Single-molecule gene sequencing method based on MOSFET device

Abstract

The invention provides a single-molecule gene sequencing method based on an MOSFET device, and belongs to the technical field of single-molecule gene sequencing. A grid electrode and a source and drain electrode area of the MOSFET device are coated with a chromium surface and a gold surface in sequence, after the grid electrode is coated with a PMMA coating, a hole only capable of containing single polymerase is developed through high-precision electron beam exposure, and the single polymerase is formed in the hole; the PDMS micro-channel is attached to the periphery of the grid electrode to form a micro reaction chamber, and electronegative polymerase is driven into a high-potential PMMA hole by utilizing a negative pressure circulating scanning method and forms gold-sulfur bond connection with a bottom grid electrode gold atom, so that modification of a single polymerase on the grid electrode is completed. By further upgrading and improving a product-grade MOSFET device, a sequencing technology which takes a single polymerase chain reaction as a sequence information feedback source and realizes high-precision reading of a sequence by utilizing an intrinsic physiological function of biomolecules is formed, and an effective signal analysis method is constructed, so that the information reading effectiveness is improved, and the accuracy of information reading is improved. The accuracy and the high efficiency of a single molecule sequencing technology are improved.

Description

Technical Field

[0001] The present invention belongs to the technical field of single molecule gene sequencing, and in particular relates to a single molecule gene sequencing method based on MOSFET devices. Background Art

[0002] Under the guidance of the policy concept of "accelerating the development of high-throughput gene sequencing technology and promoting innovative technologies marked by single-molecule sequencing", the development of single-molecule sequencing technology in China is in full swing. Single-molecule electrical sequencing has the characteristics of high throughput, label-free, and real-time, and has extremely high potential application value in the field of new-generation gene sequencing. However, the third-generation single-molecule electrical sequencing method, which has been developed in the mainstream recently, is based on nanopore detection and is integrated into arrayed sequencing chips (MinION platform), which greatly improves sequencing throughput and read length. However, this method has defects such as difficulty in controlling the speed of single bases and high error rate. It is still urgent to develop single-molecule electrical sequencing methods with independent innovation, high precision, and single-base recognition.

[0003] MOSFET devices have extremely wide application value in the field of biological detection. In the early second-generation sequencing (Ion Torrent of Thermo Fisher), developers used MOSFET to + The sensitivity of ions enables the detection of H in the single-base polymerization of DNA polymerase chain + The precise capture of the release process achieved the goal of single-base sequencing accuracy and successfully applied the technology to the sequencing market. However, the low throughput and bulk PCR amplification of the second-generation sequencing technology have made the sequencing cost remain high and prohibitive. Therefore, combined with MOSFET devices that are stable in operation and can be mass-produced, the development of a sequencing platform with single-molecule test sensitivity will greatly improve sequencing throughput and read length, eliminate the need for PCR amplification, further reduce sequencing costs, and achieve lightweight and low-cost sequencing goals in the field of gene sequencing. Summary of the invention

[0004] The purpose of the present invention is to develop a high-precision single-molecule electrical sequencing technology with broad-spectrum practical value, using product-level MOSFET devices as electrical detection elements, connecting a single polymerase protein KlenowFragment (KF) through a confinement effect, projecting the surface charge fluctuation caused by the conformational change of the protein in the single-base polymerization process onto the MOSFET gate region, and capturing the single-base polymerization behavior of the DNA template chain through real-time detection of the source-drain output current. Further, modified deoxynucleotide substrate molecules (sulfated deoxynucleotides and dideoxynucleotides) are introduced to distinguish the characteristic relaxation time and polymerization continuity of different deoxynucleotide single-base polymerizations, achieving reliable distinction of the electrical characteristics of the four bases, and combining the test analysis of the gene NPM-415 related to the expression of cancer inhibitors to verify the sequencing accuracy of the technical method.

