A SNP molecular marker related to intramuscular fat deposition of pigs and application thereof

Abstract

The application discloses a PINK1 gene SNP marker related to intramuscular fat deposition of pigs, which is the 1240th nucleotide g.414G>A of the PINK1 gene on the 6th chromosome of the pig. The molecular marker can affect the intramuscular fat deposition of the pig, and the intramuscular fat content of the population can be improved by selecting the SNP site of the pig, so as to improve the pork quality and improve the production efficiency.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology and molecular markers, and relates to an application of a PINK1 gene polymorphic site in the genetic improvement of pig intramuscular fat deposition traits. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance some understanding of the overall background of the invention and should not be necessarily regarded as an admission or any form of suggestion that the information constitutes the prior art already known to those skilled in the art.

[0003] As people's living standards improve, their demand for higher-quality animal products is also increasing. As a major pork consumer, intramuscular fat deposition in pigs is crucial for producing high-quality meat products in my country's livestock industry. Currently, lean pigs are widely raised for their high yield, rapid growth, and high feed conversion rates. However, this high leanness is accompanied by a decrease in intramuscular fat content, which affects the taste and flavor of the pork.

[0004] PINK1 (PTEN-induced putative kinase 1), a 581-amino acid polypeptide, is a serine / threonine kinase localized to depolarized mitochondria. It is expressed in cells throughout the body, with particularly high expression in energy-intensive organs such as the heart, muscle, and brain. Within cells, it is primarily localized in the inner mitochondrial membrane. Its N-terminus resembles a mitochondrial targeting signal, followed by a hydrophobic transmembrane region that serves as a termination signal for inner mitochondrial membrane translocation. Residues 156 to 509 constitute a serine / threonine domain, followed by a C-terminal domain that serves as a retention signal at the outer mitochondrial membrane. In normal mitochondria, PINK1 is continuously translocated to the inner mitochondrial membrane, where it is cleaved by the inner mitochondrial membrane protease PARL, generating an N-terminal degradation motif and subsequently cleared. Consequently, PINK1 levels are extremely low, making it difficult to detect. However, when the mitochondrial membrane potential is impaired, PINK1's access to the inner mitochondrial membrane is blocked. PINK1 accumulates at the outer mitochondrial membrane and recruits parkin to the damaged mitochondria to activate its E3 enzyme activity. Parkin then ubiquitinates mitochondrial outer membrane proteins, which are then phosphorylated by PINK1. Phosphorylated ubiquitin-modified outer membrane proteins are then recognized by autophagy adaptor proteins (such as p62, NDP52, and OPTN), initiating mitophagy. Mitophagy, a crucial mitochondrial quality control mechanism, primarily recognizes and eliminates dysfunctional mitochondria through ubiquitination-dependent recognition. Previous studies have revealed how mitophagy regulates muscle-fat metabolic communication, suggesting that mitophagy plays a crucial role in lipid homeostasis. The PINK1 protein level in pigs with the PINK1 gene g.1240G>A mutation was not significantly reduced, but its kinase activity was persistently and significantly reduced. Molecular modeling, kinetic simulation, and multiple functional assays showed that the G1240A mutation interfered with the ubiquitin phosphorylation of wild-type PINK1 in the heterodimeric complex, which impaired the protective function of PINK1 / parkin-mediated mitochondrial quality control. Summary of the Invention

[0005] The present invention screens out a PINK1 gene SNP marker capable of regulating pig intramuscular fat deposition to address the deficiencies and shortcomings of the prior art. The present invention also provides a primer pair and a kit for detecting the SNP molecular marker, a method for screening pig breeds with high intramuscular fat traits, and a method for genetic improvement of pigs.

[0006] The technical solution adopted in the present invention is as follows:

[0007] In a first aspect of the present invention, a single-nucleotide polymorphism (SNP) marker of the PINK1 gene associated with intramuscular fat deposition in pigs is provided. The SNP marker is located at nucleotide position 1240, g.1240G>A, of the PINK1 gene on pig chromosome 6. The sequence of the SNP molecular marker is shown in SEQ ID NO: 1. The SNP molecular marker is located at position 157 from the 5' end of the nucleic acid sequence of SEQ ID NO: 1, and its base is G or A.

