An SSR core primer combination, kit and application for identifying the tea tree variety "Wuye Dancong"

Abstract

The present invention discloses an SSR core primer combination, a kit and an application for identifying the tea tree variety "Wuye Dancong". By using the SSR fluorescence labeling detection technology, the present invention screens and obtains 2 pairs of SSR core primers, and these 2 pairs of SSR core primers can quickly identify and detect "Wuye Dancong" from other tea tree varieties. The SSR core primer combination disclosed by the present invention can be used for variety identification of "Wuye Dancong", overcomes the uncertainty of identification based on external morphological characteristics, has reliable and intuitive results, high detection efficiency, simple operation, and is also conducive to the popularization, utilization and protection of the variety "Wuye Dancong".

Description

Technical Field

[0001] The present invention relates to the technical field of identification of variety resources and germplasm innovation, and particularly relates to an SSR core primer combination, a kit and an application for identifying the tea tree variety "Wuye Dancong". Background Art

[0002] "Wuye Dancong" is systematically selected from natural variant strains in the tea tree community of Phoenix Narcissus. It belongs to the small tree type, medium leaf type, and late-growing variety. The tree posture is spreading, and the branches are relatively dense. The leaves are obliquely attached, oblong in shape, dark green in color, slightly convex and folded inward on the leaf surface, wavy on the leaf margin, with blunt and sparse leaf teeth, gradually pointed leaf tips, wedge-shaped leaf bases, and thick and brittle leaf quality. The flower petals are 3-5 petals, the ovary has no pubescence, the style is 3-lobed, the stamens and pistils are of equal height, and the fruit is spherical. It is suitable for making high-grade oolong tea and black tea, with a strong gardenia flower fragrance and honey rhyme. When making oolong tea, the shape of the tea strips is straight, even and neat, black-brown in color, shiny and oily, the aroma is high, sharp and persistent, the gardenia flower fragrance is obvious, the taste is mellow and refreshing, with strong aftertaste, obvious honey rhyme, resistant to brewing, the soup color is golden yellow, bright, clear, the tea leaves at the bottom are even, soft and bright, with red edging; when making high-grade black tea, the shape is tight and black and shiny, the flower fragrance is strong and persistent, the taste is thick, fresh and refreshing with obvious sweet rhyme, the soup color is dark red, bright with a golden circle, and the tea leaves at the bottom are red and even and bright.

[0003] At present, the identification of the tea tree variety "Wuye Dancong" is judged by the identifier based on personal understanding of "Wuye Dancong" and its external morphological characteristics. The identification results are easily affected by factors such as the development stage, cultivation measures, personal ability of the identifier, and the growth environment of "Wuye Dancong", resulting in great uncertainty.

[0004] Molecular marker technology can quickly, accurately and efficiently identify varieties. Among them, simple sequence repeat (SSR) has the advantages of co-dominance, good repeatability, easy detection, simple operation, etc. Therefore, SSR molecular markers have good application prospects in variety specificity evaluation and protection. Summary of the Invention

[0005] To overcome the above-mentioned defects and deficiencies in the prior art, the present invention provides an SSR core primer combination, a kit and an application for identifying the tea tree variety "Wuye Dancong".

[0006] The first object of the present invention is to provide an SSR core primer combination for identifying the tea tree variety "Wuye Dancong".

[0007] The second object of the present invention is to provide the application of the above SSR core primer combination in the preparation of an identification product for the tea tree variety "Wuye Dancong".

[0008] The third object of the present invention is to provide the application of a product containing the above SSR core primer combination in identifying the tea tree variety "Wuye Dancong".

[0009] The fourth object of the present invention is to provide a kit for identifying the tea tree variety "Wuye Dancong".

[0010] The fifth object of the present invention is to provide a method for identifying the tea tree variety "Wuye Dancong".

[0011] To achieve the above object, the present invention provides an SSR core primer combination for identifying the tea tree variety "Wuye Dancong", and the SSR core primer combination includes SSR core primers with nucleotide sequences shown as WY.SSR-1-F, WY.SSR-1-R, WY.SSR-2-F and WY.SSR-2-R; wherein: the primer sequence of WY.SSR-1-F is: GGCGAATGTTGAAGGTGCTG; the primer sequence of WY.SSR-1-R is: ATCGCCACTTTTGGGATCGA; the primer sequence of WY.SSR-2-F is: GCAATCTGGAGACCGAAGCT; the primer sequence of WY.SSR-2-R is: TTGTCGTCTGAGGAGCAACC.