[0005] The technical solution adopted by the present invention is:

[0006] The purpose of the first aspect of the present invention is to provide a single-molecule gene sequencing biosensor based on a MOSFET device. The gate and source and drain regions of the MOSFET device are successively plated with chromium and gold surfaces. After the gate is coated with a PMMA coating, a hole that can only accommodate a single polymerase is developed through high-precision electron beam exposure. The PDMS microchannel is attached around the gate to form a micro reaction chamber. The negatively charged polymerase is driven into the high-potential PMMA hole by a negative pressure cycle scanning method, and forms a gold-sulfur bond connection with the gold atom of the bottom gate, thereby completing the modification of a single polymerase on the gate.

[0007] Furthermore, the gate center region of the MOSFET device has a gate hole with a pattern of 20 nm exposed, and the polymerase is a negatively charged KF polymerase having an amino acid sequence shown in SEQ ID NO.1.

[0008] Furthermore, the coating is chromium and gold, wherein chromium: 5nm, gold: 100nm.

[0009] The second aspect of the present invention provides a method for preparing the above-mentioned single-molecule electrical biosensor based on MOSFET devices, comprising:

[0010] 1. Regional transformation and microfluidic packaging of MOSFET devices

[0011] 1.1) Use template overlay to expose only the gate and source and drain surface areas, and then use wet etching to remove Al / Al2O3 on the gate and source and drain surfaces of product-grade MOSFET devices;

[0012] 1.2) Subsequently, chromium and gold are plated on the gate and source / drain regions by thermal evaporation technology, with 5 nm chromium and 100 nm gold, and the residual photoresist is removed by acetone;

[0013] 2. Single-molecule polymerase modification of MOSFET devices

[0014] 2.1) A layer of PMMA is spin-coated and thermally cured on the device surface, and then a prefabricated window with an aperture of about 20 nm is exposed in the center area of ​​the gate using a high-precision electron beam exposure system;

[0015] 2.2) The device after electron beam exposure is developed at low temperature, and the developer is isopropyl alcohol with a volume ratio of 3 / 1

[0016] / MIBK, thereby obtaining gate holes with 20nm pattern exposure;

[0017] 2.3) The specially made PDMS microchannel reactor was cleaned with oxygen plasma for 30 seconds to improve the substrate adhesion of PDMS, and finally the PDMS microchannel was attached to the gate epitaxial region of the device to form a micro reaction chamber for physiological liquid phase testing;

[0018] 2.4) 20 μL of physiological buffer solution containing DNA polymerase was injected into the microfluidic reaction chamber, and a gate probe at one end was immersed in the upper part of the solution. Through negative pressure circulation scanning, the negatively charged KF polymerase was driven into the bottom of the ~20 nm hole with high potential;

[0019] 2.5) The subthreshold swing changes in the scanning transfer curve and the invariance of the curve after cyclic scanning can prove the successful connection of the gold-sulfur bond between the thiol group of a single KF polymerase in the hole and the gold atom of the gate.

[0020] Furthermore, in step 1.1) of the above method, the template overlay conditions are: photolithography for 40 seconds and development for 15 seconds; the wet etching method conditions are: TranseneAluminum Etchant TypeA etching solution, immersion at 50°C for 45 minutes.

[0021] Furthermore, in step 2.1 of the above method, the spin coating thermal curing conditions are 180° C. and 2 min.

[0022] Furthermore, in step 2.2) of the above method, low-temperature development is development at 4° C. for 40 seconds.

[0023] Furthermore, in step 2.4) of the above method, the physiological buffer solution containing the DNA polymerase includes 200 nM KF, 10 mM Tris, 50 mM NaCl, 10 mM MgCl2, 100 μM TCEP, and has a pH value of 7.8.

[0024] The third aspect of the present invention provides the above-mentioned single-molecule gene sequencing method based on MOSFET device, comprising:

[0025] 1) The reaction chamber is replaced with a physiological buffer solution containing 1 μM template-primer complex chain and substrate;

[0026] 2) The test process is to apply +0.1V gate voltage to the gate area, input +0.1V voltage to the source and drain, turn on the working state of the MOSFET constant current area, and use a phase-locked amplifier combined with a current amplifier to record the source and drain current of the device in real time, with a sampling frequency of 57.6kHz.