[0008] SEQ ID NO: 1 is shown below:

[0009] 5'-GCTCACAGAGACCTGAAGTCTGACAACATCCTTGTGGAGCTGG ATGCAGACGGCTGCCCCTGGTTGGTGATCGCAGACTTCGGCTGCTGCCTGGCCGATGAGCGCGTGGGCCTGCAGCTGCCTTTCACCAGCTGGTACGTGGACCGCGGCGGAAACGGCTGCCTGATGGCTCCTGAGGTGTCCACGGCCTGCCCTGGCCCCAGGGCGGTGATTGACTACAGCAAGGCTGACGCCTGGGC GGTGGGAGCGCTCGCCTACGAAATCTTCGGGGCTCTCCAACCCCTTTTATGGCCAAGCAGGGGCCCACCTTGAAAGCCGCAGTTACCAAGAAGCTCAGCTTCCAGCGCTGCCCGAATCAGTGCCTCTAGACGTGAGACAGCTGGTGAGGTCGCTGCTCCAGCGAGATGCCAGCAAGAGGCCATCCGCCCGCGTG-3'

[0010] In a second aspect of the present invention, a primer pair is provided for detecting the SNP molecular marker of the PINK1 gene associated with pig intramuscular fat deposition, the primer pair consisting of an upstream primer and a downstream primer; the upstream primer is shown in SEQ ID NO: 2; the downstream primer is shown in SEQ ID NO: 3;

[0011] SEQ ID NO: 2: PINK1-F: 5'-GCTCACAGAGACCTGAAGTCT-3';

[0012] SEQ ID NO: 3: PINK1-R: 5'-CACGCGGCGGATGGCCTCTT-3'.

[0013] In a third aspect of the present invention, a kit for detecting the SNP molecular marker is provided, comprising the primer pair.

[0014] In a fourth aspect of the present invention, there is provided a use of the SNP molecular marker, the primer pair or the kit in any one of the following:

[0015] a) preparing a product for identifying the regulation of intramuscular fat deposition in pigs;

[0016] b) Molecular marker-assisted breeding of pigs;

[0017] c) preparing products that influence the regulation of intramuscular fat deposition in pigs.

[0018] In a fifth aspect of the present invention, a method for identifying the genotype of a SNP molecular marker associated with the regulation of pig intramuscular fat deposition is provided, comprising the following steps:

[0019] (1) Extracting genomic DNA from the pig to be tested;

[0020] (2) performing PCR amplification on the genomic DNA obtained in step (1) using the above primer pair to obtain a PCR amplification product;

[0021] (3) sequencing the PCR amplification product obtained in step (2) to obtain a sequencing result;

[0022] (4) based on the sequencing results, determining whether the genotype of the SNP molecular marker affecting the regulation of intramuscular fat deposition on chromosome 6 of the tested pig is GG, GA, or AA;

[0023] Through analysis of the results, the intramuscular fat deposition ability of pigs with GG, GA and AA genotypes was AA>GA>GG.

[0024] In one or some embodiments of the present invention, in step (2), 5 μL of 2×PCR Mix reagent, 1 μL of DNA template, 0.5 μL each of the primers shown in SEQ ID NO: 2 and SEQ ID NO: 3, and 3 μL of ddH2O are taken to form a 10 μL amplification system.

[0025] In a sixth aspect of the present invention, a method for genetic improvement of pigs is provided, comprising the following steps:

[0026] The above-mentioned SNP molecular markers associated with intramuscular fat deposition in pigs are determined in the core group of breeding pigs, and corresponding selections are made based on the SNP molecular markers: breeding pig individuals with the AA genotype at site 1240 on chromosome 6 of the pig genome are selected from the core group of breeding pigs, and breeding pig individuals with the GG genotype at site 1240 are eliminated, so as to increase the frequency of the allele AA at this site from generation to generation, thereby increasing the intramuscular fat deposition of offspring pigs.

[0027] Compared with the related art known to the inventors, one of the technical solutions of the present invention has the following beneficial effects:

[0028] (1) The present invention increases the intramuscular fat content of the pig population by selecting this SNP site, thereby improving the quality of pork and increasing production efficiency; it can be used for molecular marker-assisted breeding, can be used for early selection of breeding pigs, and significantly promote the breeding process of breeding pigs.

[0029] (2) The method of detecting the SNP site at position 157 from the 5' end of the nucleotide sequence shown in SEQ ID NO: 1 by using a pair of primers shown in SEQ ID NO: 2 and SEQ ID NO: 3 is accurate, reliable and easy to operate. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] The accompanying drawings, which constitute a part of the specification of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0031] Figure 1 : Manhattan plot of genome-wide association analysis (GWAS) of traits, where the horizontal axis represents the chromosome position of pigs; the vertical axis represents the -logP value. DETAILED DESCRIPTION

[0032] It should be noted that the following detailed descriptions are exemplary and intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present invention belongs.

