

[0102]

[0103] The obtained product was detected by mass spectrometry. Figure 5 It was found that through ShDS enzyme catalysis, the corresponding CC bond coupling product was finally obtained, that is, through ShDS enzyme catalysis, γ-lactam podophyllotoxin was generated using γ-lactam apitoxin.

[0104] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A γ-lactam podophyllotoxin compound, characterized in that: The structural formula of the γ-lactam podophyllotoxin compound is: Where R 1 is OCH3 or H, R 2 is OCH3 or H, R 3 is OCH3 or H, R 4 is OCH3 or H, R 5 is OCH3 or H.

2. The γ-lactam podophyllotoxin compound according to claim 1, characterized in that: The γ-lactam podophyllotoxin compounds include 3. A method for preparing a γ-lactam podophyllotoxin compound, characterized in that: The following steps are involved: The ShDS protein is reacted with the gamma-lactam podophyllotoxin at 25-35° C. for 50-70 minutes, the reaction is terminated, and the supernatant is collected to obtain a gamma-lactam podophyllotoxin compound.

4. The preparation method according to claim 3, characterized in that: The ShDS protein can be obtained by the following steps: (1) Optimize the ShDS encoding gene; (2) Design primers based on the optimized ShDS coding gene and obtain the target gene through PCR amplification; (3) Connecting the target gene to the vector to construct a recombinant plasmid; (4) The recombinant plasmid is transformed into Escherichia coli to obtain the target protein, which is purified to obtain ShDS protein.

5. The preparation method according to claim 4, characterized in that: The optimized ShDS encoding gene sequence is shown as SEQ ID NO.

2.

6. The preparation method according to claim 4, characterized in that: The optimized primer sequences of the ShDS encoding gene are shown in SEQ ID NO.3 and SEQ ID NO.

4.

7. The preparation method according to claim 3, characterized in that: The structural formula of the γ-lactam apigenin is: Where R 1 is OCH3 or H, R 2 is OCH3 or H, R 3 is OCH3 or H, R 4 is OCH3 or H, R 5 is OCH3 or H.

8. The preparation method according to claim 7, characterized in that: The synthesis steps of the γ-lactam apigenin are as follows: (1) reacting the starting substrate with an alcohol under alkaline conditions to obtain compound A1; (2) dissolving compound A1 in anhydrous dichloromethane and reacting with cycloisopropyl malonate to obtain compound A2; (3) reacting compound A2 with sodium borohydride in a dichloromethane solution to obtain compound A3; (4) reflux compound A3 in toluene solvent, remove the solvent, add dichloromethane and trifluoroacetic acid to react, and obtain compound A4; (5) Compound A4 is dissolved in anhydrous tetrahydrofuran and reacted with sodium hydride, and then benzyl bromide is added dropwise to obtain γ-lactam apigenin; The structural formula of the starting substrate is:

9. The preparation method according to claim 3, characterized in that: The ShDS protein and γ-lactam apigenin reaction system comprises the following components: 0.5 mM γ-lactam apigenin, 5 mM α-ketoglutaric acid (2-OG), 0.5 mM FeSO4, 1 mg / mL ShDS protein, and 50 mM phosphate buffer.

10. Use of the γ-lactam podophyllotoxin compound according to any one of claims 1 to 2 or the γ-lactam podophyllotoxin compound prepared by the method according to any one of claims 3 to 9 as a precursor for synthesizing etoposide and teniposide drug analogs.

Images