[0027] Furthermore, in the above method, the substrate includes adenine deoxynucleotide: 2.5 μM, thiothymine deoxynucleotide: 2.5 μM, thiocytosine dideoxynucleotide: 1.25 μM, thiocytosine deoxynucleotide: 1.25 μM, guanine dideoxynucleotide: 1.25 μM or guanine deoxynucleotide: 1.25 μM; the buffer solution includes 10 mM Tris, 50 mM NaCl, 10 mM MgCl2, 100 μM DTT. The pH value is 7.8.

[0028] The technical effect achieved by the present invention is that the present invention realizes an electrical single-molecule gene sequencing technology based on MOSFET devices. Through further upgrading and improvement of product-level MOSFET devices, a sequencing technology with a single polymerase chain reaction as the sequence information feedback source is formed, and the intrinsic physiological function of biological molecules is used to realize high-precision reading of the sequence. An effective signal analysis method is constructed to improve the effectiveness of information reading and improve the accuracy and efficiency of single-molecule sequencing technology. Combined with the biological sample sequence NPM-415, real-time single-molecule electrical sequencing is carried out to achieve the goal of accurate single-base identification, proving the practical value of this technology in the field of precision medicine, and providing an important application reference for realizing the broad-spectrum application of MOSFET in the single-molecule sequencing market. This technical solution can also be used for sequencing applications of other functional biological enzymes combined with MOSFET devices, such as other types of DNA polymerases, RNA, DNA degrading enzymes and polypeptide degrading enzymes, etc., which can achieve the universal single-molecule sequencing goals of RNA, DNA and polypeptides. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Single-molecule polymerase modification process based on MOSFET devices.

[0030] Figure 2Output curve of the modified MOSFET device (a), transfer curve of the MOSFET device before and after single-molecule polymerase modification (b), blank control electrical test of the MOSFET device before protein modification, and real-time electrical test of the chain polymerization process after single KF polymerase modification (c). DETAILED DESCRIPTION

[0031] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0032] 1. A method for preparing a single-molecule electrical biosensor based on a MOSFET device, comprising:

[0033] (I) Regionalization transformation and microfluidic packaging of MOSFET devices

[0034] 1) Use template overlay (photolithography 40s, development 15s) to expose only the gate and source and drain surface areas, and then use wet etching method (TranseneAluminum EtchantTypeA etching solution, immersion at 50℃ for 45min) to remove Al / Al2O3 on the gate and source and drain surfaces of product-grade MOSFET devices.

[0035] 2) Subsequently, chromium and gold (chromium: 5 nm, gold: 100 nm) were deposited on the gate and source / drain regions by thermal evaporation technology, and the residual photoresist was removed by acetone.

[0036] (II) Single-molecule polymerase modification of MOSFET devices

[0037] 1) A layer of PMMA is spin-coated and thermally cured (180°C, 2 min) on the device surface, and then a prefabricated window with an aperture of about 20 nm is exposed in the center area of ​​the gate using a high-precision electron beam exposure system.

[0038] 2) The device after electron beam exposure was developed at low temperature (4° C.) (40 s) using a developer of isopropyl alcohol / MIBK (3 / 1, v / v) to obtain a gate hole with a pattern exposure of ∼20 nm.

[0039] 3) The specially made PDMS microfluidic reactor was cleaned with oxygen plasma for 30 seconds to improve the substrate adhesion of PDMS, and finally the PDMS microfluidic channel was attached to the gate epitaxial region of the device to form a micro reaction chamber for physiological liquid phase testing.