[0033] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is intended to include the plural form. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, they indicate the presence of features, steps, operations and / or combinations thereof.

[0034] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0035] SNP screening:

[0036] (1) Data collection

[0037] Data were collected from purebred Large White boars on a pig farm. The pigs were provided with free access to food and water, and the feeding regimen and housing conditions were consistent throughout. Before slaughter, ear tissue samples were collected from all test pigs and stored in 75% ethanol for the extraction of porcine genomic DNA. After slaughter, longissimus dorsi muscle samples were obtained from the left carcass for muscle fat content determination. The results were measured using petroleum ether extraction, with the average of three measurements taken.

[0038] (2) Extraction and detection of genomic DNA

[0039] The TSINGKE TSP202-200 high-efficiency animal genomic DNA extraction kit was used. Porcine genomic DNA was extracted from pig ear tissue using the Hi-Pure Animal Genomic DNA Kit. The quality and concentration of the extracted DNA were assessed using a NanoDrop 2000 Nucleic Acid and Protein Analyzer (Thermo Fisher Scientific, USA). The curves were steep and smooth, with A260 / A280 ratios between 1.8 and 2.0, and A260 / A230 between 2.0 and 2.5. 50-100 ng of the extracted DNA was subjected to 1% agarose gel electrophoresis. Bright, concentrated bands indicated high DNA purity.

[0040] (3) Genetic analysis and quality control

[0041] Whole-genome DNA from pigs was hybridized to the Porcine SNP60 BeadChip developed by Illumina, which contains 61,565 SNPs. Quality control was performed using PLINK, and SNP markers with a genotype missingness (GENO) greater than 0.1, a minimum allele frequency (MAF) less than 0.01, a Hardy-Weinberg equilibrium (HWE) less than 0.001, and a sample detection rate (MIND) less than 0.90 were removed.

[0042] To systematically analyze the genetic basis of the target trait and identify relevant loci, in addition to utilizing SNP data from the PorcineSNP60 BeadChip, we also conducted independent genome-wide association analysis, successfully identifying a new locus that was not included in the markers on existing arrays. This discovery, based on genome-wide data analysis, further validated its potential role in the target trait.

[0043] The analysis results are as follows Figure 1 As shown. Figure 1It can be seen that there is a site on chromosome 6 of molecular marker which significantly affects intramuscular fat deposition, and the significantly associated SNP is g.157G>A at the 157th nucleotide in SEQ NO. 1.

[0044] Detection and verification of SNP molecular markers of samples:

[0045] (1) The genomic DNA of the pig to be tested was extracted by using the high-efficiency animal genomic DNA extraction kit (TSINGKE TSP202-200 Hi-Pure Animal Genomic DNA Kit) of Tsingke Biological Company, and the detailed steps were as follows:

[0046] 1) The pig's ear sample was cut into pieces with clean surgical scissors, 20 μL Proteinase K was added and mixed, and then the tissue was enzymolyzed at 56°C overnight water bath until no granular feeling was felt;

[0047] 2) 200 μL Buffer GB was added to the digestion solution, vortexed to mix, and then 56°C water bath for 10 min;6.

[0048] 200 μL of anhydrous ethanol was added to the digestion solution and vortexed to mix;

[0049] 3) The adsorption column was placed in the collection tube, and then the mixed solution obtained in the previous step was transferred to the adsorption column, and centrifuged at 12,000

[0050] rpm (~13,400×g) for 1 min;

[0051] 4) Discard the waste liquid, put the adsorption column back into the collection tube, add 500 μL Buffer WB1 to the adsorption column,

[0052] 12,000 rpm (~13,400×g) centrifugation for 30 s;

[0053] 5) Discard the waste liquid, put the adsorption column back into the collection tube, add 600 μL Buffer WB2 to the adsorption column, and centrifuge at 12,000 rpm (~13,400×g) for 30 s;

[0054] 6) Repeat step 5);

[0055] 7) Discard the waste liquid, put the adsorption column back into the collection tube, and centrifuge at 12,000 rpm (~13,400×g) for 2 min. The adsorption column was placed at room temperature for a few minutes, and the residual rinse solution was completely dried;

[0056] 8) Place the adsorption column in a new 1.5 mL centrifuge tube, add 50-100 μL TEBuffer or ddH2O (better effect after 65°C heat bath) to the middle of the adsorption film, place at room temperature for 5 minutes, and centrifuge at 12000 rpm (13400 rpm).

[0057] × g) for 2 min to collect the DNA solution.