[0012] The 5'-end of the SSR core primer shown by the nucleotide sequence WY.SSR-1-F and / or the 5'-end of the SSR core primer shown by the nucleotide sequence WY.SSR-2-F are labeled with a fluorescent reporter group.

[0013] The fluorescent reporter group is FAM, HEX, TAMRA or ROX.

[0014] The application of the above SSR core primer combination in preparing an identification product for the tea tree variety "Wuye Dancong".

[0015] The application of the product of the above SSR core primer combination in identifying the tea tree variety "Wuye Dancong".

[0016] A kit for identifying the tea tree variety "Wuye Dancong", which includes the above SSR core primer combination.

[0017] The kit further includes HSTaq DNA polymerase, dNTPs, 10× Buffer, positive control reference, negative control reference, and ultrapure water.

[0018] A method for identifying the tea tree variety "Wuye Dancong" is to identify by using the above SSR core primer combination or the above kit.

[0019] A method for identifying the tea tree variety "Wuye Dancong" includes the following steps:

[0020] S1. Extract the genomic DNA of the tea plant sample to be tested;

[0021] S2. Using the genomic DNA extracted in step S1 as a template, perform PCR amplification with the above SSR core primer combination;

[0022] S3. Type the PCR amplification products obtained in step S2, and judge the bands of the typing results:

[0023] When the SSR core primers with nucleotide sequences WY.SSR-1-F and WY.SSR-1-R amplify two characteristic bands of 145 bp and 160 bp, and the SSR core primers with nucleotide sequences WY.SSR-2-F and WY.SSR-2-R amplify two characteristic bands of 146 bp and 149 bp, it indicates that the tea plant sample to be tested is "Wuye Dancong"; the appearance of other bands indicates that the tea plant sample to be tested is not "Wuye Dancong".

[0024] The typing method described in step S3 above is to perform capillary electrophoresis on the PCR amplification products; for PCR amplification, the total reaction system is 10 μL, including: 1 μL of 10×Buffer I, 0.8 μL of 2.5 mM dNTPs, 0.6 μL of 2.5 μM upstream primer, 0.6 μL of 2.5 μM downstream primer, 0.1 μL of TAKARA HSTaq, 1 μL of DNA, and ddH2O is added to make up 10 μL; the PCR amplification reaction conditions are: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s; annealing at 60°C for 30 s for 35 cycles; extension at 72°C for 30 s; finally, extension at 60°C for 30 min.

[0025] Advantages and effects of the present invention:

[0026] The present invention discloses an SSR core primer combination, kit and application for identifying the tea tree variety "Wuye Dancong". The present invention uses the SSR fluorescence labeling detection technology to screen out 2 pairs of SSR core primers, and these 2 pairs of SSR core primers can quickly identify and detect "Wuye Dancong" from other tea tree varieties. The SSR core primer combination disclosed by the present invention can identify the variety of "Wuye Dancong", overcomes the uncertainty of identification based on external morphological characteristics, has reliable and intuitive results, high detection efficiency, simple operation, and is also beneficial to the popularization, utilization and protection of the variety of "Wuye Dancong". Description of the Drawings

[0027] Figure 1 Capillary electrophoresis bands of 28 tea tree varieties / lines amplified by the specific SSR core primers WY.SSR-1-F and WY.SSR-1-R in Example 1.

[0028] Figure 2 Capillary electrophoresis bands of 28 tea tree varieties / lines amplified by the specific SSR core primers WY.SSR-2-F and WY.SSR-2-R in Example 1.

[0029] Figure 3 Capillary electrophoresis bands of 30 tea tree varieties / lines amplified by the specific SSR core primers WY.SSR-1-F and WY.SSR-1-R in Example 2.

[0030] Figure 4 Capillary electrophoresis bands of 30 tea tree varieties / lines amplified by the specific SSR core primers WY.SSR-2-F and WY.SSR-2-R in Example 2. Detailed implementation manners

[0031] The following specific examples are used to further illustrate the present invention, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in the technical field.

[0032] Unless otherwise specified, the reagents and materials used in the following examples are all commercially available.

[0033] Example 1 Obtaining of specific primer sequences of "Wuye Dancong"

[0034] I. Experimental methods

[0035] 1. SSR primer design

[0036] The MISA software was used to retrieve the genomic sequences in the tea tree genome database (http: / / tpia.teaplants.cn / ), and SSR loci in the genomic sequences were retrieved. 200 pairs of SSR primers were designed in batches using Primer 5.0, and the primers were synthesized by Beijing Yuewei Gene Technology Co., Ltd.