[0040] 4) 20 μL of physiological buffer solution containing DNA polymerase (200 nM KF, 10 mM Tris, 50 mM NaCl, 10 mM MgCl2, 100 μM TCEP, pH 7.8) was injected into the microfluidic reaction chamber, and a gate probe at one end was immersed in the upper part of the solution. Through negative pressure circulation scanning, the negatively charged KF polymerase was driven into the bottom of the ~20 nm pore with high potential.

[0041] 5) The subthreshold swing in the scanning transfer curve and the invariability of the curve after cyclic scanning can prove the successful connection between the thiol group of a single KF polymerase in the hole and the gold atom of the gate. Figure 1 ).

[0042] 2. A method for electrical real-time sequencing of a single-molecule polymerase-modified MOSFET device, comprising:

[0043] 1) The reaction chamber is replaced with a physiological buffer solution containing a template-primer complex chain (1 μM) and a substrate.

[0044] The substrates include adenine deoxynucleotide: 2.5 μM, thiothymine deoxynucleotide: 2.5 μM, thiocytosine dideoxynucleotide: 1.25 μM, thiocytosine deoxynucleotide: 1.25 μM, guanine dideoxynucleotide: 1.25 μM or guanine deoxynucleotide: 1.25 μM.

[0045] The buffer solution was 10 mM Tris, 50 mM NaCl, 10 mM MgCl2, 100 μM DTT, and the pH value was 7.8.

[0046] 2) Apply +0.1V gate voltage to the gate region, input +0.1V voltage to the source and drain, turn on the working state of the MOSFET constant current region, and use a phase-locked amplifier (HF2LI) combined with a current amplifier (DL1211) to record the source and drain current of the device in real time, with a sampling frequency of 57.6kHz. Test the DNA chain polymerization process of the synthetic cell sequence template chain NPM-415 to verify the feasibility of sequencing.

[0047] 3. DNA sequencing example of single-molecule polymerase modified MOSFET device

[0048] 1) The enzyme used in the example is a single thiol mutant KF polymerase, and the amino acid sequence of the enzyme is as follows (SEQ ID NO.1):

[0049] Protein molecular weight = 614MW = 69229.9

[0050] Isoelectric point = 6.14

[0051]

[0052]

[0053] 2) The NPM-415 gene sequence used in the example is specifically as follows:

[0054] Template (SEQ ID NO.2):

[0055] C C A G A G A C A A G A A A G A C A A C T A A A G G A AT T C AT T TAT TA C G AT T T G AT A A

[0056] T T T AT T A AT A AT C AT AT A A C A A G T G TA A A A AT A C T G A CTA AT T T C A C A A A C

[0057] C T T A AT T T A AT G T A G A C T C AT AT T T A A A A G A A C C T C AG T AT A G A A ATA G AT

[0058] C T C A AT T G A G A G A C C A C C AT C T T A C T T T T T AT C T A CA A C T T G ATA C G T T T C

[0059] T C T G T A A AT T A A AT A A C T A C A G AT A C T T C A C A A C A CC A A G G A AT T G G T G T

[0060] A A A G A A A A A A A A A A A A A G G T C C G ATA A G T T C TA G A GA C C G T C A C C T C C T T

[0061] C A G A G A A AT T C T T T T AT C A A AT T T G T T A A A C A AT T T TT TA A A A G G C A G A AT

[0062] AAAGTAAAGAC AT TGTCAACT ATA GACCGACAGGA AA A ATAT TA CGTCTC

[0063] ACTCTTGAAAGGGATGGCACAAACTATTTACAACAGG

[0064] Primer (SEQ ID NO.3):

[0065] GGTCTCTGTTCTTTCTGTTGATTTCC

[0066] 3) Performance test of MOSFET device after modification

[0067] A blank physiological buffer solution (37°C, 10 mM Tris, 50 mM NaCl, 10 mM MgCl2, 100 μM DTT, pH 7.8) was injected into the reaction cavity, and the output curve of the test device (V DS :0-500mV、V GS :20-340mV), proving that the device has good gate responsiveness after modification ( Figure 2 a).