[0058] (2) PCR amplification is performed on the genomic DNA obtained in step (1) using the above primer pair to obtain a PCR amplification product. The amplification system is as follows:

[0059] 1) Take 5 μL of 2×PCR Mix reagent, 1 μL of DNA template, SEQ ID NO: 2 and SEQ ID NO:

[0060] 0.5 μL of each primer shown in 3 and 3 μL of ddH2O constitute a 10 μL amplification system;

[0061] 2) Set the PCR amplification conditions as follows: 94°C, 3 min; 29 cycles (94°C, 25 s; 56°C, 25 s; 72°C, 10 s); 72°C, 5 min; 4°C, ∞.

[0062] (3) sequencing the PCR amplification product obtained in step (2) to obtain a sequencing result;

[0063] (4) based on the sequencing results, determining whether the genotype of the SNP molecular marker affecting the regulation of intramuscular fat deposition on chromosome 6 of the tested pig is GG, GA, or AA;

[0064] By analyzing the results in Tables 1 and 2, the intramuscular fat deposition ability of pigs with GG, GA and AA genotypes is AA>GA>GG.

[0065]

[0066]

[0067] Among them, there were 29 pigs with GG genotype: 001, 004, 008, 009, 010, 013, 017, 020, 021, 024, 030, 035, 036, 039, 041, 043, 047, 048, 049, 060, 061, 068, 077, 080, 081, 082, 090, 095, 098;

[0068] There were 48 pigs with GA genotype: 002, 005, 006, 007, 012, 014, 016, 019, 025, 028, 029, 031, 032, 033, 034, 037, 040, 042, 044, 045, 050, 053, 054, 055, 056, 058, 059, 062, 063, 066, 067, 069, 070, 071, 072, 073, 074, 076, 078, 083, 086, 087, 089, 091, 093, 094, 096, 100;

[0069] There were 23 pigs with AA genotype: 003, 011, 015, 018, 022, 023, 026, 027, 038, 046, 051, 052, 057, 064, 065, 075, 079, 084, 085, 088, 092, 097, and 099.

[0070] According to Tables 1 and 2, the effect of the G→A mutation at the 1240th nucleotide of the PINK1 gene on chromosome 6 of the molecular marker SNP site on the intramuscular fat content indicates that this molecular marker can affect the intramuscular fat deposition of pigs. By selecting this SNP site in pigs, the intramuscular fat content of the group can be increased, thereby improving pork quality and increasing production efficiency.

[0071] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. A PINK1 gene SNP molecular marker associated with intramuscular fat deposition in pigs, characterized by: The sequence of the SNP molecular marker is shown in SEQ ID NO:

1.

2. Use of the SNP molecular marker according to claim 1 in any of the following: a) preparing products for identifying traits regulating intramuscular fat deposition in pigs; b) Molecular marker-assisted breeding of pigs, the specific trait of assisted breeding is intramuscular fat deposition in pigs.

3. A method for identifying the genotype of the SNP molecular marker according to claim 1 that is related to the regulation of intramuscular fat deposition in pigs, characterized in that: The following steps are included: (1) Extracting genomic DNA from the pig to be tested; (2) performing PCR amplification on the genomic DNA obtained in step (1) using a primer pair to obtain a PCR amplification product; the primer pair comprises an upstream primer and a downstream primer; the upstream primer is shown in SEQ ID NO: 2; the downstream primer is shown in SEQ ID NO: 3; (3) sequencing the PCR amplification product obtained in step (2) to obtain a sequencing result; (4) based on the sequencing results, determining whether the genotype of the SNP molecular marker affecting the regulation of intramuscular fat deposition in the tested pig is GG, GA, or AA; Through analysis of the results, the intramuscular fat deposition ability of pigs with GG, GA and AA genotypes was AA>GA>GG.

4. The method for identifying the genotype of the SNP molecular marker according to claim 1 that is related to the regulation of pig intramuscular fat deposition according to claim 3, wherein: In step (2), 5 μL of 2×PCR Mix reagent, 1 μL of DNA template, 0.5 μL each of the primers shown in SEQ ID NO: 2 and SEQ ID NO: 3, and 3 μL of ddH2O were taken to form a 10 μL amplification system.

5. A method for genetic improvement of pigs, characterized by: The following steps are included: Determine the PINK1 gene SNP molecular marker associated with pig intramuscular fat deposition as described in claim 1 for the breeding pigs in the breeding pig core group, and make corresponding selections based on the SNP molecular markers: select breeding pig individuals with SNP genotype AA in the breeding pig core group, and eliminate breeding pig individuals with SNP genotype GG, so as to increase the frequency of the allele AA at this site, thereby increasing the intramuscular fat deposition of offspring pigs.

Images