[0037] 2. Extraction of tea tree variety DNA

[0038] Twenty-eight tea tree varieties / lines with similar kinship and phenotypes such as "Wuye Dancong", "Lingtou Dancong", "Dancong No. 1", and "Huangjingui", as well as the hybrid offspring of Wuye Dancong and Yinghong No. 9 (numbers A16 - A28) were preliminarily screened. The specific tea tree varieties / lines used for the preliminary screening are shown in Table 1 (obtained from the Tea Germplasm Resource Bank of Guangdong Province).

[0039] Table 1 Twenty-eight tea tree varieties / lines used for the preliminary screening

[0040]

[0041] Extract the DNA of 28 tea tree varieties / lines (Table 1) used for preliminary screening. The specific steps for DNA extraction are as follows:

[0042] a) Add liquid nitrogen to tea tree leaves and grind them thoroughly. Weigh approximately 100 mg of the ground powder.

[0043] b) Quickly add 400 μL of buffer GPS and 10 μL of RNase A to the ground powder. After quickly vortexing and mixing, place the centrifuge tube in a 65 °C water bath for 15 min. During the water bath, invert the centrifuge tube several times to mix the sample.

[0044] c) Add 100 μL of buffer GPA, vortex for 1 min, centrifuge at 12000 rpm for 5 min, transfer the supernatant to the filter column CS, then centrifuge at 12000 rpm for 1 min, and transfer the filtrate to a new centrifuge tube.

[0045] d) Add an equal volume of absolute ethanol and mix well. At this time, flocculent precipitates may appear.

[0046] e) Transfer both the solution and the flocculent precipitates obtained in the previous step to the RNase-Free adsorption column CR2, centrifuge at 12000 rpm for 1 min, discard the waste liquid, and place the RNase-Free adsorption column CR2 in the collection tube.

[0047] f) Add 550 μL of deproteinization solution RD to the RNase-Free adsorption column CR2, centrifuge at 12000 rpm for 1 min, discard the waste liquid, and place the RNase-Free adsorption column CR2 in the collection tube.

[0048] g) Add 700 μL of washing buffer PW to the RNase-Free adsorption column CR2, centrifuge at 12000 rpm for 1 min, discard the waste liquid, and place the RNase-Free adsorption column CR2 in the collection tube.

[0049] h) Repeat step g.

[0050] i) Place the RNase-Free adsorption column CR2 back into the collection tube, centrifuge at 12000 rpm for 2 min, discard the collection tube, then transfer the RNase-Free adsorption column CR2 to a new centrifuge tube, and air-dry at room temperature for 5 - 10 min.

[0051] j) Add 50 - 100 μL of elution buffer TB to the RNase-Free adsorption column CR2, let it stand at room temperature for 3 - 5 min, centrifuge at 12000 rpm for 2 min, and collect the solution into the centrifuge tube to obtain the tea tree genomic DNA.

[0052] 3. PCR amplification

[0053] Using the genomic DNA of tea plants extracted in Step 2 above as a template, PCR amplification was performed using SSR fluorescence labeling detection technology. The primers included an upstream primer labeled with a fluorescent reporter group at the 5' end (the fluorescent reporter group was FAM, HEX, TAMRA, or ROX, and FAM fluorescence labeling was used in the present invention) and a downstream primer. The PCR amplification guided by the upstream primer labeled with a fluorescent reporter group at the 5' end produced a fluorescent PCR product.

[0054] For the PCR amplification, the total reaction system was 10 μL, including: 1 μL of 10×Buffer I, 0.8 μL of 2.5 mM dNTPs, 0.6 μL of 2.5 μM upstream primer, 0.6 μL of 2.5 μM downstream primer, 0.1 μL of TAKARA HSTaq, 1 μL of DNA, and ddH2O was added to make up 10 μL.

[0055] The PCR amplification reaction conditions were: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s; annealing at 60°C for 30 s for 35 cycles; extension at 72°C for 30 s; and finally extension at 60°C for 30 min.

[0056] 4. Genotyping Detection

[0057] Capillary electrophoresis detection: 9 μL of a mixture of molecular weight internal standard and formamide (volume ratio 0.5:8.5) and 1.0 μL of the PCR product were added to each well of a 96-well plate; denaturation at 95°C for 3 min, and genotyping detection was performed using a 3730XL DNA analyzer.

[0058] 5. Data Analysis

[0059] The original data file obtained by the 3730XL DNA analyzer was imported into the analysis software genemapper ID 3.2 for band discrimination analysis.