[0068] 4) Blank control experiment of MOSFET devices

[0069] A blank physiological buffer solution (37°C, 10 mM Tris, 50 mM NaCl, 10 mM MgCl2, 100 μM DTT, pH 7.8) was added to the reaction chamber, and the current signal was recorded in real time ( Figure 2 c), the current value presents a single Gaussian distribution.

[0070] 5) Single-molecule polymerase modification based on MOSFET devices

[0071] Using a high-precision electron beam exposure system, a hole with a diameter of about 20 nm was opened on the PMMA surface of the gate. A buffer solution containing polymerase protein (100nM KF, 37°C, 10mM Tris, 50mM NaCl, 10mMMgCl2, 100μM DTT, pH 7.8) was injected into the reaction chamber, and a single polymerase was modified on the gate surface using a negative pressure cycle scan. The MOSFET modified with a single polymerase exhibited a transfer curve with current value fluctuations, proving the successful connection of the polymerase protein ( Figure 2 b).

[0072] 6) Real-time DNA sequencing experiment based on single-molecule polymerase modified MOSFET device

[0073] After a single polymerase was modified, the MOSFET device was tested in real time in a physiological buffer solution (37°C, 1μM primer-template complex chain, 2.5μM dATP, 2.5μM dTTPSα, 1.25μM ddCTPSα, 1.25μM dCTPSα, 1.25μM ddGTP, 1.25μM dGTP, 10mM Tris, 50mM NaCl, 10mM MgCl2, 100μM DTT, pH 7.8). It can be observed that after the addition of substrate and template chain, the conductance value of the MOSFET device showed a two-state distribution, proving that the chain polymerization process of KF polymerase on the NPM-415 sequence was successfully captured ( Figure 2 c).

[0074] Through the above embodiments of the present invention, the present invention provides regional transformation and microfluidic packaging of MOSFET devices, as well as single-molecule polymerase modification of MOSFET devices, and obtains a biosensor based on MOSFET devices. Through a DNA sequencing example, the performance of the MOSFET device after transformation was verified, proving that the device has good gate responsiveness after transformation. In real-time testing, real-time single-molecule electrical sequencing was performed in combination with the biological sample sequence NPM-415 to achieve the goal of accurate single-base identification, proving the practical value of this technology in the field of precision medicine, and providing an important application reference for realizing the broad-spectrum application of MOSFET in the single-molecule sequencing market. The single-molecule gene sequencing technology based on MOSFET of the present invention can realize real-time single-base sequencing of non-amplified genes. It can further perform highly integrated, small, portable, high-throughput, low-cost gene sequencing.

[0075] It should be further explained that the above implementation modes are only used for understanding the technical solutions of the present invention, and are not used to limit the protection scope of the present invention. Any obvious changes and adjustments made to the technical solutions of the present invention within the technical concept of the present invention should also fall within the protection scope of the present invention.

Claims

1. Single-molecule gene sequencing biosensor based on MOSFET device, characterized by: The gate and source-drain regions of the MOSFET device are successively plated with chromium and gold surfaces. After the gate is coated with PMMA coating, high-precision electron beam exposure is used to develop a hole that can only accommodate a single polymerase. The PDMS microchannel is attached around the gate to form a micro reaction chamber. The negatively charged polymerase is driven into the high-potential PMMA hole using a negative pressure cycle scanning method, forming a gold-sulfur bond connection with the gold atom of the bottom gate, completing the modification of a single polymerase on the gate.

2. The single-molecule gene sequencing biosensor based on MOSFET device according to claim 1, characterized in that: The central area of ​​the gate has a gate hole with a pattern of 20 nm exposed. The polymerase is a negatively charged (Klenow Fragment) KF polymerase, which has an amino acid sequence shown in SEQ ID NO.

1.

3. The single-molecule gene sequencing biosensor based on MOSFET device according to claim 1, characterized in that: The coating is chromium and gold, with chromium: 5nm and gold: 100nm.