[0060] II. Experimental Results

[0061] Two pairs of specific SSR core primers were screened out from 200 pairs of SSR primers, namely WY.SSR-1-F, WY.SSR-1-R, WY.SSR-2-F, and WY.SSR-2-R. The primer sequences are shown in Table 2.

[0062] Table 2 Specific SSR Core Primer Sequences

[0063]

[0064] The capillary electrophoresis band statistical results of these 2 pairs of specific SSR core primers amplifying 28 tea plant varieties / lines (Table 1) are shown in Table 3 and Figures 1-2 as follows. The results showed that characteristic bands appeared in "Wuye Dancong", specifically:

[0065] (1) Two characteristic bands of 145 bp and 160 bp were amplified by the specific SSR core primers WY.SSR-1-F and WY.SSR-1-R;

[0066] (2) Two characteristic bands of 146 bp and 149 bp were amplified by the specific SSR core primers WY.SSR-2-F and WY.SSR-2-R.

[0067] The above results show that two pairs of specific SSR core primers can amplify characteristic bands for the tea cultivar "Wuye Dancong", so "Wuye Dancong" can be distinguished from the other 27 related and phenotypically similar tea cultivars / lines.

[0068] Table 3 Statistical results of capillary electrophoresis bands of two pairs of specific SSR core primers for 28 tea cultivars / lines

[0069]

[0070] Example 2

[0071] Further verification of two pairs of specific SSR core primers

[0072] I. Experimental method

[0073] Two pairs of specific SSR core primers WY.SSR-1-F and WY.SSR-1-R, WY.SSR-2-F and WY.SSR-2-R for identifying "Wuye Dancong" obtained by screening were further verified. Twenty-nine tea cultivars currently popularized and applied in production were selected for amplification detection simultaneously with "Wuye Dancong". The specific 30 tea cultivars are shown in Table 4.

[0074] Table 4 Thirty tea cultivars currently popularized and applied in production

[0075]

[0076] The methods for extracting DNA of tea cultivars, PCR amplification, genotyping detection and data analysis were carried out according to Example 1.

[0077] II. Experimental results

[0078] The statistical results of capillary electrophoresis bands of two pairs of specific SSR core primers amplifying 30 tea cultivars (Table 4) are shown in Table 5 and Figures 3-4 as follows. The results show that only "Wuye Dancong" showed characteristic bands, specifically:

[0079] (1) Two characteristic bands of 145 bp and 160 bp were amplified by the specific SSR core primers WY.SSR-1-F and WY.SSR-1-R;

[0080] (2) Two characteristic bands of 146 bp and 149 bp were amplified by the specific SSR core primers WY.SSR-2-F and WY.SSR-2-R;

[0081] The above results indicate that two pairs of specific SSR core primers can amplify specific allelic loci for the tea cultivar 'Wuye Dancong'. Therefore, 'Wuye Dancong' can be distinguished from the other 29 tea cultivars currently promoted and applied in production.

[0082] Table 5 Statistical results of capillary electrophoresis bands of 30 popularized tea cultivars

[0083]

[0084] Example 3

[0085] A method for identifying 'Wuye Dancong' using a specific SSR core primer combination

[0086] 1. Extract the DNA of the tea cultivar 'Wuye Dancong' according to the method of Example 1;

[0087] 2. Using the DNA extracted in step 1 as a template, perform PCR amplification with two pairs of specific SSR core primers WY.SSR-1-F and WY.SSR-1-R, WY.SSR-2-F and WY.SSR-2-R. The sequences of the two pairs of specific SSR core primers are as follows, and the 5' ends of the upstream primers are all labeled with a fluorescent reporter group (the fluorescent reporter group can be FAM, HEX, TAMRA or ROX, and HEX fluorescent labeling is used in the present invention):

[0088] WY.SSR-1-F: GGCGAATGTTGAAGGTGCTG;

[0089] WY.SSR-1-R: ATCGCCACTTTTGGGATCGA;

[0090] WY.SSR-2-F: GCAATCTGGAGACCGAAGCT;

[0091] WY.SSR-2-R: TTGTCGTCTGAGGAGCAACC;

[0092] 3. The PCR amplification method is carried out according to Example 1:

[0093] Perform genotyping detection and data analysis on the PCR products obtained in step 2. Both the genotyping detection and data analysis methods are carried out according to Example 1.