4. The method for preparing a single-molecule electrical biosensor based on a MOSFET device according to any one of claims 1 to 3, characterized in that: include:

1. Regional transformation and microfluidic packaging of MOSFET devices 1.1) Use template overlay to expose only the gate and source and drain surface areas, and then use wet etching to remove Al / Al2O3 on the gate and source and drain surfaces of product-grade MOSFET devices; 1.2) Subsequently, chromium and gold are plated on the gate and source / drain regions by thermal evaporation technology, with 5 nm chromium and 100 nm gold, and the residual photoresist is removed by acetone; 2. Single-molecule polymerase modification of MOSFET devices 2.1) A layer of PMMA is spin-coated and thermally cured on the device surface, and then a prefabricated window with an aperture of about 20 nm is exposed in the center area of ​​the gate using a high-precision electron beam exposure system; 2.2) The device after electron beam exposure is subjected to low temperature development, and the developer is 3 / 1 volume ratio of isopropyl alcohol / MIBK, so as to obtain a gate hole with a pattern exposure of 20 nm; 2.3) The specially made PDMS microchannel reactor was cleaned with oxygen plasma for 30 seconds to improve the substrate adhesion of PDMS, and finally the PDMS microchannel was attached to the gate epitaxial region of the device to form a micro reaction chamber for physiological liquid phase testing; 2.4) 20 μL of physiological buffer solution containing DNA polymerase was injected into the microfluidic reaction chamber, and a gate probe at one end was immersed in the upper part of the solution. Through negative pressure circulation scanning, the negatively charged KF polymerase was driven into the bottom of the ~20 nm hole with high potential; 2.5) The subthreshold swing changes in the scanning transfer curve and the invariance of the curve after cyclic scanning can prove the successful connection of the gold-sulfur bond between the thiol group of a single KF polymerase in the hole and the gold atom of the gate.

5. The method for preparing a single-molecule electrical biosensor based on a MOSFET device according to claim 4, characterized in that: In step 1.1), the template overlay conditions are: photolithography for 40 seconds and development for 15 seconds; the wet etching method conditions are TranseneAluminum Etchant Type A etching solution and immersion at 50° C. for 45 minutes.

6. The method for preparing a single-molecule electrical biosensor based on a MOSFET device according to claim 4, characterized in that: In step 2.1, the spin coating thermal curing conditions are 180°C and 2 min.

7. The method for preparing a single-molecule electrical biosensor based on a MOSFET device according to claim 4, characterized in that: In step 2.2), low temperature development is performed at 4°C for 40 seconds.

8. The method for preparing a single-molecule electrical biosensor based on a MOSFET device according to claim 4, characterized in that: In step 2.4), the physiological buffer solution containing DNA polymerase includes 200 nM KF, 10 mM Tris, 50 mM NaCl, 10 mM MgCl2, 100 μM TCEP, and has a pH value of 7.

8.

9. The single-molecule gene sequencing method based on MOSFET devices according to any one of claims 1 to 3, characterized in that: include: 1) The reaction chamber is replaced with a physiological buffer solution containing 1 μM template-primer complex chain and substrate; 2) The test process is to apply +0.1V gate voltage to the gate area, input +0.1V voltage to the source and drain, turn on the working state of the MOSFET constant current area, and use a phase-locked amplifier combined with a current amplifier to record the source and drain current of the device in real time, with a sampling frequency of 57.6kHz.

10. The single-molecule gene sequencing method based on MOSFET device according to claim 9, characterized in that: The substrates include adenine deoxynucleotide: 2.5 μM, thiothymine deoxynucleotide: 2.5 μM, thiocytosine dideoxynucleotide: 1.25 μM, thiocytosine deoxynucleotide: 1.25 μM, guanine dideoxynucleotide: 1.25 μM or guanine deoxynucleotide: 1.25 μM. The buffer solution included 10 mM Tris, 50 mM NaCl, 10 mM MgCl2, and 100 μM DTT, and the pH value was 7.8.

Images