[0094] 4. Result interpretation:

[0095] If the amplification products of two pairs of specific SSR core primers show the following characteristic bands respectively, it indicates that the tea tree variety to be tested is "Wuye Dancong"; if the following characteristic bands do not appear respectively, it indicates that the tea tree variety to be tested is not "Wuye Dancong":

[0096] (1) The two specific SSR core primers WY.SSR-1-F and WY.SSR-1-R amplify two characteristic bands of 145bp and 160bp;

[0097] (2) The two specific SSR core primers WY.SSR-2-F and WY.SSR-2-R amplify two characteristic bands of 146bp and 149bp.

[0098] Example 4

[0099] A kit for identifying the tea tree variety "Wuye Dancong"

[0100] I. Composition

[0101] (1) Two pairs of specific SSR core primers, with the 5' ends of the upstream primers labeled with fluorescent reporter groups (the fluorescent reporter groups can be FAM, HEX, TAMRA or ROX, and HEX fluorescent labeling is used in the present invention):

[0102] WY.SSR-1-F: GGCGAATGTTGAAGGTGCTG;

[0103] WY.SSR-1-R: ATCGCCACTTTTGGGATCGA;

[0104] WY.SSR-2-F: GCAATCTGGAGACCGAAGCT;

[0105] WY.SSR-2-R: TTGTCGTCTGAGGAGCAACC;

[0106] (2) HSTaq DNA polymerase, dNTPs, 10× Buffer, positive control reference, negative control reference, ultrapure water.

[0107] II. Usage method

[0108] Perform detection and result interpretation according to the method of Example 3.

[0109] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.

Claims

1. A SSR core primer combination for identifying the tea variety "Wuyedancong", characterized in that: The SSR core primer combination comprises SSR core primers represented by nucleotide sequences WY.SSR-1-F, WY.SSR-1-R, WY.SSR-2-F and WY.SSR-2-R; wherein: the primer sequence of WY.SSR-1-F is: GGCGAATGTTGAAGGTGCTG; the primer sequence of WY.SSR-1-R is: ATCGCCACTTTTGGGATCGA; the primer sequence of WY.SSR-2-F is: GCAATCTGGAGACCGAAGCT; the primer sequence of WY.SSR-2-R is: TTGTCGTCTGAGGAGCAACC.

2. The SSR core primer combination according to claim 1, characterized in that The 5' end of the SSR core primer shown in the nucleotide sequence WY.SSR-1-F and / or the 5' end of the SSR core primer shown in the nucleotide sequence WY.SSR-2-F are labeled with a fluorescent reporter group.

3. The SSR core primer combination according to claim 2, characterized in that The fluorescent reporter group is FAM, HEX, TAMRA or ROX.

4. Use of the SSR core primer combination described in any one of claims 1 to 3 in preparing an identification product of the tea variety "Wuyedancong".

5. Use of a product comprising the SSR core primer combination according to any one of claims 1 to 3 in identifying the tea variety "Wuyedancong", characterized in that: When the SSR core primers shown by the nucleotide sequences WY.SSR-1-F and WY.SSR-1-R amplify two characteristic bands of 145bp and 160bp, and the SSR core primers shown by the nucleotide sequences WY.SSR-2-F and WY.SSR-2-R amplify two characteristic bands of 146bp and 149bp, it indicates that the tea tree sample to be tested is "Wuye Dancong"; the appearance of other bands indicates that the tea tree sample to be tested is not "Wuye Dancong".

6. A kit for identifying the tea variety "Wuyedancong", characterized in that: Comprising the SSR core primer combination described in any one of claims 1 to 3.

7. The kit according to claim 6, characterized in that The kit also includes HSTaq DNA polymerase, dNTPs, 10×Buffer, a positive control reference substance, a negative control reference substance and ultrapure water.

8. A method for identifying the tea variety "Wuye Dancong", characterized in that: Identification is performed using the SSR core primer combination described in any one of claims 1 to 3 or the kit described in any one of claims 6 to 7. When the SSR core primers shown by the nucleotide sequences WY.SSR-1-F and WY.SSR-1-R amplify two characteristic bands of 145bp and 160bp, and the SSR core primers shown by the nucleotide sequences WY.SSR-2-F and WY.SSR-2-R amplify two characteristic bands of 146bp and 149bp, it indicates that the tea tree sample to be tested is "Wuye Dancong"; the appearance of other bands indicates that the tea tree sample to be tested is not "Wuye Dancong".

9. The method according to claim 8, characterized in that The following steps are involved: S1. Extracting genomic DNA from the tea tree sample to be tested; S2. Using the genomic DNA extracted in step S1 as a template, PCR amplification is performed using the SSR core primer combination described in any one of claims 1 to 3; S3. Typing the PCR amplification product obtained in step S2, and performing band identification on the typing results.

Images